Starting /dee2/code/volunteer_pipeline.sh SRR3208001 current disk space = 3051442851840 free memory = 1577638092 SRR3208001 SRAfilesize 7cd5d13c517cd856791b30cbd5cce57e SRR3208001.sra SRR3208001.sra file validated SRR3208001 is single end SRR3208001 is conventional basespace SRR3208001 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208001_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.90675 33.0 32.0 34.0 25.0 34.0 2 32.01025 33.0 32.0 34.0 28.0 34.0 3 31.94625 33.0 32.0 34.0 27.0 34.0 4 31.75075 33.0 32.0 34.0 28.0 34.0 5 32.047 33.0 32.0 34.0 30.0 34.0 6 35.79625 38.0 36.0 38.0 31.0 38.0 7 36.255 38.0 37.0 38.0 33.0 38.0 8 36.2215 38.0 37.0 38.0 33.0 38.0 9 36.28625 38.0 37.0 38.0 33.0 38.0 10-11 36.41125 38.0 37.5 38.0 34.0 38.0 12-13 36.41 38.0 37.5 38.0 33.5 38.0 14-15 36.410250000000005 38.0 38.0 38.0 33.0 38.0 16-17 36.39125 38.0 38.0 38.0 33.5 38.0 18-19 36.319625 38.0 37.5 38.0 33.5 38.0 20-21 36.391000000000005 38.0 37.5 38.0 33.5 38.0 22-23 36.433875 38.0 38.0 38.0 34.0 38.0 24-25 36.412499999999994 38.0 38.0 38.0 34.0 38.0 26-27 36.218875 38.0 37.0 38.0 33.0 38.0 28-29 36.2145 38.0 37.5 38.0 33.0 38.0 30-31 36.406875 38.0 38.0 38.0 33.0 38.0 32-33 36.31975 38.0 38.0 38.0 33.5 38.0 34-35 36.346125 38.0 38.0 38.0 33.0 38.0 36-37 36.336625 38.0 37.5 38.0 33.5 38.0 38-39 36.390375 38.0 38.0 38.0 34.0 38.0 40-41 36.488375 38.0 38.0 38.0 34.0 38.0 42-43 36.294624999999996 38.0 38.0 38.0 33.5 38.0 44-45 36.295375 38.0 38.0 38.0 33.0 38.0 46-47 36.393249999999995 38.0 38.0 38.0 34.0 38.0 48-49 36.306625 38.0 37.5 38.0 33.0 38.0 50-51 36.316625 38.0 37.5 38.0 33.5 38.0 52-53 36.285875000000004 38.0 37.5 38.0 33.0 38.0 54-55 36.419375 38.0 38.0 38.0 34.0 38.0 56-57 36.331 38.0 38.0 38.0 33.5 38.0 58-59 36.234375 38.0 37.0 38.0 33.0 38.0 60-61 36.31625 38.0 37.5 38.0 33.5 38.0 62-63 36.261250000000004 38.0 38.0 38.0 33.0 38.0 64-65 36.149375000000006 38.0 37.0 38.0 33.0 38.0 66-67 36.309625 38.0 37.5 38.0 33.5 38.0 68-69 36.463125000000005 38.0 38.0 38.0 34.0 38.0 70-71 36.405875 38.0 38.0 38.0 33.5 38.0 72-73 36.193124999999995 38.0 37.0 38.0 33.0 38.0 74-75 36.19975 38.0 37.0 38.0 33.0 38.0 76-77 36.02975 38.0 37.0 38.0 32.0 38.0 78-79 36.201125000000005 38.0 37.0 38.0 33.0 38.0 80-81 36.287875 38.0 38.0 38.0 33.5 38.0 82-83 36.178250000000006 38.0 37.0 38.0 33.0 38.0 84-85 36.242125 38.0 37.0 38.0 33.0 38.0 86-87 36.266999999999996 38.0 38.0 38.0 33.0 38.0 88-89 36.082125000000005 38.0 37.0 38.0 32.0 38.0 90-91 36.050875000000005 38.0 37.0 38.0 33.0 38.0 92-93 35.99625 38.0 37.0 38.0 32.0 38.0 94-95 36.13875 38.0 37.0 38.0 33.0 38.0 96-97 36.029125 38.0 37.0 38.0 32.5 38.0 98-99 36.073750000000004 38.0 37.0 38.0 32.5 38.0 100-101 35.991 38.0 37.0 38.0 32.5 38.0 102-103 36.011375 38.0 37.0 38.0 33.0 38.0 104-105 36.065375 38.0 37.0 38.0 33.0 38.0 106-107 35.604625 38.0 37.0 38.0 31.0 38.0 108-109 34.758750000000006 38.0 37.0 38.0 28.0 38.0 110-111 34.807500000000005 38.0 36.5 38.0 27.5 38.0 112-113 34.608875 38.0 36.5 38.0 25.5 38.0 114-115 34.887375 38.0 36.5 38.0 26.5 38.0 116-117 35.186 38.0 36.5 38.0 28.0 38.0 118-119 35.382625000000004 38.0 37.0 38.0 29.0 38.0 120-121 35.213750000000005 38.0 36.5 38.0 29.0 38.0 122-123 35.225 38.0 37.0 38.0 30.0 38.0 124-125 33.69775 37.5 35.0 38.0 23.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 3.0 19 2.0 20 3.0 21 3.0 22 3.0 23 1.0 24 13.0 25 18.0 26 18.0 27 35.0 28 55.0 29 61.0 30 89.0 31 107.0 32 133.0 33 166.0 34 276.0 35 302.0 36 510.0 37 2199.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.059973924380706 14.758800521512386 12.046936114732725 51.13428943937418 2 17.7633224918689 20.465349011758818 42.30673004753565 19.46459844883663 3 20.974999999999998 24.375 28.475 26.174999999999997 4 23.225 32.6 20.825 23.35 5 25.35 34.599999999999994 23.225 16.825000000000003 6 18.3 36.975 24.4 20.325 7 16.725 19.625 43.0 20.65 8 17.8 23.474999999999998 32.574999999999996 26.150000000000002 9 19.05 22.55 32.824999999999996 25.575 10-11 22.45 31.95 23.8625 21.7375 12-13 20.599999999999998 27.075 29.5375 22.787499999999998 14-15 21.0 28.3125 28.962500000000002 21.725 16-17 21.6875 28.075 27.800000000000004 22.4375 18-19 21.525 29.1375 27.400000000000002 21.9375 20-21 22.075 28.762500000000003 27.3625 21.8 22-23 21.3875 29.275000000000002 27.725 21.6125 24-25 21.25 28.5625 28.65 21.5375 26-27 21.1625 28.825 28.1125 21.9 28-29 21.4125 29.1625 27.775 21.65 30-31 22.175 28.237499999999997 27.975 21.6125 32-33 20.424999999999997 28.8375 28.3375 22.400000000000002 34-35 21.3625 29.099999999999998 27.05 22.4875 36-37 21.7875 28.3375 27.750000000000004 22.125 38-39 21.175 28.9875 28.299999999999997 21.5375 40-41 21.25 29.175 27.487499999999997 22.0875 42-43 21.349999999999998 28.575 28.962500000000002 21.1125 44-45 22.6 27.3125 28.475 21.6125 46-47 21.912499999999998 28.999999999999996 27.2625 21.825 48-49 20.3125 28.95 28.349999999999998 22.3875 50-51 22.3 28.975 27.762500000000003 20.962500000000002 52-53 21.4125 27.900000000000002 28.7375 21.95 54-55 21.2375 28.012500000000003 28.787499999999998 21.9625 56-57 21.3875 28.3125 28.549999999999997 21.75 58-59 21.8875 27.962500000000002 28.762500000000003 21.3875 60-61 21.512500000000003 27.675 28.537499999999998 22.275 62-63 21.175 28.499999999999996 28.625 21.7 64-65 21.1375 28.625 28.3625 21.875 66-67 21.4125 28.425 28.287499999999998 21.875 68-69 22.15 28.15 29.062500000000004 20.6375 70-71 21.725 28.175 28.125 21.975 72-73 22.2125 29.075 27.9125 20.8 74-75 21.762500000000003 28.3875 29.212500000000002 20.6375 76-77 21.2875 29.2 28.1875 21.325 78-79 21.3 28.9375 28.275 21.4875 80-81 21.175 29.4375 28.15 21.2375 82-83 20.8 28.512500000000003 28.1875 22.5 84-85 21.425 28.9875 27.712500000000002 21.875 86-87 21.8625 29.0875 27.6125 21.4375 88-89 22.4875 28.0625 28.512500000000003 20.9375 90-91 20.7375 28.812500000000004 29.15 21.3 92-93 21.6625 28.749999999999996 28.3875 21.2 94-95 21.9 27.8625 28.65 21.587500000000002 96-97 21.4375 28.6125 28.5875 21.3625 98-99 22.2 29.2375 28.349999999999998 20.2125 100-101 22.275 28.9375 27.950000000000003 20.837500000000002 102-103 21.8625 28.1625 28.325 21.65 104-105 21.4875 28.499999999999996 28.8375 21.175 106-107 22.219416740310567 28.014139628834744 28.077262971846988 21.6891806590077 108-109 22.143318269851516 28.766946417043254 28.80568108457069 20.284054228534536 110-111 23.070997560662473 29.336243420207985 27.269225831300552 20.32353318782899 112-113 22.83678756476684 29.1839378238342 27.020725388601036 20.958549222797927 114-115 23.372478937962725 28.98902221087567 26.2190451876436 21.419453663518 116-117 23.179474279964786 29.71953213432273 26.587850584832097 20.513143000880394 118-119 23.4125 28.8625 26.875 20.849999999999998 120-121 23.2125 29.349999999999998 26.0375 21.4 122-123 23.3 28.8625 26.450000000000003 21.3875 124-125 23.1625 29.4875 25.5125 21.837500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.0 22 2.5 23 1.0 24 1.5 25 2.5 26 5.0 27 8.0 28 15.5 29 17.5 30 21.0 31 34.5 32 39.5 33 49.5 34 65.5 35 85.0 36 100.5 37 120.5 38 144.5 39 183.5 40 225.0 41 238.0 42 247.0 43 265.5 44 278.0 45 267.5 46 258.0 47 245.0 48 214.0 49 179.5 50 156.0 51 136.5 52 105.5 53 72.0 54 53.5 55 46.5 56 32.5 57 18.5 58 12.5 59 7.0 60 7.0 61 8.5 62 7.0 63 4.5 64 4.0 65 3.5 66 2.0 67 1.5 68 1.5 69 1.0 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.125 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.9875 108-109 3.1875 110-111 2.6374999999999997 112-113 3.5000000000000004 114-115 2.075 116-117 0.6125 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.0625 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 0.8375 0.0 0.0 0.0 0.0 96-97 1.0375 0.0 0.0 0.0 0.0 98-99 1.2374999999999998 0.0 0.0 0.0 0.0 100-101 1.4375 0.0 0.0 0.0 0.0 102-103 1.9125 0.0 0.0 0.0 0.0 104-105 2.4000000000000004 0.0 0.0 0.0 0.0 106-107 3.025 0.0 0.0 0.0 0.0 108-109 3.75 0.0 0.0 0.0 0.0 110-111 4.5375 0.0 0.0 0.0 0.0 112-113 5.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1552218 spots for SRR3208001.sra Written 1552218 spots for SRR3208001.sra Read 1552218 spots for SRR3208001.sra Written 1552218 spots for SRR3208001.sra Read 1552218 spots for SRR3208001.sra Written 1552218 spots for SRR3208001.sra Read 1552218 spots for SRR3208001.sra Written 1552218 spots for SRR3208001.sra Read 1552218 spots for SRR3208001.sra Written 1552218 spots for SRR3208001.sra Read 1552218 spots for SRR3208001.sra Written 1552218 spots for SRR3208001.sra Read 1552218 spots for SRR3208001.sra Written 1552218 spots for SRR3208001.sra Read 1552218 spots for SRR3208001.sra Written 1552218 spots for SRR3208001.sra Read 1552218 spots for SRR3208001.sra Written 1552218 spots for SRR3208001.sra Read 1552218 spots for SRR3208001.sra Written 1552218 spots for SRR3208001.sra Read 1552218 spots for SRR3208001.sra Written 1552218 spots for SRR3208001.sra Read 1552218 spots for SRR3208001.sra Written 1552218 spots for SRR3208001.sra Read 1552218 spots for SRR3208001.sra Written 1552218 spots for SRR3208001.sra Read 1552218 spots for SRR3208001.sra Written 1552218 spots for SRR3208001.sra Read 1552233 spots for SRR3208001.sra Written 1552233 spots for SRR3208001.sra Read 1552218 spots for SRR3208001.sra Written 1552218 spots for SRR3208001.sra Read 1552218 spots for SRR3208001.sra Written 1552218 spots for SRR3208001.sra Read 1552218 spots for SRR3208001.sra Written 1552218 spots for SRR3208001.sra Read 1552218 spots for SRR3208001.sra Written 1552218 spots for SRR3208001.sra Read 1552218 spots for SRR3208001.sra Written 1552218 spots for SRR3208001.sra SRR ids: ['SRR3208001.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_li8eivpq SRR3208001.sra spots: 31044375 blocks: [[1, 1552218], [1552219, 3104436], [3104437, 4656654], [4656655, 6208872], [6208873, 7761090], [7761091, 9313308], [9313309, 10865526], [10865527, 12417744], [12417745, 13969962], [13969963, 15522180], [15522181, 17074398], [17074399, 18626616], [18626617, 20178834], [20178835, 21731052], [21731053, 23283270], [23283271, 24835488], [24835489, 26387706], [26387707, 27939924], [27939925, 29492142], [29492143, 31044375]] SRR3208001 file size 9948348 SRR3208001 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208001 SRR3208001_1.fastq Input file: SRR3208001_1.fastq trimmed: SRR3208001-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 00:24:23 2025 >> started Wed Feb 12 00:24:43 2025 >> done (20.171s) 31044375 reads processed; of these: 10980 ( 0.04%) short reads filtered out after trimming by size control 61497 ( 0.20%) empty reads filtered out after trimming by size control 30971898 (99.77%) reads available; of these: 2531608 ( 8.17%) trimmed reads available after processing 28440290 (91.83%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 516 0.00% 19 454 0.00% 20 488 0.00% 21 539 0.00% 22 641 0.00% 23 815 0.00% 24 4288 0.01% 25 4764 0.02% 26 1014 0.00% 27 729 0.00% 28 670 0.00% 29 889 0.00% 30 1308 0.00% 31 1083 0.00% 32 1144 0.00% 33 567 0.00% 34 653 0.00% 35 730 0.00% 36 709 0.00% 37 716 0.00% 38 761 0.00% 39 746 0.00% 40 782 0.00% 41 760 0.00% 42 775 0.00% 43 820 0.00% 44 824 0.00% 45 843 0.00% 46 863 0.00% 47 987 0.00% 48 939 0.00% 49 1070 0.00% 50 1135 0.00% 51 1066 0.00% 52 1118 0.00% 53 1206 0.00% 54 1174 0.00% 55 1287 0.00% 56 1306 0.00% 57 1353 0.00% 58 1614 0.01% 59 1575 0.01% 60 1679 0.01% 61 1767 0.01% 62 1911 0.01% 63 2016 0.01% 64 2015 0.01% 65 2023 0.01% 66 2143 0.01% 67 2351 0.01% 68 2494 0.01% 69 2880 0.01% 70 3101 0.01% 71 3347 0.01% 72 3773 0.01% 73 4250 0.01% 74 4388 0.01% 75 4366 0.01% 76 4479 0.01% 77 4981 0.02% 78 5591 0.02% 79 6178 0.02% 80 7085 0.02% 81 8049 0.03% 82 8881 0.03% 83 9921 0.03% 84 10751 0.03% 85 11889 0.04% 86 12833 0.04% 87 13920 0.04% 88 15746 0.05% 89 17590 0.06% 90 20463 0.07% 91 23786 0.08% 92 27261 0.09% 93 30264 0.10% 94 3893 0.01% 95 4060 0.01% 96 4441 0.01% 97 4729 0.02% 98 4730 0.02% 99 5038 0.02% 100 5656 0.02% 101 5876 0.02% 102 6641 0.02% 103 7224 0.02% 104 7650 0.02% 105 9765 0.03% 106 9048 0.03% 107 9472 0.03% 108 10586 0.03% 109 11964 0.04% 110 13311 0.04% 111 15254 0.05% 112 17074 0.06% 113 19254 0.06% 114 22621 0.07% 115 27202 0.09% 116 32364 0.10% 117 40561 0.13% 118 50875 0.16% 119 63952 0.21% 120 84805 0.27% 121 120140 0.39% 122 185847 0.60% 123 346136 1.12% 124 1051546 3.40% 125 28440290 91.83% 30971898 reads passed initial QC criterion=sequence-density sequence-density=4.72 sequence-density-rank=1 fanout-score=42.31 fanout-score-rank=1 prefix-density=6.36 prefix-fanout=31.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=4.72 sequence-density-rank=1 fanout-score=42.31 fanout-score-rank=1 prefix-density=6.36 prefix-fanout=31.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGAAAAAAA -o SRR3208001 - Input file: STDIN trimmed: SRR3208001-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 00:26:02 2025 >> started Wed Feb 12 00:26:28 2025 >> done (26.075s) 18583139 reads processed; of these: 292 ( 0.00%) short reads filtered out after trimming by size control 1566 ( 0.01%) empty reads filtered out after trimming by size control 18581281 (99.99%) reads available; of these: 2710306 (14.59%) trimmed reads available after processing 15870975 (85.41%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 313 0.00% 19 295 0.00% 20 310 0.00% 21 387 0.00% 22 435 0.00% 23 519 0.00% 24 2466 0.01% 25 2629 0.01% 26 594 0.00% 27 471 0.00% 28 393 0.00% 29 539 0.00% 30 795 0.00% 31 645 0.00% 32 671 0.00% 33 347 0.00% 34 409 0.00% 35 446 0.00% 36 405 0.00% 37 434 0.00% 38 453 0.00% 39 474 0.00% 40 475 0.00% 41 475 0.00% 42 452 0.00% 43 493 0.00% 44 507 0.00% 45 545 0.00% 46 492 0.00% 47 587 0.00% 48 563 0.00% 49 677 0.00% 50 691 0.00% 51 647 0.00% 52 650 0.00% 53 731 0.00% 54 725 0.00% 55 759 0.00% 56 804 0.00% 57 845 0.00% 58 965 0.01% 59 952 0.01% 60 1047 0.01% 61 1055 0.01% 62 1172 0.01% 63 1213 0.01% 64 1206 0.01% 65 1228 0.01% 66 1297 0.01% 67 1444 0.01% 68 1479 0.01% 69 1706 0.01% 70 1850 0.01% 71 1938 0.01% 72 2112 0.01% 73 2223 0.01% 74 2335 0.01% 75 2565 0.01% 76 2720 0.01% 77 3028 0.02% 78 3363 0.02% 79 3740 0.02% 80 4244 0.02% 81 4922 0.03% 82 5340 0.03% 83 5961 0.03% 84 6433 0.03% 85 7181 0.04% 86 7708 0.04% 87 8455 0.05% 88 9543 0.05% 89 10562 0.06% 90 12208 0.07% 91 14089 0.08% 92 16106 0.09% 93 18379 0.10% 94 20835 0.11% 95 22529 0.12% 96 24543 0.13% 97 26837 0.14% 98 29786 0.16% 99 33163 0.18% 100 37640 0.20% 101 42327 0.23% 102 48758 0.26% 103 54237 0.29% 104 59396 0.32% 105 64040 0.34% 106 66507 0.36% 107 69917 0.38% 108 74751 0.40% 109 80922 0.44% 110 89078 0.48% 111 98322 0.53% 112 107835 0.58% 113 116973 0.63% 114 125175 0.67% 115 132991 0.72% 116 137431 0.74% 117 143862 0.77% 118 151849 0.82% 119 166449 0.90% 120 201443 1.08% 121 291870 1.57% 122 613438 3.30% 123 175238 0.94% 124 533861 2.87% 125 14541961 78.26% criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=41.74 fanout-score-rank=10 prefix-density=0.23 prefix-fanout=11.6 sequence=CACCACCACCATGGGCTCCCCAGCCACC criterion=fanout-score sequence-density=0.05 sequence-density-rank=14 fanout-score=336.63 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=30.4 sequence=TTCTTCTTCTTT Started job on | Feb 12 00:27:02 Started mapping on | Feb 12 00:27:03 Finished on | Feb 12 00:28:08 Mapping speed, Million of reads per hour | 1715.26 Number of input reads | 30970040 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 29337605 Uniquely mapped reads % | 94.73% Average mapped length | 122.43 Number of splices: Total | 11097434 Number of splices: Annotated (sjdb) | 10877708 Number of splices: GT/AG | 10925213 Number of splices: GC/AG | 141227 Number of splices: AT/AC | 10972 Number of splices: Non-canonical | 20022 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.02% Deletion average length | 2.19 Insertion rate per base | 0.02% Insertion average length | 1.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 608193 % of reads mapped to multiple loci | 1.96% Number of reads mapped to too many loci | 594521 % of reads mapped to too many loci | 1.92% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.37% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1024242 1024242 1024242 N_multimapping 608193 608193 608193 N_noFeature 1278861 15162978 15257010 N_ambiguous 306293 54938 55480 UnstrandedReadsAssigned:27752451 PositiveStrandReadsAssigned:14119689 NegativeStrandReadsAssigned:14025115 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208001 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208001-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,970,040 reads, 28,729,504 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,276 rounds 52401 SRR3208001.ke.tsv 34699 SRR3208001.se.tsv 87100 total ==> SRR3208001.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1107 28.5573 Potri.005G024800.1.v4.1 1035 936 159 8.40943 Potri.004G059700.1.v4.1 961 862 43 2.46949 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 382.631 6.66033 Potri.016G087400.1.v4.1 270 171 1215 351.743 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 120 3.54871 Potri.012G127500.1.v4.1 977 878 4059 228.86 ==> SRR3208001.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3075 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 610 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 52 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 24 SRR3208001 completed mapping pipeline successfully