Starting /dee2/code/volunteer_pipeline.sh SRR3208003 current disk space = 3051755520000 free memory = 1506621692 SRR3208003 SRAfilesize 0be56f63e26a8ac8e1737cb5d736defe SRR3208003.sra SRR3208003.sra file validated SRR3208003 is single end SRR3208003 is conventional basespace SRR3208003 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208003_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.27625 33.0 32.0 34.0 27.0 34.0 2 32.0025 33.0 32.0 34.0 28.0 34.0 3 31.977 33.0 32.0 34.0 28.0 34.0 4 31.69425 33.0 32.0 34.0 28.0 34.0 5 31.85775 33.0 32.0 34.0 28.0 34.0 6 35.5135 38.0 36.0 38.0 29.0 38.0 7 35.972 38.0 37.0 38.0 31.0 38.0 8 36.15525 38.0 37.0 38.0 33.0 38.0 9 36.2745 38.0 37.0 38.0 33.0 38.0 10-11 36.301625 38.0 37.0 38.0 33.0 38.0 12-13 36.266125 38.0 37.5 38.0 33.5 38.0 14-15 36.27575 38.0 37.0 38.0 33.0 38.0 16-17 36.244125 38.0 37.5 38.0 32.0 38.0 18-19 36.208125 38.0 37.5 38.0 33.0 38.0 20-21 36.24625 38.0 37.0 38.0 33.0 38.0 22-23 36.320750000000004 38.0 37.5 38.0 33.0 38.0 24-25 36.284000000000006 38.0 37.0 38.0 33.0 38.0 26-27 36.12475 38.0 37.0 38.0 33.0 38.0 28-29 36.178 38.0 37.0 38.0 32.5 38.0 30-31 36.24925 38.0 37.0 38.0 33.0 38.0 32-33 36.216625 38.0 37.5 38.0 33.0 38.0 34-35 36.195875 38.0 37.0 38.0 33.0 38.0 36-37 36.2485 38.0 37.0 38.0 33.0 38.0 38-39 36.19799999999999 38.0 37.0 38.0 32.0 38.0 40-41 36.284 38.0 37.5 38.0 33.0 38.0 42-43 36.232749999999996 38.0 37.5 38.0 33.0 38.0 44-45 36.1775 38.0 37.0 38.0 33.0 38.0 46-47 36.25175 38.0 37.0 38.0 33.0 38.0 48-49 36.147375 38.0 37.0 38.0 33.0 38.0 50-51 36.190625 38.0 37.0 38.0 33.0 38.0 52-53 36.21825 38.0 37.0 38.0 33.0 38.0 54-55 36.15025 38.0 37.0 38.0 33.0 38.0 56-57 36.076375 38.0 37.0 38.0 32.0 38.0 58-59 36.114 38.0 37.0 38.0 32.5 38.0 60-61 36.01275 38.0 37.0 38.0 32.0 38.0 62-63 36.076875 38.0 37.0 38.0 32.0 38.0 64-65 36.073875 38.0 37.0 38.0 32.5 38.0 66-67 36.132 38.0 37.0 38.0 32.5 38.0 68-69 36.2265 38.0 37.5 38.0 33.0 38.0 70-71 36.267875000000004 38.0 37.5 38.0 33.5 38.0 72-73 36.19425 38.0 37.0 38.0 33.5 38.0 74-75 36.158500000000004 38.0 37.0 38.0 33.0 38.0 76-77 35.93375 38.0 37.0 38.0 32.0 38.0 78-79 36.01325 38.0 37.0 38.0 33.0 38.0 80-81 36.091625 38.0 37.0 38.0 33.0 38.0 82-83 35.970375000000004 38.0 37.0 38.0 33.0 38.0 84-85 35.995000000000005 38.0 37.0 38.0 33.0 38.0 86-87 35.9675 38.0 37.0 38.0 33.0 38.0 88-89 35.838125 38.0 37.0 38.0 31.0 38.0 90-91 35.87075 38.0 37.0 38.0 32.0 38.0 92-93 35.77912499999999 38.0 37.0 38.0 31.0 38.0 94-95 35.850875 38.0 37.0 38.0 32.0 38.0 96-97 35.771125 38.0 37.0 38.0 31.0 38.0 98-99 35.76325 38.0 37.0 38.0 31.0 38.0 100-101 35.739875 38.0 37.0 38.0 31.0 38.0 102-103 35.701750000000004 38.0 37.0 38.0 31.0 38.0 104-105 35.732875 38.0 37.0 38.0 31.0 38.0 106-107 35.474625 38.0 37.0 38.0 31.0 38.0 108-109 34.951 38.0 37.0 38.0 28.0 38.0 110-111 35.02 38.0 37.0 38.0 29.0 38.0 112-113 34.7315 38.0 36.5 38.0 27.0 38.0 114-115 34.91075 38.0 36.5 38.0 27.5 38.0 116-117 35.07825 38.0 36.5 38.0 28.5 38.0 118-119 35.2335 38.0 36.5 38.0 29.0 38.0 120-121 35.04175 38.0 36.5 38.0 29.5 38.0 122-123 35.008375 38.0 36.5 38.0 28.5 38.0 124-125 33.403875 37.5 34.0 38.0 23.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 1.0 11 1.0 12 0.0 13 1.0 14 0.0 15 1.0 16 0.0 17 1.0 18 1.0 19 2.0 20 4.0 21 6.0 22 9.0 23 19.0 24 8.0 25 20.0 26 25.0 27 36.0 28 52.0 29 56.0 30 92.0 31 117.0 32 124.0 33 184.0 34 245.0 35 311.0 36 536.0 37 2144.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.723775327006926 16.465760451397795 15.080789946140035 45.729674275455245 2 20.375 21.925 37.3 20.4 3 20.625 25.224999999999998 29.299999999999997 24.85 4 22.775000000000002 29.9 23.65 23.674999999999997 5 24.875 35.55 22.05 17.525 6 18.925 36.425000000000004 25.374999999999996 19.275000000000002 7 17.974999999999998 20.125 42.175000000000004 19.725 8 18.025 24.75 31.2 26.025 9 18.9 24.5 32.225 24.375 10-11 22.35 33.25 23.625 20.775 12-13 19.825 27.725 30.4625 21.987499999999997 14-15 21.7875 27.787499999999998 28.262500000000003 22.162499999999998 16-17 21.475 28.675 27.962500000000002 21.8875 18-19 21.8625 28.925 27.425 21.7875 20-21 21.3625 29.15 26.85 22.6375 22-23 21.0 29.075 27.762500000000003 22.162499999999998 24-25 20.962500000000002 28.712500000000002 28.6125 21.712500000000002 26-27 21.912499999999998 28.875 27.712500000000002 21.5 28-29 21.2875 27.962500000000002 28.525 22.225 30-31 21.0125 29.0875 28.325 21.575 32-33 22.0125 28.537499999999998 28.125 21.325 34-35 21.6625 29.45 27.5125 21.375 36-37 20.7375 29.1125 28.6125 21.5375 38-39 21.7875 29.4 27.3625 21.45 40-41 22.175 28.5625 27.075 22.1875 42-43 21.087500000000002 28.9125 28.9125 21.087500000000002 44-45 21.95 28.549999999999997 27.750000000000004 21.75 46-47 21.3 29.025000000000002 27.8625 21.8125 48-49 21.95 28.275 27.737499999999997 22.037499999999998 50-51 21.337500000000002 29.2875 27.474999999999998 21.9 52-53 21.6 28.599999999999998 28.212500000000002 21.587500000000002 54-55 21.462500000000002 28.849999999999998 27.1625 22.525000000000002 56-57 20.674999999999997 29.575000000000003 27.35 22.400000000000002 58-59 21.837500000000002 27.1375 29.5 21.525 60-61 21.4375 28.3125 28.487499999999997 21.762500000000003 62-63 21.6875 28.462500000000002 28.175 21.675 64-65 21.1625 28.8875 27.962500000000002 21.987499999999997 66-67 21.625 27.450000000000003 28.549999999999997 22.375 68-69 21.512500000000003 28.15 28.6875 21.65 70-71 21.099999999999998 28.6375 28.475 21.7875 72-73 21.462500000000002 29.2375 28.037499999999998 21.2625 74-75 21.912499999999998 28.237499999999997 28.475 21.375 76-77 21.637500000000003 29.45 27.237499999999997 21.675 78-79 20.7875 28.349999999999998 28.0625 22.8 80-81 22.225 27.712500000000002 29.2375 20.825 82-83 22.7 28.349999999999998 27.3625 21.587500000000002 84-85 21.3 28.825 27.8125 22.0625 86-87 22.25 28.299999999999997 27.675 21.775 88-89 22.0125 28.0875 28.5875 21.3125 90-91 22.2 28.249999999999996 28.725 20.825 92-93 21.8125 27.787499999999998 28.512500000000003 21.8875 94-95 21.337500000000002 29.012500000000003 28.299999999999997 21.349999999999998 96-97 22.05 28.5875 27.5625 21.8 98-99 21.8625 29.725 27.750000000000004 20.6625 100-101 21.5 29.5 27.6625 21.337500000000002 102-103 22.275 29.0875 27.3625 21.275 104-105 22.4625 29.125 27.537499999999998 20.875 106-107 21.24417579649918 29.467321496033243 27.15023296814003 22.13826973932754 108-109 21.83511995916284 28.968861664114343 27.20775906074528 21.98825931597754 110-111 22.77530235518778 28.847867600254617 26.92552514322088 21.45130490133673 112-113 22.59879780023021 28.64816472694718 27.292492646118426 21.46054482670418 114-115 22.04035020936429 28.981093769826167 27.483821850019037 21.494734170790508 116-117 22.02560240963855 29.417670682730922 26.706827309236946 21.849899598393574 118-119 22.9375 29.525000000000002 26.387500000000003 21.15 120-121 22.525000000000002 29.2875 26.387500000000003 21.8 122-123 23.3625 29.425 25.687500000000004 21.525 124-125 23.549999999999997 29.8375 25.35 21.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.5 21 2.5 22 2.5 23 3.5 24 4.0 25 4.0 26 10.0 27 14.5 28 14.5 29 19.5 30 26.0 31 32.5 32 40.0 33 52.5 34 68.5 35 86.5 36 105.0 37 130.5 38 161.5 39 177.5 40 197.0 41 233.0 42 251.5 43 255.5 44 257.0 45 251.0 46 237.5 47 228.5 48 216.0 49 184.5 50 143.0 51 117.5 52 105.0 53 82.5 54 64.5 55 53.5 56 40.5 57 27.0 58 16.0 59 12.5 60 15.0 61 13.5 62 6.5 63 3.5 64 4.5 65 3.5 66 6.0 67 4.0 68 1.5 69 2.5 70 1.5 71 1.0 72 1.0 73 2.0 74 1.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5250000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.7374999999999999 108-109 2.0500000000000003 110-111 1.8124999999999998 112-113 2.2624999999999997 114-115 1.4874999999999998 116-117 0.4 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79914637208135 99.375 2 0.1506402209389907 0.3 3 0.0 0.0 4 0.0 0.0 5 0.025106703489831784 0.125 6 0.0 0.0 7 0.0 0.0 8 0.025106703489831784 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTA 8 0.2 TruSeq Adapter, Index 13 (97% over 40bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTAT 5 0.125 TruSeq Adapter, Index 13 (97% over 40bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.2 0.0 0.0 0.0 0.0 2 0.2 0.0 0.0 0.0 0.0 3 0.2 0.0 0.0 0.0 0.0 4 0.2 0.0 0.0 0.0 0.0 5 0.2 0.0 0.0 0.0 0.0 6 0.2 0.0 0.0 0.0 0.0 7 0.2 0.0 0.0 0.0 0.0 8 0.2 0.0 0.0 0.0 0.0 9 0.2 0.0 0.0 0.0 0.0 10-11 0.2 0.0 0.0 0.0 0.0 12-13 0.2 0.0 0.0 0.0 0.0 14-15 0.2 0.0 0.0 0.0 0.0 16-17 0.225 0.0 0.0 0.0 0.0 18-19 0.225 0.0 0.0 0.0 0.0 20-21 0.225 0.0 0.0 0.0 0.0 22-23 0.225 0.0 0.0 0.0 0.0 24-25 0.25 0.0 0.0 0.0 0.0 26-27 0.30000000000000004 0.0 0.0 0.0 0.0 28-29 0.325 0.0 0.0 0.0 0.0 30-31 0.375 0.0 0.0 0.0 0.0 32-33 0.3875 0.0 0.0 0.0 0.0 34-35 0.425 0.0 0.0 0.0 0.0 36-37 0.4625 0.0 0.0 0.0 0.0 38-39 0.5375000000000001 0.0 0.0 0.0 0.0 40-41 0.6 0.0 0.0 0.0 0.0 42-43 0.6125 0.0 0.0 0.0 0.0 44-45 0.625 0.0 0.0 0.0 0.0 46-47 0.625 0.0 0.0 0.0 0.0 48-49 0.625 0.0 0.0 0.0 0.0 50-51 0.625 0.0 0.0 0.0 0.0 52-53 0.675 0.0 0.0 0.0 0.0 54-55 0.7 0.0 0.0 0.0 0.0 56-57 0.7 0.0 0.0 0.0 0.0 58-59 0.7124999999999999 0.0 0.0 0.0 0.0 60-61 0.7375 0.0 0.0 0.0 0.0 62-63 0.775 0.0 0.0 0.0 0.0 64-65 0.8 0.0 0.0 0.0 0.0 66-67 0.825 0.0 0.0 0.0 0.0 68-69 0.8625 0.0 0.0 0.0 0.0 70-71 0.9 0.0 0.0 0.0 0.0 72-73 0.9375 0.0 0.0 0.0 0.0 74-75 1.0 0.0 0.0 0.0 0.0 76-77 1.025 0.0 0.0 0.0 0.0 78-79 1.0375 0.0 0.0 0.0 0.0 80-81 1.1125 0.0 0.0 0.0 0.0 82-83 1.1625 0.0 0.0 0.0 0.0 84-85 1.2625000000000002 0.0 0.0 0.0 0.0 86-87 1.4125 0.0 0.0 0.0 0.0 88-89 1.5 0.0 0.0 0.0 0.0 90-91 1.6 0.0 0.0 0.0 0.0 92-93 1.75 0.0 0.0 0.0 0.0 94-95 2.0375 0.0 0.0 0.0 0.0 96-97 2.2875 0.0 0.0 0.0 0.0 98-99 2.6 0.0 0.0 0.0 0.0 100-101 2.9875 0.0 0.0 0.0 0.0 102-103 3.475 0.0 0.0 0.0 0.0 104-105 4.2625 0.0 0.0 0.0 0.0 106-107 5.050000000000001 0.0 0.0 0.0 0.0 108-109 5.737500000000001 0.0 0.0 0.0 0.0 110-111 6.4875 0.0 0.0 0.0 0.0 112-113 7.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 888031 spots for SRR3208003.sra Written 888031 spots for SRR3208003.sra Read 888031 spots for SRR3208003.sra Written 888031 spots for SRR3208003.sra Read 888031 spots for SRR3208003.sra Written 888031 spots for SRR3208003.sra Read 888031 spots for SRR3208003.sra Written 888031 spots for SRR3208003.sra Read 888031 spots for SRR3208003.sra Written 888031 spots for SRR3208003.sra Read 888031 spots for SRR3208003.sra Written 888031 spots for SRR3208003.sra Read 888031 spots for SRR3208003.sra Written 888031 spots for SRR3208003.sra Read 888031 spots for SRR3208003.sra Written 888031 spots for SRR3208003.sra Read 888046 spots for SRR3208003.sra Written 888046 spots for SRR3208003.sra Read 888031 spots for SRR3208003.sra Written 888031 spots for SRR3208003.sra Read 888031 spots for SRR3208003.sra Written 888031 spots for SRR3208003.sra Read 888031 spots for SRR3208003.sra Written 888031 spots for SRR3208003.sra Read 888031 spots for SRR3208003.sra Written 888031 spots for SRR3208003.sra Read 888031 spots for SRR3208003.sra Written 888031 spots for SRR3208003.sra Read 888031 spots for SRR3208003.sra Written 888031 spots for SRR3208003.sra Read 888031 spots for SRR3208003.sra Written 888031 spots for SRR3208003.sra Read 888031 spots for SRR3208003.sra Written 888031 spots for SRR3208003.sra Read 888031 spots for SRR3208003.sra Written 888031 spots for SRR3208003.sra Read 888031 spots for SRR3208003.sra Written 888031 spots for SRR3208003.sra Read 888031 spots for SRR3208003.sra Written 888031 spots for SRR3208003.sra SRR ids: ['SRR3208003.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qulbsjzs SRR3208003.sra spots: 17760635 blocks: [[1, 888031], [888032, 1776062], [1776063, 2664093], [2664094, 3552124], [3552125, 4440155], [4440156, 5328186], [5328187, 6216217], [6216218, 7104248], [7104249, 7992279], [7992280, 8880310], [8880311, 9768341], [9768342, 10656372], [10656373, 11544403], [11544404, 12432434], [12432435, 13320465], [13320466, 14208496], [14208497, 15096527], [15096528, 15984558], [15984559, 16872589], [16872590, 17760635]] SRR3208003 file size 5686860 SRR3208003 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208003 SRR3208003_1.fastq Input file: SRR3208003_1.fastq trimmed: SRR3208003-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 00:08:27 2025 >> started Wed Feb 12 00:08:42 2025 >> done (14.784s) 17760635 reads processed; of these: 8041 ( 0.05%) short reads filtered out after trimming by size control 59040 ( 0.33%) empty reads filtered out after trimming by size control 17693554 (99.62%) reads available; of these: 1691628 ( 9.56%) trimmed reads available after processing 16001926 (90.44%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 683 0.00% 19 711 0.00% 20 838 0.00% 21 785 0.00% 22 885 0.01% 23 989 0.01% 24 3086 0.02% 25 3380 0.02% 26 1452 0.01% 27 1224 0.01% 28 1375 0.01% 29 1479 0.01% 30 1759 0.01% 31 1716 0.01% 32 1761 0.01% 33 1540 0.01% 34 1673 0.01% 35 1680 0.01% 36 1706 0.01% 37 1800 0.01% 38 1902 0.01% 39 1880 0.01% 40 1967 0.01% 41 1992 0.01% 42 2038 0.01% 43 2195 0.01% 44 2187 0.01% 45 2348 0.01% 46 2463 0.01% 47 2655 0.02% 48 2825 0.02% 49 3058 0.02% 50 3103 0.02% 51 3260 0.02% 52 3140 0.02% 53 3209 0.02% 54 3380 0.02% 55 3559 0.02% 56 3598 0.02% 57 3922 0.02% 58 4208 0.02% 59 4435 0.03% 60 4574 0.03% 61 4701 0.03% 62 4671 0.03% 63 4854 0.03% 64 5172 0.03% 65 5480 0.03% 66 5499 0.03% 67 5714 0.03% 68 6201 0.04% 69 6932 0.04% 70 7106 0.04% 71 7079 0.04% 72 7100 0.04% 73 7307 0.04% 74 7510 0.04% 75 8031 0.05% 76 8641 0.05% 77 8754 0.05% 78 9567 0.05% 79 10585 0.06% 80 11571 0.07% 81 11494 0.06% 82 11762 0.07% 83 12127 0.07% 84 12691 0.07% 85 13386 0.08% 86 13937 0.08% 87 14756 0.08% 88 15954 0.09% 89 18167 0.10% 90 20665 0.12% 91 22483 0.13% 92 24027 0.14% 93 25322 0.14% 94 2417 0.01% 95 2539 0.01% 96 2617 0.01% 97 2741 0.02% 98 2937 0.02% 99 3048 0.02% 100 3503 0.02% 101 3619 0.02% 102 3961 0.02% 103 4319 0.02% 104 4536 0.03% 105 5582 0.03% 106 5257 0.03% 107 5512 0.03% 108 5967 0.03% 109 6779 0.04% 110 7723 0.04% 111 8499 0.05% 112 9446 0.05% 113 10791 0.06% 114 12523 0.07% 115 15171 0.09% 116 17666 0.10% 117 22206 0.13% 118 28079 0.16% 119 35437 0.20% 120 46775 0.26% 121 66948 0.38% 122 102272 0.58% 123 192932 1.09% 124 592160 3.35% 125 16001926 90.44% 17693554 reads passed initial QC criterion=sequence-density sequence-density=5.72 sequence-density-rank=1 fanout-score=52.91 fanout-score-rank=1 prefix-density=7.56 prefix-fanout=40.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=5.72 sequence-density-rank=1 fanout-score=52.91 fanout-score-rank=1 prefix-density=7.56 prefix-fanout=40.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR3208003 - Input file: STDIN trimmed: SRR3208003-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 00:09:40 2025 >> started Wed Feb 12 00:10:10 2025 >> done (30.106s) 11795703 reads processed; of these: 225 ( 0.00%) short reads filtered out after trimming by size control 1684 ( 0.01%) empty reads filtered out after trimming by size control 11793794 (99.98%) reads available; of these: 1909471 (16.19%) trimmed reads available after processing 9884323 (83.81%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 457 0.00% 19 474 0.00% 20 605 0.01% 21 562 0.00% 22 602 0.01% 23 671 0.01% 24 1953 0.02% 25 2128 0.02% 26 1008 0.01% 27 835 0.01% 28 959 0.01% 29 994 0.01% 30 1165 0.01% 31 1149 0.01% 32 1186 0.01% 33 1020 0.01% 34 1125 0.01% 35 1152 0.01% 36 1096 0.01% 37 1218 0.01% 38 1267 0.01% 39 1296 0.01% 40 1336 0.01% 41 1365 0.01% 42 1387 0.01% 43 1500 0.01% 44 1460 0.01% 45 1607 0.01% 46 1692 0.01% 47 1791 0.02% 48 1862 0.02% 49 2069 0.02% 50 2117 0.02% 51 2143 0.02% 52 2095 0.02% 53 2170 0.02% 54 2287 0.02% 55 2386 0.02% 56 2400 0.02% 57 2607 0.02% 58 2840 0.02% 59 2983 0.03% 60 3105 0.03% 61 3166 0.03% 62 3124 0.03% 63 3222 0.03% 64 3454 0.03% 65 3492 0.03% 66 3702 0.03% 67 3828 0.03% 68 4181 0.04% 69 4571 0.04% 70 4651 0.04% 71 4704 0.04% 72 4695 0.04% 73 4839 0.04% 74 4882 0.04% 75 5083 0.04% 76 5539 0.05% 77 5768 0.05% 78 6339 0.05% 79 7083 0.06% 80 7799 0.07% 81 7746 0.07% 82 7856 0.07% 83 8065 0.07% 84 8348 0.07% 85 9010 0.08% 86 9385 0.08% 87 9910 0.08% 88 10763 0.09% 89 12175 0.10% 90 13765 0.12% 91 14749 0.13% 92 15836 0.13% 93 17101 0.14% 94 18353 0.16% 95 19704 0.17% 96 20499 0.17% 97 22392 0.19% 98 24749 0.21% 99 27173 0.23% 100 30564 0.26% 101 33937 0.29% 102 37521 0.32% 103 41081 0.35% 104 44046 0.37% 105 46737 0.40% 106 48790 0.41% 107 51190 0.43% 108 54123 0.46% 109 58363 0.49% 110 64310 0.55% 111 69884 0.59% 112 75984 0.64% 113 81755 0.69% 114 87364 0.74% 115 91640 0.78% 116 95392 0.81% 117 98817 0.84% 118 103931 0.88% 119 112908 0.96% 120 133712 1.13% 121 187952 1.59% 122 381112 3.23% 123 106622 0.90% 124 327434 2.78% 125 8890800 75.39% criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=91.30 fanout-score-rank=7 prefix-density=0.28 prefix-fanout=18.4 sequence=TTCTTTCTTTCT criterion=fanout-score sequence-density=0.04 sequence-density-rank=15 fanout-score=318.00 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=30.7 sequence=TTCTTCTTCTTT Started job on | Feb 12 00:10:42 Started mapping on | Feb 12 00:10:42 Finished on | Feb 12 00:11:47 Mapping speed, Million of reads per hour | 979.84 Number of input reads | 17691645 Average input read length | 122 UNIQUE READS: Uniquely mapped reads number | 15217575 Uniquely mapped reads % | 86.02% Average mapped length | 121.84 Number of splices: Total | 5562269 Number of splices: Annotated (sjdb) | 5455609 Number of splices: GT/AG | 5476287 Number of splices: GC/AG | 69545 Number of splices: AT/AC | 5913 Number of splices: Non-canonical | 10524 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.02% Deletion average length | 2.18 Insertion rate per base | 0.02% Insertion average length | 1.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 332260 % of reads mapped to multiple loci | 1.88% Number of reads mapped to too many loci | 444918 % of reads mapped to too many loci | 2.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.57% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2141810 2141810 2141810 N_multimapping 332260 332260 332260 N_noFeature 628927 7870439 7864611 N_ambiguous 164646 26367 27093 UnstrandedReadsAssigned:14424002 PositiveStrandReadsAssigned:7320769 NegativeStrandReadsAssigned:7325871 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=122 echo kmer=117 SRR3208003 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208003-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,691,645 reads, 15,080,318 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,223 rounds 52401 SRR3208003.ke.tsv 34699 SRR3208003.se.tsv 87100 total ==> SRR3208003.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 489 23.359 Potri.005G024800.1.v4.1 1035 936 62 6.07206 Potri.004G059700.1.v4.1 961 862 42 4.46645 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 224.294 7.2295 Potri.016G087400.1.v4.1 270 171 741 397.23 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 64 3.50465 Potri.012G127500.1.v4.1 977 878 3465 361.767 ==> SRR3208003.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1605 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 349 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3208003 completed mapping pipeline successfully