Starting /dee2/code/volunteer_pipeline.sh SRR3208002 current disk space = 3051742199808 free memory = 1508791376 SRR3208002 SRAfilesize fd88a8221a74f6a0189fcdd1769aa185 SRR3208002.sra SRR3208002.sra file validated SRR3208002 is single end SRR3208002 is conventional basespace SRR3208002 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208002_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.48025 33.0 32.0 34.0 18.0 34.0 2 31.82625 33.0 32.0 34.0 27.0 34.0 3 31.8045 33.0 32.0 34.0 27.0 34.0 4 31.53025 33.0 32.0 34.0 27.0 34.0 5 31.8865 33.0 32.0 34.0 30.0 34.0 6 35.436 38.0 36.0 38.0 29.0 38.0 7 35.8995 38.0 37.0 38.0 31.0 38.0 8 36.064 38.0 37.0 38.0 31.0 38.0 9 36.2855 38.0 37.0 38.0 33.0 38.0 10-11 36.307375 38.0 37.0 38.0 33.5 38.0 12-13 36.213125 38.0 37.0 38.0 33.0 38.0 14-15 36.302625 38.0 37.0 38.0 33.0 38.0 16-17 36.167249999999996 38.0 37.0 38.0 33.0 38.0 18-19 36.21575 38.0 37.0 38.0 33.0 38.0 20-21 36.188375 38.0 37.0 38.0 32.5 38.0 22-23 36.307375 38.0 37.0 38.0 33.0 38.0 24-25 36.250125 38.0 37.0 38.0 33.0 38.0 26-27 36.079875 38.0 37.0 38.0 32.5 38.0 28-29 36.007125 38.0 37.0 38.0 32.0 38.0 30-31 36.086749999999995 38.0 37.0 38.0 33.0 38.0 32-33 36.091875 38.0 37.0 38.0 33.0 38.0 34-35 36.079625 38.0 37.0 38.0 32.5 38.0 36-37 36.10325 38.0 37.0 38.0 32.0 38.0 38-39 36.16075 38.0 37.0 38.0 33.0 38.0 40-41 36.18825 38.0 37.5 38.0 33.0 38.0 42-43 36.169624999999996 38.0 37.0 38.0 32.5 38.0 44-45 36.095875 38.0 37.0 38.0 32.0 38.0 46-47 36.116 38.0 37.0 38.0 33.0 38.0 48-49 35.936125000000004 38.0 37.0 38.0 32.0 38.0 50-51 36.09325 38.0 37.0 38.0 32.0 38.0 52-53 36.095 38.0 37.0 38.0 33.0 38.0 54-55 36.104375000000005 38.0 37.0 38.0 32.0 38.0 56-57 35.931 38.0 37.0 38.0 31.0 38.0 58-59 36.017250000000004 38.0 37.0 38.0 31.5 38.0 60-61 36.006125 38.0 37.0 38.0 32.0 38.0 62-63 36.004375 38.0 37.0 38.0 32.0 38.0 64-65 35.937749999999994 38.0 37.0 38.0 31.0 38.0 66-67 36.08475 38.0 37.0 38.0 33.0 38.0 68-69 36.190124999999995 38.0 37.0 38.0 33.0 38.0 70-71 36.200375 38.0 37.0 38.0 33.0 38.0 72-73 36.097 38.0 37.0 38.0 33.0 38.0 74-75 35.944625 38.0 37.0 38.0 31.0 38.0 76-77 35.775125 38.0 37.0 38.0 31.0 38.0 78-79 35.972125000000005 38.0 37.0 38.0 32.0 38.0 80-81 36.072625 38.0 37.0 38.0 33.0 38.0 82-83 35.9825 38.0 37.0 38.0 31.5 38.0 84-85 36.04775 38.0 37.0 38.0 32.0 38.0 86-87 35.987 38.0 37.0 38.0 32.0 38.0 88-89 35.93275 38.0 37.0 38.0 31.0 38.0 90-91 35.8965 38.0 37.0 38.0 31.0 38.0 92-93 35.948750000000004 38.0 37.0 38.0 32.5 38.0 94-95 35.87775 38.0 37.0 38.0 31.5 38.0 96-97 35.881125 38.0 37.0 38.0 31.0 38.0 98-99 35.889375 38.0 37.0 38.0 31.0 38.0 100-101 35.612 38.0 37.0 38.0 31.0 38.0 102-103 35.71675 38.0 37.0 38.0 31.0 38.0 104-105 35.849000000000004 38.0 37.0 38.0 32.0 38.0 106-107 35.3565 38.0 36.5 38.0 29.5 38.0 108-109 34.505750000000006 38.0 36.0 38.0 26.0 38.0 110-111 34.5495 38.0 36.0 38.0 26.0 38.0 112-113 34.136624999999995 38.0 36.0 38.0 23.0 38.0 114-115 34.220124999999996 38.0 35.5 38.0 24.0 38.0 116-117 34.74275 38.0 35.5 38.0 25.5 38.0 118-119 35.063125 38.0 36.0 38.0 28.0 38.0 120-121 35.029375 38.0 36.0 38.0 28.5 38.0 122-123 35.108374999999995 38.0 36.0 38.0 29.0 38.0 124-125 33.560625 37.5 34.0 38.0 22.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 3.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 1.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.0 18 1.0 19 1.0 20 1.0 21 2.0 22 4.0 23 8.0 24 11.0 25 26.0 26 33.0 27 47.0 28 61.0 29 50.0 30 94.0 31 130.0 32 122.0 33 173.0 34 298.0 35 346.0 36 547.0 37 2034.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.274881516587676 14.955239599789364 12.269615587151133 50.50026329647183 2 18.363772829622217 22.34175631723793 39.80485364023017 19.489617212909682 3 20.75 25.874999999999996 27.05 26.325 4 24.65 32.225 19.675 23.45 5 23.799999999999997 34.0 24.05 18.15 6 19.975 35.449999999999996 24.55 20.025000000000002 7 15.85 19.225 44.425 20.5 8 18.075 22.775000000000002 32.475 26.674999999999997 9 19.425 23.95 32.324999999999996 24.3 10-11 21.75 33.475 23.7 21.075 12-13 19.3375 27.287499999999998 30.012499999999996 23.3625 14-15 21.175 28.212500000000002 28.925 21.6875 16-17 21.5625 27.5125 27.900000000000002 23.025000000000002 18-19 21.0625 28.012500000000003 28.1625 22.7625 20-21 21.675 28.7375 27.737499999999997 21.85 22-23 21.375 28.000000000000004 28.6375 21.987499999999997 24-25 20.8875 28.549999999999997 28.1375 22.425 26-27 21.625 28.65 27.750000000000004 21.975 28-29 21.75 28.3625 28.287499999999998 21.6 30-31 21.2 28.5875 28.3625 21.85 32-33 21.6875 28.4 27.6625 22.25 34-35 21.987499999999997 27.625 28.537499999999998 21.85 36-37 21.4375 28.975 28.3625 21.224999999999998 38-39 21.9 27.9375 28.175 21.987499999999997 40-41 21.95 28.762500000000003 28.375 20.9125 42-43 20.8625 28.5875 28.675 21.875 44-45 21.2875 28.075 28.725 21.912499999999998 46-47 21.95 28.249999999999996 27.8625 21.9375 48-49 21.8125 28.5875 28.000000000000004 21.6 50-51 21.6875 28.0875 28.4 21.825 52-53 22.475 28.425 27.1375 21.9625 54-55 21.825 29.375 27.0 21.8 56-57 20.7125 27.950000000000003 29.912499999999998 21.425 58-59 21.8875 28.3875 28.8375 20.8875 60-61 21.3 27.762500000000003 28.549999999999997 22.3875 62-63 22.025 27.250000000000004 28.212500000000002 22.5125 64-65 21.6625 28.237499999999997 27.875 22.225 66-67 21.6625 28.349999999999998 28.349999999999998 21.637500000000003 68-69 21.2375 28.487499999999997 28.4375 21.837500000000002 70-71 21.75 28.1875 28.237499999999997 21.825 72-73 21.0375 27.737499999999997 28.4375 22.787499999999998 74-75 21.837500000000002 28.499999999999996 27.900000000000002 21.762500000000003 76-77 22.425 28.487499999999997 28.537499999999998 20.549999999999997 78-79 22.0 28.299999999999997 27.287499999999998 22.412499999999998 80-81 22.0 28.012500000000003 28.425 21.5625 82-83 22.1375 27.787499999999998 28.925 21.15 84-85 22.0625 28.375 27.6125 21.95 86-87 21.775 28.487499999999997 27.8125 21.925 88-89 21.75 28.9875 27.375 21.8875 90-91 21.462500000000002 29.012500000000003 27.962500000000002 21.5625 92-93 21.975 27.6625 29.2375 21.125 94-95 22.25 29.275000000000002 27.5625 20.9125 96-97 21.6625 28.349999999999998 27.8625 22.125 98-99 21.9 29.312500000000004 27.275 21.512500000000003 100-101 22.1875 29.125 27.1625 21.525 102-103 22.4625 29.1625 27.35 21.025 104-105 22.4625 28.575 27.950000000000003 21.0125 106-107 21.3154226333798 27.85451780509441 28.906349005195793 21.923710556329993 108-109 22.504230118443317 28.140049459846416 28.73877391643889 20.61694650527138 110-111 22.207859358841777 28.645294725956568 29.007238883143742 20.13960703205791 112-113 22.768265586197884 29.551692589204027 26.859234087047447 20.82080773755065 114-115 22.125144545804957 28.973403571887445 26.365154824617758 22.536297057689836 116-117 22.678077019884217 29.234835137175935 27.15831865089353 20.92876919204631 118-119 23.425 29.25 26.674999999999997 20.65 120-121 22.6375 29.75 26.2125 21.4 122-123 23.1875 29.2 25.8625 21.75 124-125 22.5875 29.225 26.6 21.587500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.5 24 2.0 25 2.5 26 2.5 27 4.0 28 8.0 29 15.5 30 27.5 31 28.0 32 31.5 33 51.0 34 67.5 35 91.0 36 109.0 37 126.0 38 142.0 39 169.0 40 204.0 41 234.5 42 260.0 43 263.5 44 266.0 45 263.5 46 260.5 47 244.5 48 223.0 49 187.5 50 143.5 51 131.5 52 114.0 53 74.0 54 54.0 55 46.5 56 33.5 57 24.5 58 15.5 59 12.5 60 13.0 61 13.5 62 10.5 63 5.0 64 2.5 65 2.5 66 1.0 67 1.0 68 2.0 69 3.5 70 2.5 71 0.0 72 1.0 73 2.0 74 1.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.050000000000001 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 1.3625 108-109 3.9625 110-111 3.3000000000000003 112-113 4.3625 114-115 2.7125 116-117 0.675 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.3 0.0 0.0 0.0 0.0 104-105 1.725 0.0 0.0 0.0 0.0 106-107 2.3375 0.0 0.0 0.0 0.0 108-109 2.9875 0.0 0.0 0.0 0.0 110-111 3.8625 0.0 0.0 0.0 0.0 112-113 4.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1548743 spots for SRR3208002.sra Written 1548743 spots for SRR3208002.sra Read 1548743 spots for SRR3208002.sra Written 1548743 spots for SRR3208002.sra Read 1548743 spots for SRR3208002.sra Written 1548743 spots for SRR3208002.sra Read 1548743 spots for SRR3208002.sra Written 1548743 spots for SRR3208002.sra Read 1548743 spots for SRR3208002.sra Written 1548743 spots for SRR3208002.sra Read 1548743 spots for SRR3208002.sra Written 1548743 spots for SRR3208002.sra Read 1548743 spots for SRR3208002.sra Written 1548743 spots for SRR3208002.sra Read 1548743 spots for SRR3208002.sra Written 1548743 spots for SRR3208002.sra Read 1548743 spots for SRR3208002.sra Written 1548743 spots for SRR3208002.sra Read 1548743 spots for SRR3208002.sra Written 1548743 spots for SRR3208002.sra Read 1548743 spots for SRR3208002.sra Written 1548743 spots for SRR3208002.sra Read 1548743 spots for SRR3208002.sra Written 1548743 spots for SRR3208002.sra Read 1548743 spots for SRR3208002.sra Written 1548743 spots for SRR3208002.sra Read 1548743 spots for SRR3208002.sra Written 1548743 spots for SRR3208002.sra Read 1548743 spots for SRR3208002.sra Written 1548743 spots for SRR3208002.sra Read 1548743 spots for SRR3208002.sra Written 1548743 spots for SRR3208002.sra Read 1548743 spots for SRR3208002.sra Written 1548743 spots for SRR3208002.sra Read 1548743 spots for SRR3208002.sra Written 1548743 spots for SRR3208002.sra Read 1548748 spots for SRR3208002.sra Written 1548748 spots for SRR3208002.sra Read 1548743 spots for SRR3208002.sra Written 1548743 spots for SRR3208002.sra SRR ids: ['SRR3208002.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c933hodq SRR3208002.sra spots: 30974865 blocks: [[1, 1548743], [1548744, 3097486], [3097487, 4646229], [4646230, 6194972], [6194973, 7743715], [7743716, 9292458], [9292459, 10841201], [10841202, 12389944], [12389945, 13938687], [13938688, 15487430], [15487431, 17036173], [17036174, 18584916], [18584917, 20133659], [20133660, 21682402], [21682403, 23231145], [23231146, 24779888], [24779889, 26328631], [26328632, 27877374], [27877375, 29426117], [29426118, 30974865]] SRR3208002 file size 9926060 SRR3208002 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208002 SRR3208002_1.fastq Input file: SRR3208002_1.fastq trimmed: SRR3208002-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 00:08:11 2025 >> started Wed Feb 12 00:08:32 2025 >> done (20.841s) 30974865 reads processed; of these: 10568 ( 0.03%) short reads filtered out after trimming by size control 34925 ( 0.11%) empty reads filtered out after trimming by size control 30929372 (99.85%) reads available; of these: 2536712 ( 8.20%) trimmed reads available after processing 28392660 (91.80%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 434 0.00% 19 443 0.00% 20 509 0.00% 21 524 0.00% 22 579 0.00% 23 789 0.00% 24 4116 0.01% 25 4659 0.02% 26 971 0.00% 27 655 0.00% 28 656 0.00% 29 859 0.00% 30 1158 0.00% 31 1089 0.00% 32 1040 0.00% 33 540 0.00% 34 538 0.00% 35 639 0.00% 36 625 0.00% 37 655 0.00% 38 640 0.00% 39 630 0.00% 40 649 0.00% 41 639 0.00% 42 703 0.00% 43 728 0.00% 44 725 0.00% 45 771 0.00% 46 732 0.00% 47 788 0.00% 48 873 0.00% 49 930 0.00% 50 959 0.00% 51 932 0.00% 52 966 0.00% 53 1022 0.00% 54 1053 0.00% 55 1088 0.00% 56 1214 0.00% 57 1304 0.00% 58 1338 0.00% 59 1376 0.00% 60 1466 0.00% 61 1520 0.00% 62 1530 0.00% 63 1655 0.01% 64 1794 0.01% 65 1758 0.01% 66 1868 0.01% 67 2009 0.01% 68 2179 0.01% 69 2347 0.01% 70 2584 0.01% 71 2725 0.01% 72 3068 0.01% 73 3294 0.01% 74 3435 0.01% 75 3651 0.01% 76 3773 0.01% 77 4282 0.01% 78 4733 0.02% 79 5058 0.02% 80 5710 0.02% 81 6463 0.02% 82 7232 0.02% 83 8263 0.03% 84 8910 0.03% 85 9681 0.03% 86 10256 0.03% 87 11344 0.04% 88 12900 0.04% 89 14517 0.05% 90 16736 0.05% 91 19351 0.06% 92 22089 0.07% 93 25084 0.08% 94 4008 0.01% 95 4267 0.01% 96 4422 0.01% 97 4697 0.02% 98 5063 0.02% 99 5311 0.02% 100 5824 0.02% 101 6221 0.02% 102 6763 0.02% 103 7495 0.02% 104 8110 0.03% 105 10001 0.03% 106 9630 0.03% 107 10159 0.03% 108 10830 0.04% 109 12263 0.04% 110 13896 0.04% 111 15542 0.05% 112 17638 0.06% 113 20201 0.07% 114 23463 0.08% 115 28133 0.09% 116 33028 0.11% 117 41184 0.13% 118 52227 0.17% 119 66346 0.21% 120 86853 0.28% 121 122901 0.40% 122 189736 0.61% 123 356173 1.15% 124 1079524 3.49% 125 28392660 91.80% 30929372 reads passed initial QC criterion=sequence-density sequence-density=3.92 sequence-density-rank=1 fanout-score=44.89 fanout-score-rank=1 prefix-density=5.35 prefix-fanout=32.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=3.92 sequence-density-rank=1 fanout-score=44.89 fanout-score-rank=1 prefix-density=5.35 prefix-fanout=32.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTGAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTGAAAAAAA -o SRR3208002 - Input file: STDIN trimmed: SRR3208002-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 00:10:07 2025 >> started Wed Feb 12 00:10:31 2025 >> done (23.778s) 15464686 reads processed; of these: 228 ( 0.00%) short reads filtered out after trimming by size control 359 ( 0.00%) empty reads filtered out after trimming by size control 15464099 (100.00%) reads available; of these: 2005222 (12.97%) trimmed reads available after processing 13458877 (87.03%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 231 0.00% 19 236 0.00% 20 289 0.00% 21 349 0.00% 22 378 0.00% 23 413 0.00% 24 2117 0.01% 25 2392 0.02% 26 508 0.00% 27 343 0.00% 28 336 0.00% 29 446 0.00% 30 575 0.00% 31 515 0.00% 32 528 0.00% 33 273 0.00% 34 262 0.00% 35 337 0.00% 36 329 0.00% 37 349 0.00% 38 338 0.00% 39 303 0.00% 40 304 0.00% 41 313 0.00% 42 352 0.00% 43 370 0.00% 44 358 0.00% 45 396 0.00% 46 382 0.00% 47 404 0.00% 48 446 0.00% 49 462 0.00% 50 489 0.00% 51 477 0.00% 52 488 0.00% 53 528 0.00% 54 534 0.00% 55 595 0.00% 56 607 0.00% 57 642 0.00% 58 686 0.00% 59 684 0.00% 60 689 0.00% 61 786 0.01% 62 793 0.01% 63 867 0.01% 64 883 0.01% 65 892 0.01% 66 934 0.01% 67 1027 0.01% 68 1103 0.01% 69 1169 0.01% 70 1313 0.01% 71 1371 0.01% 72 1498 0.01% 73 1570 0.01% 74 1623 0.01% 75 1790 0.01% 76 1898 0.01% 77 2155 0.01% 78 2350 0.02% 79 2564 0.02% 80 2844 0.02% 81 3275 0.02% 82 3656 0.02% 83 4144 0.03% 84 4394 0.03% 85 4855 0.03% 86 5172 0.03% 87 5751 0.04% 88 6592 0.04% 89 7385 0.05% 90 8532 0.06% 91 9480 0.06% 92 10894 0.07% 93 12691 0.08% 94 14042 0.09% 95 15540 0.10% 96 16661 0.11% 97 18425 0.12% 98 20368 0.13% 99 22994 0.15% 100 26309 0.17% 101 29600 0.19% 102 34096 0.22% 103 38113 0.25% 104 41512 0.27% 105 45413 0.29% 106 47242 0.31% 107 50706 0.33% 108 53429 0.35% 109 58693 0.38% 110 64365 0.42% 111 71437 0.46% 112 78851 0.51% 113 86186 0.56% 114 92260 0.60% 115 98697 0.64% 116 103615 0.67% 117 108239 0.70% 118 115442 0.75% 119 128573 0.83% 120 157458 1.02% 121 234438 1.52% 122 502474 3.25% 123 153417 0.99% 124 465990 3.01% 125 12331210 79.74% criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=81.12 fanout-score-rank=5 prefix-density=0.28 prefix-fanout=17.4 sequence=TTCTTTCTTTCT criterion=fanout-score sequence-density=0.05 sequence-density-rank=11 fanout-score=267.56 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=27.6 sequence=AAGAAGAAGAAA Started job on | Feb 12 00:11:05 Started mapping on | Feb 12 00:11:05 Finished on | Feb 12 00:12:05 Mapping speed, Million of reads per hour | 1855.73 Number of input reads | 30928785 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 28936968 Uniquely mapped reads % | 93.56% Average mapped length | 122.75 Number of splices: Total | 10875034 Number of splices: Annotated (sjdb) | 10669479 Number of splices: GT/AG | 10708322 Number of splices: GC/AG | 135664 Number of splices: AT/AC | 11111 Number of splices: Non-canonical | 19937 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.02% Deletion average length | 2.19 Insertion rate per base | 0.02% Insertion average length | 1.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 610218 % of reads mapped to multiple loci | 1.97% Number of reads mapped to too many loci | 919972 % of reads mapped to too many loci | 2.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.47% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1381599 1381599 1381599 N_multimapping 610218 610218 610218 N_noFeature 1224663 14961492 15000330 N_ambiguous 302584 51248 52020 UnstrandedReadsAssigned:27409721 PositiveStrandReadsAssigned:13924228 NegativeStrandReadsAssigned:13884618 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208002 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208002-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,928,785 reads, 28,708,421 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,203 rounds 52401 SRR3208002.ke.tsv 34699 SRR3208002.se.tsv 87100 total ==> SRR3208002.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 929 23.8552 Potri.005G024800.1.v4.1 1035 936 167 8.79189 Potri.004G059700.1.v4.1 961 862 61 3.4871 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 484.761 8.39923 Potri.016G087400.1.v4.1 270 171 1359 391.62 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 101 2.97309 Potri.012G127500.1.v4.1 977 878 6202 348.08 ==> SRR3208002.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3067 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 585 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 51 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR3208002 completed mapping pipeline successfully