Starting /dee2/code/volunteer_pipeline.sh SRR3207998 current disk space = 3051997564928 free memory = 1436155028 SRR3207998 SRAfilesize cb5ec31f7f5bcb34822e6e59bc1b040c SRR3207998.sra SRR3207998.sra file validated SRR3207998 is single end SRR3207998 is conventional basespace SRR3207998 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207998_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.004 34.0 33.0 34.0 31.0 34.0 2 33.17225 34.0 33.0 34.0 31.0 34.0 3 33.26375 34.0 34.0 34.0 31.0 34.0 4 36.54275 37.0 37.0 37.0 35.0 37.0 5 36.42025 37.0 37.0 37.0 35.0 37.0 6 36.345 37.0 37.0 37.0 35.0 37.0 7 36.3545 37.0 37.0 37.0 35.0 37.0 8 36.3095 37.0 37.0 37.0 35.0 37.0 9 38.23775 39.0 39.0 39.0 37.0 39.0 10-11 38.22525 39.0 39.0 39.0 37.0 39.0 12-13 38.242999999999995 39.0 39.0 39.0 37.0 39.0 14-15 39.823750000000004 41.0 40.0 41.0 38.0 41.0 16-17 39.848625 41.0 40.0 41.0 37.5 41.0 18-19 39.81275 41.0 40.0 41.0 38.0 41.0 20-21 39.834375 41.0 40.0 41.0 38.0 41.0 22-23 39.676500000000004 41.0 40.0 41.0 37.0 41.0 24-25 39.724625 41.0 40.0 41.0 37.0 41.0 26-27 39.654375 41.0 40.0 41.0 37.0 41.0 28-29 39.54575 41.0 40.0 41.0 37.0 41.0 30-31 39.500125 41.0 40.0 41.0 37.0 41.0 32-33 39.45125 41.0 40.0 41.0 36.5 41.0 34-35 39.3155 41.0 39.5 41.0 36.0 41.0 36-37 39.272125 41.0 39.0 41.0 36.0 41.0 38-39 39.159375 40.5 39.0 41.0 36.0 41.0 40-41 39.0865 40.0 39.0 41.0 36.0 41.0 42-43 38.99775 40.5 39.0 41.0 35.0 41.0 44-45 39.098625 41.0 39.0 41.0 35.0 41.0 46-47 39.06825 41.0 39.0 41.0 35.0 41.0 48-49 38.937 40.0 39.0 41.0 35.0 41.0 50-51 39.076750000000004 41.0 39.0 41.0 35.0 41.0 52-53 39.007875 41.0 39.0 41.0 35.0 41.0 54-55 38.819 41.0 39.0 41.0 35.0 41.0 56-57 38.798875 41.0 39.0 41.0 35.0 41.0 58-59 38.55825 40.5 38.0 41.0 34.5 41.0 60-61 38.116625 40.0 37.0 41.0 34.0 41.0 62-63 38.08625 40.0 37.0 41.0 34.0 41.0 64-65 37.81225 39.5 37.0 41.0 34.0 41.0 66-67 37.50175 39.0 36.0 41.0 34.0 41.0 68-69 37.05775 39.0 35.5 40.5 33.0 41.0 70-71 36.581 37.5 35.0 39.5 33.0 41.0 72-73 36.102125 37.0 35.0 39.0 32.5 41.0 74-75 35.670874999999995 36.5 35.0 39.0 32.0 40.5 76-77 34.695625 35.5 34.0 37.0 30.5 39.0 78-79 34.690124999999995 35.0 35.0 37.0 31.5 39.0 80-81 34.603625 35.0 35.0 37.0 31.5 39.0 82-83 34.2155 35.0 35.0 36.0 31.5 37.0 84-85 34.044 35.0 35.0 36.0 32.0 37.0 86-87 33.881874999999994 35.0 35.0 36.0 32.0 37.0 88-89 33.55625 35.0 34.0 35.0 31.0 36.0 90-91 33.481 35.0 34.0 35.0 31.0 36.0 92-93 33.429125 35.0 34.0 35.0 31.0 36.0 94-95 33.21225 35.0 34.0 35.0 31.0 36.0 96-97 33.16425 35.0 34.0 35.0 31.0 35.0 98-99 32.929625 35.0 34.0 35.0 31.0 35.0 100 32.833 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 1.0 12 3.0 13 3.0 14 3.0 15 6.0 16 1.0 17 5.0 18 4.0 19 7.0 20 7.0 21 6.0 22 2.0 23 6.0 24 7.0 25 8.0 26 12.0 27 19.0 28 22.0 29 32.0 30 40.0 31 50.0 32 59.0 33 80.0 34 111.0 35 148.0 36 284.0 37 709.0 38 1802.0 39 561.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.600600600600597 15.69069069069069 12.562562562562562 46.146146146146144 2 19.5 21.125 40.45 18.925 3 20.7 25.45 25.05 28.799999999999997 4 25.324999999999996 31.275 20.4 23.0 5 24.5311327831958 35.55888972243061 22.85571392848212 17.05426356589147 6 19.475 37.9 23.95 18.675 7 16.950000000000003 21.099999999999998 41.675000000000004 20.275000000000002 8 18.425 24.4 32.425 24.75 9 20.599999999999998 22.55 33.550000000000004 23.3 10-11 21.7875 33.225 24.525 20.4625 12-13 20.125 27.375 29.7875 22.7125 14-15 20.95 28.599999999999998 28.175 22.275 16-17 21.975 29.349999999999998 26.974999999999998 21.7 18-19 21.462500000000002 28.050000000000004 28.1 22.3875 20-21 21.4375 28.5875 27.425 22.55 22-23 21.3875 28.1125 27.700000000000003 22.8 24-25 21.94024253031629 28.19102387798475 27.853481685210653 22.015251906488313 26-27 21.5625 28.449999999999996 27.762500000000003 22.225 28-29 21.285642821410704 28.789394697348676 27.66383191595798 22.26113056528264 30-31 21.143500562992617 28.499937445264607 28.337295133241586 22.019266858501187 32-33 21.3625 28.512500000000003 27.150000000000002 22.975 34-35 21.6625 28.3625 28.849999999999998 21.125 36-37 21.6 27.575 28.325 22.5 38-39 21.5625 28.787499999999998 27.025 22.625 40-41 21.325 29.25 28.299999999999997 21.125 42-43 21.575 27.700000000000003 28.6125 22.112499999999997 44-45 21.525 28.512500000000003 28.050000000000004 21.912499999999998 46-47 21.65 28.799999999999997 28.15 21.4 48-49 22.112499999999997 27.8125 27.500000000000004 22.575 50-51 21.75 28.0625 27.712500000000002 22.475 52-53 21.3125 29.25 27.3875 22.05 54-55 22.8875 28.000000000000004 26.8125 22.3 56-57 21.6125 28.512500000000003 27.762500000000003 22.112499999999997 58-59 21.675 27.8125 28.237499999999997 22.275 60-61 21.637500000000003 27.750000000000004 28.1625 22.45 62-63 22.3625 28.9 27.125 21.6125 64-65 22.162499999999998 28.625 27.450000000000003 21.762500000000003 66-67 21.825 27.6375 28.4 22.1375 68-69 22.112499999999997 28.1375 28.1375 21.6125 70-71 21.8875 28.462500000000002 28.575 21.075 72-73 21.6875 27.950000000000003 27.474999999999998 22.8875 74-75 21.825 27.775 28.3125 22.0875 76-77 21.987499999999997 28.025 27.9125 22.075 78-79 22.1875 28.512500000000003 26.950000000000003 22.35 80-81 22.1 27.437499999999996 28.275 22.1875 82-83 21.6625 28.1375 27.537499999999998 22.662499999999998 84-85 21.987499999999997 28.675 27.3125 22.025 86-87 21.5625 29.2875 26.787499999999998 22.3625 88-89 21.9625 28.125 28.037499999999998 21.875 90-91 22.537499999999998 27.6125 28.237499999999997 21.6125 92-93 22.3625 27.775 28.825 21.0375 94-95 22.45 28.65 27.487499999999997 21.4125 96-97 21.55 28.449999999999996 27.700000000000003 22.3 98-99 22.325 28.65 27.425 21.6 100 22.650000000000002 29.275000000000002 26.275 21.8 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.0 24 1.5 25 1.5 26 2.5 27 4.0 28 5.5 29 8.5 30 16.5 31 23.5 32 32.5 33 39.5 34 53.5 35 86.0 36 101.5 37 109.0 38 141.0 39 181.5 40 215.5 41 240.5 42 251.0 43 255.5 44 250.5 45 263.5 46 281.0 47 256.5 48 230.5 49 197.0 50 155.5 51 126.5 52 97.0 53 80.5 54 68.0 55 50.0 56 39.0 57 29.5 58 23.0 59 22.0 60 14.5 61 5.5 62 3.0 63 6.0 64 7.5 65 4.5 66 2.5 67 1.5 68 1.5 69 2.5 70 2.0 71 0.5 72 0.0 73 0.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 1.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0125 26-27 0.0 28-29 0.05 30-31 0.08750000000000001 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82456140350877 99.575 2 0.15037593984962408 0.3 3 0.0 0.0 4 0.0 0.0 5 0.02506265664160401 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC 5 0.125 TruSeq Adapter, Index 4 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 561358 spots for SRR3207998.sra Written 561358 spots for SRR3207998.sra Read 561358 spots for SRR3207998.sra Written 561358 spots for SRR3207998.sra Read 561358 spots for SRR3207998.sra Written 561358 spots for SRR3207998.sra Read 561358 spots for SRR3207998.sra Written 561358 spots for SRR3207998.sra Read 561358 spots for SRR3207998.sra Written 561358 spots for SRR3207998.sra Read 561358 spots for SRR3207998.sra Written 561358 spots for SRR3207998.sra Read 561358 spots for SRR3207998.sra Written 561358 spots for SRR3207998.sra Read 561358 spots for SRR3207998.sra Written 561358 spots for SRR3207998.sra Read 561358 spots for SRR3207998.sra Written 561358 spots for SRR3207998.sra Read 561358 spots for SRR3207998.sra Written 561358 spots for SRR3207998.sra Read 561358 spots for SRR3207998.sra Written 561358 spots for SRR3207998.sra Read 561358 spots for SRR3207998.sra Written 561358 spots for SRR3207998.sra Read 561360 spots for SRR3207998.sra Written 561360 spots for SRR3207998.sra Read 561358 spots for SRR3207998.sra Written 561358 spots for SRR3207998.sra Read 561358 spots for SRR3207998.sra Written 561358 spots for SRR3207998.sra Read 561358 spots for SRR3207998.sra Written 561358 spots for SRR3207998.sra Read 561358 spots for SRR3207998.sra Written 561358 spots for SRR3207998.sra Read 561358 spots for SRR3207998.sra Written 561358 spots for SRR3207998.sra Read 561358 spots for SRR3207998.sra Written 561358 spots for SRR3207998.sra Read 561358 spots for SRR3207998.sra Written 561358 spots for SRR3207998.sra SRR ids: ['SRR3207998.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gavdoo0j SRR3207998.sra spots: 11227162 blocks: [[1, 561358], [561359, 1122716], [1122717, 1684074], [1684075, 2245432], [2245433, 2806790], [2806791, 3368148], [3368149, 3929506], [3929507, 4490864], [4490865, 5052222], [5052223, 5613580], [5613581, 6174938], [6174939, 6736296], [6736297, 7297654], [7297655, 7859012], [7859013, 8420370], [8420371, 8981728], [8981729, 9543086], [9543087, 10104444], [10104445, 10665802], [10665803, 11227162]] SRR3207998 file size 2910914 SRR3207998 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207998 SRR3207998_1.fastq Input file: SRR3207998_1.fastq trimmed: SRR3207998-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 23:51:07 2025 >> started Tue Feb 11 23:51:12 2025 >> done (5.304s) 11227162 reads processed; of these: 1651 ( 0.01%) short reads filtered out after trimming by size control 21798 ( 0.19%) empty reads filtered out after trimming by size control 11203713 (99.79%) reads available; of these: 512991 ( 4.58%) trimmed reads available after processing 10690722 (95.42%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 259 0.00% 19 294 0.00% 20 722 0.01% 21 468 0.00% 22 639 0.01% 23 929 0.01% 24 1273 0.01% 25 1597 0.01% 26 1628 0.01% 27 1661 0.01% 28 1667 0.01% 29 1685 0.02% 30 1782 0.02% 31 1786 0.02% 32 1782 0.02% 33 1793 0.02% 34 1913 0.02% 35 2025 0.02% 36 2035 0.02% 37 1985 0.02% 38 2166 0.02% 39 2216 0.02% 40 2289 0.02% 41 2393 0.02% 42 2479 0.02% 43 2520 0.02% 44 2545 0.02% 45 2608 0.02% 46 2837 0.03% 47 2823 0.03% 48 2912 0.03% 49 2984 0.03% 50 2912 0.03% 51 3087 0.03% 52 3104 0.03% 53 3309 0.03% 54 3423 0.03% 55 3495 0.03% 56 3515 0.03% 57 3730 0.03% 58 3749 0.03% 59 3789 0.03% 60 3899 0.03% 61 3799 0.03% 62 3980 0.04% 63 4293 0.04% 64 4148 0.04% 65 4350 0.04% 66 4668 0.04% 67 4806 0.04% 68 4929 0.04% 69 5128 0.05% 70 5108 0.05% 71 5224 0.05% 72 5359 0.05% 73 5647 0.05% 74 5984 0.05% 75 5930 0.05% 76 4176 0.04% 77 4697 0.04% 78 5236 0.05% 79 5690 0.05% 80 6041 0.05% 81 6456 0.06% 82 6865 0.06% 83 7561 0.07% 84 7730 0.07% 85 8368 0.07% 86 8751 0.08% 87 9452 0.08% 88 10381 0.09% 89 11382 0.10% 90 12312 0.11% 91 13533 0.12% 92 15376 0.14% 93 17617 0.16% 94 20642 0.18% 95 24351 0.22% 96 28951 0.26% 97 32806 0.29% 98 36571 0.33% 99 37986 0.34% 100 10690722 95.42% 11203713 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=13.15 fanout-score-rank=23 prefix-density=0.09 prefix-fanout=13.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=15 fanout-score=312.16 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=28.8 sequence=TTCTTCTTCTTC Started job on | Feb 11 23:51:28 Started mapping on | Feb 11 23:51:29 Finished on | Feb 11 23:51:42 Mapping speed, Million of reads per hour | 3102.57 Number of input reads | 11203713 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 10761177 Uniquely mapped reads % | 96.05% Average mapped length | 98.76 Number of splices: Total | 3167989 Number of splices: Annotated (sjdb) | 3108649 Number of splices: GT/AG | 3118437 Number of splices: GC/AG | 40118 Number of splices: AT/AC | 3274 Number of splices: Non-canonical | 6160 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.02 Insertion rate per base | 0.01% Insertion average length | 1.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 262829 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 38094 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.26% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 179707 179707 179707 N_multimapping 262829 262829 262829 N_noFeature 477271 5570711 5599001 N_ambiguous 107639 19242 19844 UnstrandedReadsAssigned:10176267 PositiveStrandReadsAssigned:5171224 NegativeStrandReadsAssigned:5142332 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207998 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207998-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,203,713 reads, 10,425,241 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,014 rounds 52401 SRR3207998.ke.tsv 34699 SRR3207998.se.tsv 87100 total ==> SRR3207998.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 570 40.6124 Potri.005G024800.1.v4.1 1035 936 151 22.0577 Potri.004G059700.1.v4.1 961 862 18 2.85512 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 245.31 11.7935 Potri.016G087400.1.v4.1 270 171 354 283.052 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 42 3.43046 Potri.012G127500.1.v4.1 977 878 1867 290.743 ==> SRR3207998.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 832 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 239 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 24 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR3207998 completed mapping pipeline successfully