Starting /dee2/code/volunteer_pipeline.sh SRR3207996 current disk space = 3051987771392 free memory = 1342683344 SRR3207996 SRAfilesize 571b96ce48fa459f75675590820af385 SRR3207996.sra SRR3207996.sra file validated SRR3207996 is single end SRR3207996 is conventional basespace SRR3207996 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207996_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0775 34.0 33.0 34.0 31.0 34.0 2 33.226 34.0 34.0 34.0 31.0 34.0 3 33.26225 34.0 34.0 34.0 31.0 34.0 4 36.59025 37.0 37.0 37.0 35.0 37.0 5 36.48625 37.0 37.0 37.0 35.0 37.0 6 36.447 37.0 37.0 37.0 35.0 37.0 7 36.4295 37.0 37.0 37.0 35.0 37.0 8 36.47475 37.0 37.0 37.0 35.0 37.0 9 38.31125 39.0 39.0 39.0 37.0 39.0 10-11 38.334625 39.0 39.0 39.0 37.0 39.0 12-13 38.277625 39.0 39.0 39.0 37.0 39.0 14-15 39.762625 41.0 40.0 41.0 37.5 41.0 16-17 39.876375 41.0 40.0 41.0 38.0 41.0 18-19 39.941625 41.0 40.0 41.0 38.0 41.0 20-21 39.87175 41.0 40.0 41.0 38.0 41.0 22-23 39.859 41.0 40.0 41.0 38.0 41.0 24-25 39.728875 41.0 40.0 41.0 37.5 41.0 26-27 39.651125 41.0 40.0 41.0 37.0 41.0 28-29 39.51525 41.0 40.0 41.0 37.0 41.0 30-31 39.277375 41.0 40.0 41.0 36.5 41.0 32-33 39.319 41.0 39.5 41.0 36.0 41.0 34-35 38.949124999999995 40.5 39.0 41.0 35.5 41.0 36-37 39.058125000000004 40.5 39.0 41.0 36.0 41.0 38-39 39.041375 40.0 39.0 41.0 35.5 41.0 40-41 38.935125 40.0 39.0 41.0 35.5 41.0 42-43 38.761125 40.0 39.0 41.0 35.0 41.0 44-45 38.619125 40.0 38.0 41.0 35.0 41.0 46-47 38.632374999999996 40.0 38.0 41.0 35.0 41.0 48-49 38.561875 40.0 38.0 41.0 35.0 41.0 50-51 38.770624999999995 41.0 39.0 41.0 35.0 41.0 52-53 38.72125 41.0 39.0 41.0 35.0 41.0 54-55 38.403375 41.0 38.0 41.0 34.5 41.0 56-57 38.349999999999994 40.0 38.0 41.0 34.0 41.0 58-59 38.06275 40.0 38.0 41.0 34.0 41.0 60-61 37.949625 40.0 37.0 41.0 34.0 41.0 62-63 37.5985 39.5 36.5 41.0 33.5 41.0 64-65 37.2665 39.0 36.0 41.0 33.0 41.0 66-67 36.821 39.0 35.5 41.0 32.5 41.0 68-69 36.43925 38.0 35.0 40.5 32.0 41.0 70-71 36.035624999999996 37.0 35.0 39.5 32.0 41.0 72-73 35.446 36.5 35.0 39.0 31.0 41.0 74-75 35.127375 36.0 35.0 39.0 31.0 40.0 76-77 33.998875 35.0 34.0 37.0 29.5 39.0 78-79 34.171625 35.0 34.0 37.0 30.5 39.0 80-81 33.884875 35.0 34.0 36.5 30.0 38.0 82-83 33.560375 35.0 34.0 36.0 30.0 37.0 84-85 33.233125 35.0 34.0 36.0 30.0 37.0 86-87 32.982375 35.0 34.0 35.5 29.5 36.0 88-89 32.8005 35.0 34.0 35.0 29.0 36.0 90-91 32.57175 35.0 34.0 35.0 29.0 36.0 92-93 32.421875 35.0 34.0 35.0 29.0 36.0 94-95 32.156375 35.0 34.0 35.0 27.0 35.5 96-97 32.084374999999994 35.0 34.0 35.0 28.0 35.0 98-99 31.905124999999998 35.0 34.0 35.0 28.0 35.0 100 31.77375 35.0 34.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 3.0 10 4.0 11 5.0 12 4.0 13 3.0 14 4.0 15 6.0 16 11.0 17 8.0 18 6.0 19 13.0 20 4.0 21 9.0 22 13.0 23 10.0 24 12.0 25 10.0 26 15.0 27 15.0 28 20.0 29 36.0 30 41.0 31 46.0 32 62.0 33 79.0 34 109.0 35 192.0 36 337.0 37 805.0 38 1675.0 39 443.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.75 13.0 15.625 47.625 2 19.875 21.4 35.775 22.95 3 21.6 24.975 27.474999999999998 25.95 4 24.65 31.65 20.25 23.45 5 24.756189047261813 34.63365841460365 22.230557639409852 18.37959489872468 6 19.225 37.925 23.025000000000002 19.825 7 17.275 18.9 43.225 20.599999999999998 8 20.275000000000002 22.075 30.425 27.224999999999998 9 20.45 23.05 31.474999999999998 25.025 10-11 22.7125 33.074999999999996 22.400000000000002 21.8125 12-13 20.4375 27.037499999999998 29.5375 22.9875 14-15 20.7 27.875 28.825 22.6 16-17 21.675 27.987499999999997 27.775 22.5625 18-19 22.237499999999997 27.287499999999998 27.575 22.900000000000002 20-21 21.625 28.4 28.1875 21.7875 22-23 22.4375 28.287499999999998 27.200000000000003 22.075 24-25 22.091568676507382 28.383787840880657 27.145359019264447 22.37928446334751 26-27 21.55 28.775000000000002 27.462500000000002 22.2125 28-29 22.40300375469337 26.896120150187734 27.496871088861074 23.204005006257823 30-31 21.027568922305765 28.233082706766915 27.694235588972433 23.045112781954888 32-33 21.425 27.8625 27.85 22.8625 34-35 23.0625 27.8125 27.462500000000002 21.6625 36-37 22.25 27.8125 27.0875 22.85 38-39 20.75 28.6125 28.025 22.6125 40-41 21.912499999999998 27.9375 27.6875 22.4625 42-43 21.3 28.249999999999996 27.6125 22.8375 44-45 21.85 27.8875 27.962500000000002 22.3 46-47 23.0 27.287499999999998 26.2625 23.45 48-49 22.05 28.5875 26.8625 22.5 50-51 22.112499999999997 27.6 28.000000000000004 22.287499999999998 52-53 22.7 27.175 27.775 22.35 54-55 21.775 27.625 27.6375 22.9625 56-57 22.425 26.6625 28.249999999999996 22.662499999999998 58-59 22.6125 26.9125 27.6125 22.8625 60-61 21.65 28.025 27.3 23.025000000000002 62-63 21.725 28.3125 27.6375 22.325 64-65 21.6125 28.675 27.625 22.0875 66-67 22.3375 27.237499999999997 27.987499999999997 22.4375 68-69 22.6 27.962500000000002 27.4125 22.025 70-71 22.650000000000002 27.825 26.700000000000003 22.825 72-73 20.7 29.8375 26.5875 22.875 74-75 21.987499999999997 29.025000000000002 27.437499999999996 21.55 76-77 23.65 27.775 26.6 21.975 78-79 22.037499999999998 27.275 27.700000000000003 22.9875 80-81 23.0375 27.625 27.500000000000004 21.837500000000002 82-83 22.55 27.275 27.2625 22.912499999999998 84-85 21.912499999999998 27.474999999999998 28.0625 22.55 86-87 22.525000000000002 27.3375 28.575 21.5625 88-89 23.3125 27.287499999999998 27.3875 22.0125 90-91 22.037499999999998 27.375 27.962500000000002 22.625 92-93 22.6375 28.175 27.437499999999996 21.75 94-95 21.8125 27.85 28.175 22.162499999999998 96-97 21.6125 27.400000000000002 27.5625 23.425 98-99 22.412499999999998 28.075 27.487499999999997 22.025 100 23.65 26.724999999999998 26.950000000000003 22.675 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.0 23 0.0 24 0.5 25 3.5 26 4.5 27 6.0 28 7.5 29 7.0 30 11.5 31 15.5 32 21.5 33 32.0 34 42.0 35 57.5 36 78.0 37 97.5 38 114.0 39 155.5 40 197.0 41 213.0 42 243.0 43 268.5 44 278.5 45 278.0 46 270.5 47 270.5 48 254.5 49 210.0 50 160.5 51 128.5 52 112.5 53 95.0 54 79.0 55 57.0 56 43.0 57 38.0 58 26.5 59 21.5 60 15.5 61 12.5 62 12.5 63 9.0 64 8.0 65 9.5 66 7.5 67 3.5 68 3.0 69 2.5 70 1.5 71 1.5 72 1.0 73 1.5 74 1.0 75 0.5 76 1.5 77 1.0 78 0.5 79 0.5 80 1.0 81 1.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.075 26-27 0.0 28-29 0.125 30-31 0.25 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0125 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.037500000000000006 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1283330 spots for SRR3207996.sra Written 1283330 spots for SRR3207996.sra Read 1283330 spots for SRR3207996.sra Written 1283330 spots for SRR3207996.sra Read 1283330 spots for SRR3207996.sra Written 1283330 spots for SRR3207996.sra Read 1283330 spots for SRR3207996.sra Written 1283330 spots for SRR3207996.sra Read 1283330 spots for SRR3207996.sra Written 1283330 spots for SRR3207996.sra Read 1283330 spots for SRR3207996.sra Written 1283330 spots for SRR3207996.sra Read 1283330 spots for SRR3207996.sra Written 1283330 spots for SRR3207996.sra Read 1283330 spots for SRR3207996.sra Written 1283330 spots for SRR3207996.sra Read 1283330 spots for SRR3207996.sra Written 1283330 spots for SRR3207996.sra Read 1283330 spots for SRR3207996.sra Written 1283330 spots for SRR3207996.sra Read 1283330 spots for SRR3207996.sra Written 1283330 spots for SRR3207996.sra Read 1283330 spots for SRR3207996.sra Written 1283330 spots for SRR3207996.sra Read 1283330 spots for SRR3207996.sra Written 1283330 spots for SRR3207996.sra Read 1283334 spots for SRR3207996.sra Written 1283334 spots for SRR3207996.sra Read 1283330 spots for SRR3207996.sra Written 1283330 spots for SRR3207996.sra Read 1283330 spots for SRR3207996.sra Written 1283330 spots for SRR3207996.sra Read 1283330 spots for SRR3207996.sra Written 1283330 spots for SRR3207996.sra Read 1283330 spots for SRR3207996.sra Written 1283330 spots for SRR3207996.sra Read 1283330 spots for SRR3207996.sra Written 1283330 spots for SRR3207996.sra Read 1283330 spots for SRR3207996.sra Written 1283330 spots for SRR3207996.sra SRR ids: ['SRR3207996.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mf_f1qdk SRR3207996.sra spots: 25666604 blocks: [[1, 1283330], [1283331, 2566660], [2566661, 3849990], [3849991, 5133320], [5133321, 6416650], [6416651, 7699980], [7699981, 8983310], [8983311, 10266640], [10266641, 11549970], [11549971, 12833300], [12833301, 14116630], [14116631, 15399960], [15399961, 16683290], [16683291, 17966620], [17966621, 19249950], [19249951, 20533280], [20533281, 21816610], [21816611, 23099940], [23099941, 24383270], [24383271, 25666604]] SRR3207996 file size 6668866 SRR3207996 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207996 SRR3207996_1.fastq Input file: SRR3207996_1.fastq trimmed: SRR3207996-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 23:42:47 2025 >> started Tue Feb 11 23:43:00 2025 >> done (13.170s) 25666604 reads processed; of these: 3979 ( 0.02%) short reads filtered out after trimming by size control 12861 ( 0.05%) empty reads filtered out after trimming by size control 25649764 (99.93%) reads available; of these: 1251309 ( 4.88%) trimmed reads available after processing 24398455 (95.12%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 483 0.00% 19 633 0.00% 20 1031 0.00% 21 1005 0.00% 22 1419 0.01% 23 2098 0.01% 24 2898 0.01% 25 3670 0.01% 26 4763 0.02% 27 4443 0.02% 28 3712 0.01% 29 3711 0.01% 30 3563 0.01% 31 3738 0.01% 32 3991 0.02% 33 4015 0.02% 34 4346 0.02% 35 4261 0.02% 36 4637 0.02% 37 4632 0.02% 38 4795 0.02% 39 5104 0.02% 40 5135 0.02% 41 5346 0.02% 42 5749 0.02% 43 6224 0.02% 44 6095 0.02% 45 6190 0.02% 46 6360 0.02% 47 6294 0.02% 48 6321 0.02% 49 6469 0.03% 50 6374 0.02% 51 6886 0.03% 52 7004 0.03% 53 7072 0.03% 54 7249 0.03% 55 7663 0.03% 56 8007 0.03% 57 8180 0.03% 58 8482 0.03% 59 8662 0.03% 60 8728 0.03% 61 9216 0.04% 62 9372 0.04% 63 9473 0.04% 64 9734 0.04% 65 10261 0.04% 66 10449 0.04% 67 11016 0.04% 68 11305 0.04% 69 11482 0.04% 70 12171 0.05% 71 12410 0.05% 72 13375 0.05% 73 13721 0.05% 74 14007 0.05% 75 14223 0.06% 76 10232 0.04% 77 11260 0.04% 78 13036 0.05% 79 13779 0.05% 80 14970 0.06% 81 15997 0.06% 82 17474 0.07% 83 18849 0.07% 84 19380 0.08% 85 20654 0.08% 86 21667 0.08% 87 23651 0.09% 88 25216 0.10% 89 28129 0.11% 90 30985 0.12% 91 34417 0.13% 92 38680 0.15% 93 44129 0.17% 94 51637 0.20% 95 60171 0.23% 96 70299 0.27% 97 85124 0.33% 98 93464 0.36% 99 98456 0.38% 100 24398455 95.12% 25649764 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=3.90 fanout-score-rank=16 prefix-density=0.10 prefix-fanout=2.8 sequence=TTCAACCAAGCGCGGGTAAACGGCGGGAGTAACTATGACTCTCTTAAGGTAGCCAAATGCCTCGTCATCTAATTAGTGACGCGCATGAATGGATTAACGAGATTCCCACTGTCCCTGTCTACTATCCAGCGAAACCACAGCCAAGGGAACGGGCTTGGCGGAATCAGCGGGGAAAGAAGACCCTGTTGAGCTTGACTCTAGTCCGACTTTGTGAAATGACTTGAGAGGTGTAGGATAAGTGGGAGCTTCGGCGAAGGTGAAATACCACTACTTTTAACGTTATTTTACTTATTCCGTGAATCGGAGGCGGGGCGCTGCCCCTCTTTTTGGACCCAAGGCCGCTTCGGCGGCCGATCCGGGCGGAAGACATTGTCAGGTGGGGAGTTTGGCTGGGGCGGCACATCTGTTAAAAGATAACGCAGGTGTCCTAAGATGAGCTCAACGAGAACAGAAATCTCGTGTGGAACAAAAGGGTAAAAGCTCGTTTGATTCTGATTTCCAGTACGAATAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=9 fanout-score=181.88 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=23.1 sequence=AAGAAGAAGAAA Started job on | Feb 11 23:43:19 Started mapping on | Feb 11 23:43:19 Finished on | Feb 11 23:43:43 Mapping speed, Million of reads per hour | 3847.46 Number of input reads | 25649764 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 23891839 Uniquely mapped reads % | 93.15% Average mapped length | 99.02 Number of splices: Total | 7330012 Number of splices: Annotated (sjdb) | 7208902 Number of splices: GT/AG | 7223378 Number of splices: GC/AG | 90116 Number of splices: AT/AC | 7480 Number of splices: Non-canonical | 9038 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.06 Insertion rate per base | 0.01% Insertion average length | 1.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 561956 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 1000308 % of reads mapped to too many loci | 3.90% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.76% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1195969 1195969 1195969 N_multimapping 561956 561956 561956 N_noFeature 864840 12181599 12413135 N_ambiguous 238302 38093 38540 UnstrandedReadsAssigned:22788697 PositiveStrandReadsAssigned:11672147 NegativeStrandReadsAssigned:11440164 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207996 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207996-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,649,764 reads, 24,099,700 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52401 SRR3207996.ke.tsv 34699 SRR3207996.se.tsv 87100 total ==> SRR3207996.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 657 20.6182 Potri.005G024800.1.v4.1 1035 936 82 5.27593 Potri.004G059700.1.v4.1 961 862 25 1.7466 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 349.676 7.40454 Potri.016G087400.1.v4.1 270 171 850 299.353 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 71.4845 2.57168 Potri.012G127500.1.v4.1 977 878 3219 220.794 ==> SRR3207996.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2396 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 430 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 47 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 6 SRR3207996 completed mapping pipeline successfully