Starting /dee2/code/volunteer_pipeline.sh SRR3207997 current disk space = 3051520532480 free memory = 1574471508 SRR3207997 SRAfilesize 86c811f7e72fd9f5b84742456720184f SRR3207997.sra SRR3207997.sra file validated SRR3207997 is single end SRR3207997 is conventional basespace SRR3207997 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207997_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9885 34.0 33.0 34.0 31.0 34.0 2 33.14925 34.0 33.0 34.0 31.0 34.0 3 33.241 34.0 34.0 34.0 31.0 34.0 4 36.54975 37.0 37.0 37.0 35.0 37.0 5 36.4235 37.0 37.0 37.0 35.0 37.0 6 36.31725 37.0 37.0 37.0 35.0 37.0 7 36.3315 37.0 37.0 37.0 35.0 37.0 8 36.29625 37.0 37.0 37.0 35.0 37.0 9 38.24125 39.0 39.0 39.0 37.0 39.0 10-11 38.182500000000005 39.0 39.0 39.0 37.0 39.0 12-13 38.269999999999996 39.0 39.0 39.0 37.0 39.0 14-15 39.801875 41.0 40.0 41.0 38.0 41.0 16-17 39.799 41.0 40.0 41.0 37.5 41.0 18-19 39.822625 41.0 40.0 41.0 38.0 41.0 20-21 39.84287500000001 41.0 40.0 41.0 38.0 41.0 22-23 39.676125 41.0 40.0 41.0 37.0 41.0 24-25 39.7065 41.0 40.0 41.0 37.5 41.0 26-27 39.65225 41.0 40.0 41.0 37.0 41.0 28-29 39.503625 41.0 40.0 41.0 37.0 41.0 30-31 39.465875 41.0 40.0 41.0 37.0 41.0 32-33 39.434875000000005 41.0 40.0 41.0 37.0 41.0 34-35 39.321875 41.0 39.5 41.0 36.5 41.0 36-37 39.237625 41.0 39.0 41.0 36.0 41.0 38-39 39.127624999999995 40.5 39.0 41.0 36.0 41.0 40-41 39.108875 40.0 39.0 41.0 35.5 41.0 42-43 39.060125 40.5 39.0 41.0 35.5 41.0 44-45 39.15025 41.0 39.0 41.0 36.0 41.0 46-47 39.08275 41.0 39.0 41.0 35.5 41.0 48-49 38.952749999999995 40.0 39.0 41.0 35.0 41.0 50-51 39.135875 41.0 39.0 41.0 36.0 41.0 52-53 39.116749999999996 41.0 39.0 41.0 35.0 41.0 54-55 38.999875 41.0 39.0 41.0 35.0 41.0 56-57 38.95175 41.0 39.0 41.0 35.0 41.0 58-59 38.6775 40.5 38.5 41.0 35.0 41.0 60-61 38.232875 40.0 37.0 41.0 34.0 41.0 62-63 38.229 40.0 37.0 41.0 34.0 41.0 64-65 37.931 39.5 37.0 41.0 34.0 41.0 66-67 37.625375000000005 39.0 36.0 41.0 34.0 41.0 68-69 37.144875 39.0 35.5 40.5 33.5 41.0 70-71 36.7215 37.5 35.0 40.0 33.0 41.0 72-73 36.16525 37.0 35.0 39.0 33.0 41.0 74-75 35.81699999999999 36.5 35.0 39.0 33.0 40.5 76-77 34.852875 35.5 34.0 37.0 30.5 39.0 78-79 34.877375 35.5 35.0 37.0 31.5 39.0 80-81 34.714124999999996 35.0 35.0 37.0 32.0 39.0 82-83 34.3305 35.0 35.0 36.0 32.0 37.0 84-85 34.192499999999995 35.0 35.0 36.0 32.0 37.0 86-87 34.0975 35.0 35.0 36.0 32.0 36.5 88-89 33.804 35.0 34.0 35.0 32.0 36.0 90-91 33.686499999999995 35.0 34.0 35.0 31.5 36.0 92-93 33.499875 35.0 34.0 35.0 31.0 36.0 94-95 33.325125 35.0 34.0 35.0 31.0 36.0 96-97 33.296499999999995 35.0 34.0 35.0 31.0 35.5 98-99 33.186 35.0 34.0 35.0 31.0 35.0 100 33.056 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 2.0 10 1.0 11 0.0 12 3.0 13 5.0 14 0.0 15 1.0 16 3.0 17 4.0 18 3.0 19 4.0 20 3.0 21 2.0 22 7.0 23 8.0 24 1.0 25 13.0 26 4.0 27 18.0 28 20.0 29 32.0 30 40.0 31 46.0 32 55.0 33 72.0 34 101.0 35 156.0 36 289.0 37 762.0 38 1769.0 39 572.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.427427427427425 13.613613613613614 13.163163163163164 45.7957957957958 2 19.125 21.45 38.525 20.9 3 22.05 24.525 26.724999999999998 26.700000000000003 4 25.05 30.475 19.775000000000002 24.7 5 24.037018509254626 35.842921460730366 21.335667833916958 18.78439219609805 6 19.0 38.7 23.125 19.175 7 18.0 19.75 42.075 20.175 8 19.85 25.275 30.75 24.125 9 20.474999999999998 22.75 33.45 23.325000000000003 10-11 22.7 34.25 23.1625 19.8875 12-13 20.8 26.9625 29.725 22.5125 14-15 21.675 27.6625 28.0875 22.575 16-17 21.7875 28.212500000000002 27.800000000000004 22.2 18-19 21.349999999999998 28.3625 27.3625 22.925 20-21 22.650000000000002 28.65 27.0 21.7 22-23 21.7875 30.325000000000003 26.6125 21.275 24-25 22.1055263815954 28.81970492623156 27.11927981995499 21.955488872218055 26-27 20.7875 29.25 27.950000000000003 22.0125 28-29 21.591193395046286 29.321991493620214 28.033525143857897 21.053289967475607 30-31 22.1499186584908 28.907520961081218 27.343261168814912 21.599299211613065 32-33 21.625 28.799999999999997 27.675 21.9 34-35 22.55 28.275 27.250000000000004 21.925 36-37 22.1875 28.125 28.1875 21.5 38-39 21.45 28.4375 27.5125 22.6 40-41 21.875 28.212500000000002 27.675 22.237499999999997 42-43 21.525 28.262500000000003 28.15 22.0625 44-45 21.3 27.900000000000002 28.050000000000004 22.75 46-47 22.125 28.237499999999997 27.987499999999997 21.65 48-49 21.625 28.7375 28.175 21.462500000000002 50-51 21.912499999999998 28.6875 27.6375 21.762500000000003 52-53 22.0875 28.487499999999997 28.237499999999997 21.1875 54-55 21.4875 27.6125 28.287499999999998 22.6125 56-57 21.675 28.425 27.962500000000002 21.9375 58-59 22.650000000000002 29.9 26.6 20.849999999999998 60-61 22.15 28.6875 27.5875 21.575 62-63 21.9375 28.5625 27.762500000000003 21.7375 64-65 22.025 28.749999999999996 27.224999999999998 22.0 66-67 22.9625 27.35 28.1625 21.525 68-69 22.1 28.512500000000003 27.6375 21.75 70-71 21.9625 28.9375 27.437499999999996 21.6625 72-73 21.5375 28.212500000000002 28.212500000000002 22.037499999999998 74-75 21.712500000000002 29.0875 28.212500000000002 20.9875 76-77 22.5 29.6375 26.7625 21.099999999999998 78-79 22.162499999999998 28.8625 26.85 22.125 80-81 22.0875 28.512500000000003 27.6 21.8 82-83 22.2625 27.962500000000002 28.225 21.55 84-85 21.712500000000002 28.625 28.075 21.587500000000002 86-87 21.025 28.225 28.0875 22.662499999999998 88-89 22.7125 28.1125 28.225 20.95 90-91 21.075 28.487499999999997 28.1375 22.3 92-93 21.7875 27.9375 28.15 22.125 94-95 21.875 28.1125 27.975 22.037499999999998 96-97 22.025 28.3375 28.6625 20.974999999999998 98-99 22.662499999999998 28.075 27.8375 21.425 100 21.575 29.299999999999997 26.674999999999997 22.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 1.0 25 1.0 26 3.5 27 6.5 28 7.5 29 12.0 30 15.5 31 17.5 32 32.0 33 46.5 34 53.0 35 74.5 36 103.0 37 122.0 38 138.0 39 167.0 40 196.0 41 236.5 42 272.0 43 265.5 44 266.5 45 266.5 46 260.5 47 246.5 48 222.0 49 196.5 50 166.5 51 136.5 52 111.0 53 84.5 54 62.0 55 47.5 56 33.5 57 27.0 58 25.5 59 18.5 60 9.0 61 11.0 62 10.5 63 6.5 64 6.5 65 5.0 66 1.5 67 0.5 68 1.0 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.025 26-27 0.0 28-29 0.075 30-31 0.11249999999999999 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79944848332916 99.52499999999999 2 0.17548257708698922 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0250689395838556 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC 5 0.125 TruSeq Adapter, Index 2 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 552811 spots for SRR3207997.sra Written 552811 spots for SRR3207997.sra Read 552811 spots for SRR3207997.sra Written 552811 spots for SRR3207997.sra Read 552811 spots for SRR3207997.sra Written 552811 spots for SRR3207997.sra Read 552811 spots for SRR3207997.sra Written 552811 spots for SRR3207997.sra Read 552811 spots for SRR3207997.sra Written 552811 spots for SRR3207997.sra Read 552811 spots for SRR3207997.sra Written 552811 spots for SRR3207997.sra Read 552811 spots for SRR3207997.sra Written 552811 spots for SRR3207997.sra Read 552811 spots for SRR3207997.sra Written 552811 spots for SRR3207997.sra Read 552811 spots for SRR3207997.sra Written 552811 spots for SRR3207997.sra Read 552811 spots for SRR3207997.sra Written 552811 spots for SRR3207997.sra Read 552811 spots for SRR3207997.sra Written 552811 spots for SRR3207997.sra Read 552811 spots for SRR3207997.sra Written 552811 spots for SRR3207997.sra Read 552811 spots for SRR3207997.sra Written 552811 spots for SRR3207997.sra Read 552811 spots for SRR3207997.sra Written 552811 spots for SRR3207997.sra Read 552811 spots for SRR3207997.sra Written 552811 spots for SRR3207997.sra Read 552811 spots for SRR3207997.sra Written 552811 spots for SRR3207997.sra Read 552828 spots for SRR3207997.sra Written 552828 spots for SRR3207997.sra Read 552811 spots for SRR3207997.sra Written 552811 spots for SRR3207997.sra Read 552811 spots for SRR3207997.sra Written 552811 spots for SRR3207997.sra Read 552811 spots for SRR3207997.sra Written 552811 spots for SRR3207997.sra SRR ids: ['SRR3207997.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o7g5zbxb SRR3207997.sra spots: 11056237 blocks: [[1, 552811], [552812, 1105622], [1105623, 1658433], [1658434, 2211244], [2211245, 2764055], [2764056, 3316866], [3316867, 3869677], [3869678, 4422488], [4422489, 4975299], [4975300, 5528110], [5528111, 6080921], [6080922, 6633732], [6633733, 7186543], [7186544, 7739354], [7739355, 8292165], [8292166, 8844976], [8844977, 9397787], [9397788, 9950598], [9950599, 10503409], [10503410, 11056237]] SRR3207997 file size 2866435 SRR3207997 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207997 SRR3207997_1.fastq Input file: SRR3207997_1.fastq trimmed: SRR3207997-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 00:20:38 2025 >> started Wed Feb 12 00:20:43 2025 >> done (5.361s) 11056237 reads processed; of these: 2033 ( 0.02%) short reads filtered out after trimming by size control 13613 ( 0.12%) empty reads filtered out after trimming by size control 11040591 (99.86%) reads available; of these: 513445 ( 4.65%) trimmed reads available after processing 10527146 (95.35%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 307 0.00% 19 324 0.00% 20 399 0.00% 21 545 0.00% 22 738 0.01% 23 993 0.01% 24 1390 0.01% 25 1657 0.02% 26 1768 0.02% 27 1684 0.02% 28 1663 0.02% 29 1702 0.02% 30 1730 0.02% 31 1721 0.02% 32 1775 0.02% 33 1920 0.02% 34 2015 0.02% 35 2052 0.02% 36 2114 0.02% 37 2161 0.02% 38 2257 0.02% 39 2312 0.02% 40 2360 0.02% 41 2486 0.02% 42 2560 0.02% 43 2642 0.02% 44 2713 0.02% 45 2750 0.02% 46 2780 0.03% 47 2924 0.03% 48 2960 0.03% 49 2966 0.03% 50 2958 0.03% 51 3131 0.03% 52 3129 0.03% 53 3288 0.03% 54 3517 0.03% 55 3553 0.03% 56 3580 0.03% 57 3632 0.03% 58 3825 0.03% 59 3847 0.03% 60 3944 0.04% 61 4040 0.04% 62 4002 0.04% 63 4073 0.04% 64 4257 0.04% 65 4523 0.04% 66 4522 0.04% 67 4708 0.04% 68 5005 0.05% 69 5006 0.05% 70 5077 0.05% 71 5183 0.05% 72 5471 0.05% 73 5901 0.05% 74 5977 0.05% 75 6051 0.05% 76 4341 0.04% 77 4741 0.04% 78 5275 0.05% 79 5713 0.05% 80 6227 0.06% 81 6425 0.06% 82 6893 0.06% 83 7411 0.07% 84 7689 0.07% 85 8289 0.08% 86 8743 0.08% 87 9380 0.08% 88 10027 0.09% 89 11221 0.10% 90 12258 0.11% 91 13510 0.12% 92 15376 0.14% 93 17364 0.16% 94 20248 0.18% 95 24129 0.22% 96 28461 0.26% 97 32979 0.30% 98 36259 0.33% 99 37918 0.34% 100 10527146 95.35% 11040591 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=11.42 fanout-score-rank=11 prefix-density=0.07 prefix-fanout=11.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTGAAAAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=14 fanout-score=173.41 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=22.7 sequence=AAGAAGAAGAAA Started job on | Feb 12 00:20:58 Started mapping on | Feb 12 00:20:58 Finished on | Feb 12 00:21:09 Mapping speed, Million of reads per hour | 3613.28 Number of input reads | 11040591 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 10650767 Uniquely mapped reads % | 96.47% Average mapped length | 98.72 Number of splices: Total | 3093741 Number of splices: Annotated (sjdb) | 3037718 Number of splices: GT/AG | 3048302 Number of splices: GC/AG | 36744 Number of splices: AT/AC | 3184 Number of splices: Non-canonical | 5511 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.01 Insertion rate per base | 0.01% Insertion average length | 1.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 230086 % of reads mapped to multiple loci | 2.08% Number of reads mapped to too many loci | 35021 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.12% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 159738 159738 159738 N_multimapping 230086 230086 230086 N_noFeature 450583 5509848 5513273 N_ambiguous 114958 18194 18669 UnstrandedReadsAssigned:10085226 PositiveStrandReadsAssigned:5122725 NegativeStrandReadsAssigned:5118825 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207997 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207997-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,040,591 reads, 10,332,152 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR3207997.ke.tsv 34699 SRR3207997.se.tsv 87100 total ==> SRR3207997.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 268 20.7145 Potri.005G024800.1.v4.1 1035 936 35 5.54635 Potri.004G059700.1.v4.1 961 862 12 2.06485 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 175.402 9.14785 Potri.016G087400.1.v4.1 270 171 343 297.518 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 51 4.51887 Potri.012G127500.1.v4.1 977 878 805 135.993 ==> SRR3207997.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1180 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 147 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 26 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207997 completed mapping pipeline successfully