Starting /dee2/code/volunteer_pipeline.sh SRR3207999 current disk space = 3051340709888 free memory = 1580013276 SRR3207999 SRAfilesize d2013be62c87563c06676909f7521e5f SRR3207999.sra SRR3207999.sra file validated SRR3207999 is single end SRR3207999 is conventional basespace SRR3207999 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207999_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.00575 34.0 33.0 34.0 31.0 34.0 2 33.16925 34.0 33.0 34.0 31.0 34.0 3 33.2065 34.0 34.0 34.0 31.0 34.0 4 36.487 37.0 37.0 37.0 35.0 37.0 5 36.44625 37.0 37.0 37.0 35.0 37.0 6 36.3545 37.0 37.0 37.0 35.0 37.0 7 36.3975 37.0 37.0 37.0 35.0 37.0 8 36.4095 37.0 37.0 37.0 35.0 37.0 9 38.24525 39.0 39.0 39.0 37.0 39.0 10-11 38.193749999999994 39.0 39.0 39.0 37.0 39.0 12-13 38.250625 39.0 39.0 39.0 37.0 39.0 14-15 39.79675 41.0 40.0 41.0 38.0 41.0 16-17 39.685375 41.0 40.0 41.0 37.0 41.0 18-19 39.768874999999994 41.0 40.0 41.0 38.0 41.0 20-21 39.80175 41.0 40.0 41.0 38.0 41.0 22-23 39.67675 41.0 40.0 41.0 37.0 41.0 24-25 39.659625 41.0 40.0 41.0 37.0 41.0 26-27 39.614625000000004 41.0 40.0 41.0 37.0 41.0 28-29 39.538624999999996 41.0 40.0 41.0 37.0 41.0 30-31 39.422375 41.0 40.0 41.0 37.0 41.0 32-33 39.39275 41.0 40.0 41.0 37.0 41.0 34-35 39.283625 41.0 39.0 41.0 36.5 41.0 36-37 39.15475 41.0 39.0 41.0 36.0 41.0 38-39 39.092625 41.0 39.0 41.0 35.5 41.0 40-41 38.995125 40.0 39.0 41.0 35.5 41.0 42-43 39.025999999999996 40.5 39.0 41.0 35.5 41.0 44-45 39.01875 41.0 39.0 41.0 35.5 41.0 46-47 39.039500000000004 41.0 39.0 41.0 35.5 41.0 48-49 38.890625 40.0 39.0 41.0 35.0 41.0 50-51 39.066375 41.0 39.0 41.0 36.0 41.0 52-53 38.979749999999996 41.0 39.0 41.0 35.0 41.0 54-55 38.85075 41.0 39.0 41.0 35.0 41.0 56-57 38.792 41.0 39.0 41.0 35.0 41.0 58-59 38.535250000000005 40.0 38.0 41.0 34.5 41.0 60-61 38.264250000000004 40.0 37.5 41.0 34.0 41.0 62-63 38.208749999999995 40.0 37.0 41.0 34.5 41.0 64-65 37.838 39.5 37.0 41.0 34.0 41.0 66-67 37.5465 39.0 36.0 41.0 34.0 41.0 68-69 37.16225 39.0 36.0 40.5 33.0 41.0 70-71 36.713625 37.5 35.0 40.0 33.0 41.0 72-73 36.12075 37.0 35.0 39.0 32.5 41.0 74-75 35.569 36.5 35.0 39.0 32.0 40.5 76-77 34.704750000000004 35.5 34.0 37.0 30.5 39.0 78-79 34.7095 35.0 34.5 37.0 31.0 39.0 80-81 34.575374999999994 35.0 35.0 37.0 31.5 39.0 82-83 34.281625000000005 35.0 35.0 36.0 31.0 37.0 84-85 34.09825 35.0 35.0 36.0 32.0 37.0 86-87 33.865375 35.0 35.0 36.0 31.5 36.5 88-89 33.561 35.0 34.0 35.0 31.0 36.0 90-91 33.446 35.0 34.0 35.0 31.0 36.0 92-93 33.27725 35.0 34.0 35.0 31.0 36.0 94-95 33.18625 35.0 34.0 35.0 31.0 36.0 96-97 33.07275 35.0 34.0 35.0 31.0 35.5 98-99 32.958749999999995 35.0 34.0 35.0 30.0 35.0 100 32.8595 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 2.0 11 2.0 12 6.0 13 1.0 14 1.0 15 2.0 16 3.0 17 9.0 18 4.0 19 1.0 20 2.0 21 3.0 22 9.0 23 10.0 24 4.0 25 15.0 26 13.0 27 19.0 28 15.0 29 26.0 30 34.0 31 55.0 32 45.0 33 87.0 34 103.0 35 171.0 36 294.0 37 762.0 38 1756.0 39 543.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.494871153365025 15.686765073805354 10.70803102326745 47.110332749562176 2 19.25 22.3 38.125 20.325 3 20.45 25.525 26.974999999999998 27.05 4 24.525 31.075000000000003 20.025000000000002 24.375 5 24.224999999999998 36.475 21.725 17.575 6 18.875 37.8 24.349999999999998 18.975 7 16.950000000000003 20.549999999999997 42.675000000000004 19.825 8 18.25 23.575 30.675 27.500000000000004 9 20.825 23.575 32.625 22.975 10-11 21.7375 33.0625 24.212500000000002 20.9875 12-13 20.4625 27.5875 28.3375 23.6125 14-15 20.625 28.462500000000002 29.037499999999998 21.875 16-17 21.712500000000002 28.1625 27.5625 22.5625 18-19 21.25 28.475 27.775 22.5 20-21 21.4375 28.7375 27.35 22.475 22-23 22.287499999999998 28.6125 27.825 21.275 24-25 21.8625 28.975 27.8375 21.325 26-27 20.9875 30.5 27.3875 21.125 28-29 22.405601400350086 28.382095523880967 27.394348587146787 21.817954488622153 30-31 21.46609957468101 28.696522391793845 27.445584188141105 22.39179384538404 32-33 20.775 29.1125 27.737499999999997 22.375 34-35 21.337500000000002 28.249999999999996 27.825 22.5875 36-37 21.775 28.275 27.787499999999998 22.162499999999998 38-39 21.275 28.925 27.5625 22.237499999999997 40-41 20.5 29.049999999999997 27.650000000000002 22.8 42-43 21.6875 27.8125 28.1375 22.3625 44-45 20.8 29.362500000000004 28.0875 21.75 46-47 22.125 28.599999999999998 27.575 21.7 48-49 21.625 28.6125 27.3625 22.400000000000002 50-51 21.5375 29.349999999999998 27.450000000000003 21.6625 52-53 22.025 28.375 28.037499999999998 21.5625 54-55 21.212500000000002 28.599999999999998 28.125 22.0625 56-57 20.962500000000002 29.1875 27.5625 22.287499999999998 58-59 21.425 29.525000000000002 27.5125 21.5375 60-61 21.725 28.249999999999996 27.200000000000003 22.825 62-63 22.075 28.65 27.8625 21.4125 64-65 21.75 28.025 28.525 21.7 66-67 21.587500000000002 28.0875 28.5625 21.762500000000003 68-69 21.4 27.825 28.6625 22.112499999999997 70-71 21.3125 28.8375 27.2625 22.5875 72-73 21.6125 28.625 27.85 21.912499999999998 74-75 21.175 28.5875 28.299999999999997 21.9375 76-77 21.375 27.962500000000002 28.449999999999996 22.2125 78-79 21.375 28.925 27.787499999999998 21.912499999999998 80-81 21.7875 27.787499999999998 28.175 22.25 82-83 21.6875 28.349999999999998 28.0875 21.875 84-85 21.087500000000002 28.4125 28.625 21.875 86-87 21.775 27.950000000000003 28.675 21.6 88-89 22.5125 28.462500000000002 27.9375 21.087500000000002 90-91 22.1 27.762500000000003 28.762500000000003 21.375 92-93 22.55 27.700000000000003 28.5625 21.1875 94-95 22.0 28.199999999999996 28.3125 21.4875 96-97 22.1875 28.1375 28.075 21.6 98-99 22.125 27.425 29.15 21.3 100 22.625 28.249999999999996 28.425 20.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.5 24 0.5 25 1.5 26 4.0 27 7.0 28 10.0 29 12.0 30 14.0 31 21.0 32 39.5 33 53.5 34 68.0 35 89.0 36 108.0 37 130.0 38 144.0 39 178.0 40 201.0 41 198.0 42 231.5 43 277.0 44 277.0 45 258.5 46 260.5 47 241.0 48 204.5 49 195.5 50 175.0 51 134.5 52 113.5 53 89.0 54 69.0 55 52.5 56 34.0 57 26.0 58 17.5 59 12.0 60 12.0 61 10.0 62 6.0 63 5.0 64 4.0 65 3.5 66 2.0 67 1.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.025 30-31 0.075 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87471811576046 99.65 2 0.10022550739163118 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025056376847907794 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC 6 0.15 TruSeq Adapter, Index 5 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.025 0.0 72-73 0.1 0.0 0.0 0.025 0.0 74-75 0.1 0.0 0.0 0.025 0.0 76-77 0.1 0.0 0.0 0.025 0.0 78-79 0.1 0.0 0.0 0.025 0.0 80-81 0.1 0.0 0.0 0.025 0.0 82-83 0.125 0.0 0.0 0.025 0.0 84-85 0.15 0.0 0.0 0.025 0.0 86-87 0.175 0.0 0.0 0.025 0.0 88 0.2 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 249557 spots for SRR3207999.sra Written 249557 spots for SRR3207999.sra Read 249557 spots for SRR3207999.sra Written 249557 spots for SRR3207999.sra Read 249557 spots for SRR3207999.sra Written 249557 spots for SRR3207999.sra Read 249557 spots for SRR3207999.sra Written 249557 spots for SRR3207999.sra Read 249557 spots for SRR3207999.sra Written 249557 spots for SRR3207999.sra Read 249557 spots for SRR3207999.sra Written 249557 spots for SRR3207999.sra Read 249557 spots for SRR3207999.sra Written 249557 spots for SRR3207999.sra Read 249557 spots for SRR3207999.sra Written 249557 spots for SRR3207999.sra Read 249557 spots for SRR3207999.sra Written 249557 spots for SRR3207999.sra Read 249557 spots for SRR3207999.sra Written 249557 spots for SRR3207999.sra Read 249557 spots for SRR3207999.sra Written 249557 spots for SRR3207999.sra Read 249557 spots for SRR3207999.sra Written 249557 spots for SRR3207999.sra Read 249557 spots for SRR3207999.sra Written 249557 spots for SRR3207999.sra Read 249557 spots for SRR3207999.sra Written 249557 spots for SRR3207999.sra Read 249557 spots for SRR3207999.sra Written 249557 spots for SRR3207999.sra Read 249557 spots for SRR3207999.sra Written 249557 spots for SRR3207999.sra Read 249562 spots for SRR3207999.sra Written 249562 spots for SRR3207999.sra Read 249557 spots for SRR3207999.sra Written 249557 spots for SRR3207999.sra Read 249557 spots for SRR3207999.sra Written 249557 spots for SRR3207999.sra Read 249557 spots for SRR3207999.sra Written 249557 spots for SRR3207999.sra SRR ids: ['SRR3207999.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6g2dyykw SRR3207999.sra spots: 4991145 blocks: [[1, 249557], [249558, 499114], [499115, 748671], [748672, 998228], [998229, 1247785], [1247786, 1497342], [1497343, 1746899], [1746900, 1996456], [1996457, 2246013], [2246014, 2495570], [2495571, 2745127], [2745128, 2994684], [2994685, 3244241], [3244242, 3493798], [3493799, 3743355], [3743356, 3992912], [3992913, 4242469], [4242470, 4492026], [4492027, 4741583], [4741584, 4991145]] SRR3207999 file size 1292942 SRR3207999 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207999 SRR3207999_1.fastq Input file: SRR3207999_1.fastq trimmed: SRR3207999-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 00:42:59 2025 >> started Wed Feb 12 00:43:02 2025 >> done (2.441s) 4991145 reads processed; of these: 605 ( 0.01%) short reads filtered out after trimming by size control 9023 ( 0.18%) empty reads filtered out after trimming by size control 4981517 (99.81%) reads available; of these: 222507 ( 4.47%) trimmed reads available after processing 4759010 (95.53%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 82 0.00% 19 140 0.00% 20 163 0.00% 21 221 0.00% 22 287 0.01% 23 405 0.01% 24 569 0.01% 25 691 0.01% 26 754 0.02% 27 738 0.01% 28 738 0.01% 29 769 0.02% 30 791 0.02% 31 761 0.02% 32 832 0.02% 33 834 0.02% 34 834 0.02% 35 892 0.02% 36 865 0.02% 37 978 0.02% 38 924 0.02% 39 974 0.02% 40 1011 0.02% 41 1078 0.02% 42 1132 0.02% 43 1062 0.02% 44 1176 0.02% 45 1179 0.02% 46 1200 0.02% 47 1268 0.03% 48 1159 0.02% 49 1282 0.03% 50 1273 0.03% 51 1243 0.02% 52 1358 0.03% 53 1346 0.03% 54 1499 0.03% 55 1495 0.03% 56 1576 0.03% 57 1617 0.03% 58 1599 0.03% 59 1755 0.04% 60 1677 0.03% 61 1767 0.04% 62 1815 0.04% 63 1818 0.04% 64 1850 0.04% 65 1904 0.04% 66 1892 0.04% 67 2086 0.04% 68 2204 0.04% 69 2226 0.04% 70 2213 0.04% 71 2247 0.05% 72 2305 0.05% 73 2587 0.05% 74 2513 0.05% 75 2529 0.05% 76 1859 0.04% 77 2045 0.04% 78 2347 0.05% 79 2577 0.05% 80 2575 0.05% 81 2704 0.05% 82 2947 0.06% 83 3214 0.06% 84 3377 0.07% 85 3631 0.07% 86 3801 0.08% 87 4044 0.08% 88 4469 0.09% 89 4931 0.10% 90 5293 0.11% 91 5928 0.12% 92 6700 0.13% 93 7560 0.15% 94 8953 0.18% 95 10502 0.21% 96 12311 0.25% 97 14261 0.29% 98 15955 0.32% 99 16340 0.33% 100 4759010 95.53% 4981517 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=17.74 fanout-score-rank=8 prefix-density=0.14 prefix-fanout=17.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=11 fanout-score=124.59 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=19.7 sequence=TTTTCTTTTCTT Started job on | Feb 12 00:43:26 Started mapping on | Feb 12 00:43:26 Finished on | Feb 12 00:43:32 Mapping speed, Million of reads per hour | 2988.91 Number of input reads | 4981517 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 4782019 Uniquely mapped reads % | 96.00% Average mapped length | 98.76 Number of splices: Total | 1314776 Number of splices: Annotated (sjdb) | 1290280 Number of splices: GT/AG | 1295248 Number of splices: GC/AG | 15790 Number of splices: AT/AC | 1328 Number of splices: Non-canonical | 2410 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.07 Insertion rate per base | 0.01% Insertion average length | 1.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 102041 % of reads mapped to multiple loci | 2.05% Number of reads mapped to too many loci | 16864 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.61% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 97457 97457 97457 N_multimapping 102041 102041 102041 N_noFeature 192783 2460617 2473786 N_ambiguous 57089 8253 8523 UnstrandedReadsAssigned:4532147 PositiveStrandReadsAssigned:2313149 NegativeStrandReadsAssigned:2299710 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207999 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207999-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,981,517 reads, 4,644,039 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,147 rounds 52401 SRR3207999.ke.tsv 34699 SRR3207999.se.tsv 87100 total ==> SRR3207999.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 129 20.3521 Potri.005G024800.1.v4.1 1035 936 22 7.11609 Potri.004G059700.1.v4.1 961 862 6 2.10736 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 71.0467 7.56325 Potri.016G087400.1.v4.1 270 171 283 501.054 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 18 3.25545 Potri.012G127500.1.v4.1 977 878 422 145.517 ==> SRR3207999.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 653 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 97 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207999 completed mapping pipeline successfully