Starting /dee2/code/volunteer_pipeline.sh SRR3208004 current disk space = 3051778605056 free memory = 1255848808 SRR3208004 SRAfilesize d812e00f5fef98d387ea140492152d5f SRR3208004.sra SRR3208004.sra file validated SRR3208004 is single end SRR3208004 is conventional basespace SRR3208004 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208004_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.338 33.0 32.0 34.0 27.0 34.0 2 32.03825 33.0 32.0 34.0 28.0 34.0 3 31.98625 33.0 32.0 34.0 28.0 34.0 4 31.6045 33.0 32.0 34.0 27.0 34.0 5 31.99825 33.0 32.0 34.0 30.0 34.0 6 35.4995 38.0 36.0 38.0 29.0 38.0 7 35.9555 38.0 37.0 38.0 31.0 38.0 8 36.13575 38.0 37.0 38.0 33.0 38.0 9 36.26675 38.0 37.0 38.0 33.0 38.0 10-11 36.326750000000004 38.0 37.0 38.0 33.5 38.0 12-13 36.240625 38.0 37.0 38.0 33.0 38.0 14-15 36.31075 38.0 37.0 38.0 33.0 38.0 16-17 36.307249999999996 38.0 37.0 38.0 33.0 38.0 18-19 36.23975 38.0 37.0 38.0 33.0 38.0 20-21 36.24875 38.0 37.0 38.0 33.0 38.0 22-23 36.3415 38.0 37.0 38.0 33.0 38.0 24-25 36.302375 38.0 37.0 38.0 33.5 38.0 26-27 36.140125 38.0 37.0 38.0 33.0 38.0 28-29 36.148625 38.0 37.0 38.0 33.0 38.0 30-31 36.239875 38.0 37.0 38.0 33.0 38.0 32-33 36.1935 38.0 37.0 38.0 33.0 38.0 34-35 36.182125 38.0 37.0 38.0 33.0 38.0 36-37 36.081999999999994 38.0 37.0 38.0 32.0 38.0 38-39 36.191874999999996 38.0 37.0 38.0 32.5 38.0 40-41 36.211749999999995 38.0 37.0 38.0 33.0 38.0 42-43 36.20225 38.0 37.0 38.0 33.0 38.0 44-45 36.125125 38.0 37.0 38.0 33.0 38.0 46-47 36.159875 38.0 37.0 38.0 33.0 38.0 48-49 36.14975 38.0 37.0 38.0 32.0 38.0 50-51 36.196875000000006 38.0 37.0 38.0 33.0 38.0 52-53 36.158500000000004 38.0 37.0 38.0 32.0 38.0 54-55 36.197 38.0 37.0 38.0 33.0 38.0 56-57 36.132125 38.0 37.0 38.0 33.0 38.0 58-59 36.160124999999994 38.0 37.0 38.0 33.0 38.0 60-61 36.120999999999995 38.0 37.0 38.0 32.0 38.0 62-63 35.963375 38.0 37.0 38.0 31.0 38.0 64-65 35.902249999999995 38.0 37.0 38.0 31.0 38.0 66-67 36.078375 38.0 37.0 38.0 32.0 38.0 68-69 36.259125 38.0 37.0 38.0 33.0 38.0 70-71 36.169875000000005 38.0 37.0 38.0 33.0 38.0 72-73 36.054375 38.0 37.0 38.0 32.5 38.0 74-75 36.131625 38.0 37.0 38.0 33.0 38.0 76-77 35.9195 38.0 37.0 38.0 31.0 38.0 78-79 36.0575 38.0 37.0 38.0 31.5 38.0 80-81 36.16137500000001 38.0 37.0 38.0 33.0 38.0 82-83 35.982375000000005 38.0 37.0 38.0 32.0 38.0 84-85 36.013125 38.0 37.0 38.0 32.0 38.0 86-87 36.09 38.0 37.0 38.0 33.0 38.0 88-89 36.008375 38.0 37.0 38.0 32.0 38.0 90-91 35.960499999999996 38.0 37.0 38.0 31.5 38.0 92-93 35.921125 38.0 37.0 38.0 31.5 38.0 94-95 35.871 38.0 37.0 38.0 31.0 38.0 96-97 35.999375 38.0 37.0 38.0 33.0 38.0 98-99 35.922375 38.0 37.0 38.0 32.0 38.0 100-101 35.755875 38.0 37.0 38.0 31.0 38.0 102-103 35.835375 38.0 37.0 38.0 31.0 38.0 104-105 35.798874999999995 38.0 37.0 38.0 31.0 38.0 106-107 35.55 38.0 37.0 38.0 30.0 38.0 108-109 35.21787500000001 38.0 36.5 38.0 29.0 38.0 110-111 35.133624999999995 38.0 36.0 38.0 28.5 38.0 112-113 35.053625 38.0 36.5 38.0 28.5 38.0 114-115 35.155 38.0 36.0 38.0 28.5 38.0 116-117 35.132999999999996 38.0 36.0 38.0 27.5 38.0 118-119 35.1425 38.0 36.0 38.0 28.5 38.0 120-121 35.02925 38.0 36.0 38.0 28.0 38.0 122-123 35.026125 38.0 36.0 38.0 28.0 38.0 124-125 33.3135 37.5 33.5 38.0 22.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 0.0 16 1.0 17 2.0 18 1.0 19 0.0 20 1.0 21 2.0 22 7.0 23 6.0 24 12.0 25 19.0 26 29.0 27 32.0 28 65.0 29 62.0 30 87.0 31 132.0 32 133.0 33 182.0 34 244.0 35 316.0 36 598.0 37 2067.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.412960609911057 15.65438373570521 10.62261753494282 48.31003811944091 2 17.804451112778192 21.905476369092273 41.38534633658414 18.904726181545385 3 19.475 24.5 29.049999999999997 26.974999999999998 4 24.325 31.924999999999997 20.3 23.45 5 23.925 34.150000000000006 23.75 18.175 6 19.15 37.15 24.425 19.275000000000002 7 17.175 19.875 41.775 21.175 8 18.05 23.65 31.1 27.200000000000003 9 20.349999999999998 22.875 31.85 24.925 10-11 21.65 34.025 22.925 21.4 12-13 20.4375 26.575 30.587500000000002 22.400000000000002 14-15 20.8875 27.175 29.4125 22.525000000000002 16-17 21.4 28.525 28.4125 21.6625 18-19 21.2625 28.349999999999998 27.3875 23.0 20-21 21.8625 28.1625 28.349999999999998 21.625 22-23 21.775 28.050000000000004 27.762500000000003 22.412499999999998 24-25 21.65 28.787499999999998 28.037499999999998 21.525 26-27 21.099999999999998 28.6375 28.6375 21.625 28-29 21.55 27.6 28.7375 22.112499999999997 30-31 21.3875 27.775 28.3625 22.475 32-33 20.837500000000002 27.950000000000003 29.475 21.7375 34-35 22.1375 27.950000000000003 27.900000000000002 22.0125 36-37 21.625 27.800000000000004 28.7 21.875 38-39 22.0625 27.3625 28.1 22.475 40-41 22.375 28.487499999999997 27.5625 21.575 42-43 21.212500000000002 27.925 28.499999999999996 22.3625 44-45 21.4125 28.425 28.6875 21.475 46-47 21.462500000000002 28.012500000000003 28.962500000000002 21.5625 48-49 21.975 27.9375 27.925 22.162499999999998 50-51 21.725 27.762500000000003 28.9125 21.6 52-53 22.787499999999998 28.299999999999997 27.237499999999997 21.675 54-55 21.4 28.525 28.3375 21.7375 56-57 21.725 28.275 27.8375 22.162499999999998 58-59 22.2125 28.537499999999998 28.1 21.15 60-61 21.7375 28.0625 28.125 22.075 62-63 21.7875 28.012500000000003 28.237499999999997 21.9625 64-65 23.150000000000002 28.212500000000002 27.0875 21.55 66-67 22.162499999999998 28.125 28.15 21.5625 68-69 21.825 28.7375 28.549999999999997 20.8875 70-71 21.5 28.525 27.8125 22.162499999999998 72-73 21.8 28.575 27.8625 21.762500000000003 74-75 21.3875 28.025 28.6875 21.9 76-77 22.0125 28.712500000000002 27.5625 21.712500000000002 78-79 21.825 28.512500000000003 28.5625 21.099999999999998 80-81 22.237499999999997 28.499999999999996 28.549999999999997 20.7125 82-83 21.712500000000002 28.787499999999998 27.6875 21.8125 84-85 22.625 27.6875 27.35 22.3375 86-87 20.962500000000002 27.775 29.099999999999998 22.162499999999998 88-89 22.125 28.8375 27.800000000000004 21.2375 90-91 22.225 29.6875 27.0 21.087500000000002 92-93 21.212500000000002 28.549999999999997 28.037499999999998 22.2 94-95 21.7375 27.962500000000002 28.625 21.675 96-97 21.75 28.449999999999996 28.025 21.775 98-99 22.35 28.287499999999998 27.85 21.512500000000003 100-101 22.2625 28.3875 28.3125 21.0375 102-103 22.912499999999998 28.5875 26.937499999999996 21.5625 104-105 21.85 28.3125 28.15 21.6875 106-107 22.900188323917135 29.27809165097301 26.55367231638418 21.268047708725675 108-109 21.902710919685838 28.51532809728908 28.13529262731188 21.4466683557132 110-111 22.560667340748232 28.728513650151665 27.30030333670374 21.41051567239636 112-113 22.432158255135683 29.33045904133908 27.37763124524474 20.8597514582805 114-115 22.12411705348133 29.07416750756811 27.850655903128153 20.951059535822402 116-117 22.102493421876957 28.630497431399576 27.089337175792505 22.177671970930962 118-119 23.05 28.9375 26.737499999999997 21.275 120-121 23.2125 28.7 26.974999999999998 21.1125 122-123 22.650000000000002 29.7125 26.5875 21.05 124-125 22.6875 29.15 26.8 21.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.5 20 1.0 21 0.5 22 1.5 23 2.0 24 2.0 25 2.5 26 4.5 27 8.0 28 12.5 29 16.5 30 21.0 31 29.0 32 31.5 33 42.0 34 65.5 35 76.5 36 92.0 37 122.5 38 146.5 39 159.0 40 180.5 41 226.0 42 264.5 43 277.0 44 280.0 45 273.5 46 268.5 47 258.0 48 229.5 49 194.5 50 153.5 51 121.5 52 95.0 53 81.0 54 61.5 55 43.0 56 34.5 57 23.0 58 18.5 59 14.0 60 11.0 61 7.0 62 5.5 63 5.5 64 6.0 65 4.5 66 2.0 67 3.5 68 4.5 69 4.5 70 3.5 71 1.5 72 1.0 73 0.5 74 0.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.625 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.43750000000000006 108-109 1.325 110-111 1.0999999999999999 112-113 1.425 114-115 0.8999999999999999 116-117 0.2375 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.0625 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 1.0750000000000002 0.0 0.0 0.0 0.0 102-103 1.375 0.0 0.0 0.0 0.0 104-105 1.6875 0.0 0.0 0.0 0.0 106-107 2.2249999999999996 0.0 0.0 0.0 0.0 108-109 2.7 0.0 0.0 0.0 0.0 110-111 3.3625 0.0 0.0 0.0 0.0 112-113 4.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 793409 spots for SRR3208004.sra Written 793409 spots for SRR3208004.sra Read 793409 spots for SRR3208004.sra Written 793409 spots for SRR3208004.sra Read 793409 spots for SRR3208004.sra Written 793409 spots for SRR3208004.sra Read 793409 spots for SRR3208004.sra Written 793409 spots for SRR3208004.sra Read 793409 spots for SRR3208004.sra Written 793409 spots for SRR3208004.sra Read 793409 spots for SRR3208004.sra Written 793409 spots for SRR3208004.sra Read 793409 spots for SRR3208004.sra Written 793409 spots for SRR3208004.sra Read 793409 spots for SRR3208004.sra Written 793409 spots for SRR3208004.sra Read 793409 spots for SRR3208004.sra Written 793409 spots for SRR3208004.sra Read 793409 spots for SRR3208004.sra Written 793409 spots for SRR3208004.sra Read 793425 spots for SRR3208004.sra Written 793425 spots for SRR3208004.sra Read 793409 spots for SRR3208004.sra Written 793409 spots for SRR3208004.sra Read 793409 spots for SRR3208004.sra Written 793409 spots for SRR3208004.sra Read 793409 spots for SRR3208004.sra Written 793409 spots for SRR3208004.sra Read 793409 spots for SRR3208004.sra Written 793409 spots for SRR3208004.sra Read 793409 spots for SRR3208004.sra Written 793409 spots for SRR3208004.sra Read 793409 spots for SRR3208004.sra Written 793409 spots for SRR3208004.sra Read 793409 spots for SRR3208004.sra Written 793409 spots for SRR3208004.sra Read 793409 spots for SRR3208004.sra Written 793409 spots for SRR3208004.sra Read 793409 spots for SRR3208004.sra Written 793409 spots for SRR3208004.sra SRR ids: ['SRR3208004.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_esejbsib SRR3208004.sra spots: 15868196 blocks: [[1, 793409], [793410, 1586818], [1586819, 2380227], [2380228, 3173636], [3173637, 3967045], [3967046, 4760454], [4760455, 5553863], [5553864, 6347272], [6347273, 7140681], [7140682, 7934090], [7934091, 8727499], [8727500, 9520908], [9520909, 10314317], [10314318, 11107726], [11107727, 11901135], [11901136, 12694544], [12694545, 13487953], [13487954, 14281362], [14281363, 15074771], [15074772, 15868196]] SRR3208004 file size 5079758 SRR3208004 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208004 SRR3208004_1.fastq Input file: SRR3208004_1.fastq trimmed: SRR3208004-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 00:02:39 2025 >> started Wed Feb 12 00:02:48 2025 >> done (8.938s) 15868196 reads processed; of these: 6006 ( 0.04%) short reads filtered out after trimming by size control 34329 ( 0.22%) empty reads filtered out after trimming by size control 15827861 (99.75%) reads available; of these: 1300405 ( 8.22%) trimmed reads available after processing 14527456 (91.78%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 284 0.00% 19 301 0.00% 20 372 0.00% 21 312 0.00% 22 300 0.00% 23 452 0.00% 24 2177 0.01% 25 2394 0.02% 26 555 0.00% 27 348 0.00% 28 388 0.00% 29 504 0.00% 30 685 0.00% 31 583 0.00% 32 566 0.00% 33 308 0.00% 34 319 0.00% 35 301 0.00% 36 369 0.00% 37 347 0.00% 38 339 0.00% 39 369 0.00% 40 374 0.00% 41 403 0.00% 42 388 0.00% 43 421 0.00% 44 409 0.00% 45 443 0.00% 46 430 0.00% 47 465 0.00% 48 495 0.00% 49 490 0.00% 50 520 0.00% 51 494 0.00% 52 524 0.00% 53 550 0.00% 54 596 0.00% 55 611 0.00% 56 657 0.00% 57 699 0.00% 58 716 0.00% 59 767 0.00% 60 848 0.01% 61 844 0.01% 62 891 0.01% 63 919 0.01% 64 940 0.01% 65 1109 0.01% 66 1056 0.01% 67 1065 0.01% 68 1175 0.01% 69 1301 0.01% 70 1451 0.01% 71 1526 0.01% 72 1658 0.01% 73 1908 0.01% 74 1959 0.01% 75 2179 0.01% 76 2315 0.01% 77 2326 0.01% 78 2442 0.02% 79 2794 0.02% 80 3054 0.02% 81 3448 0.02% 82 3822 0.02% 83 4245 0.03% 84 4568 0.03% 85 5070 0.03% 86 5342 0.03% 87 5943 0.04% 88 6470 0.04% 89 7518 0.05% 90 8474 0.05% 91 9887 0.06% 92 11325 0.07% 93 12380 0.08% 94 2101 0.01% 95 2117 0.01% 96 2129 0.01% 97 2352 0.01% 98 2495 0.02% 99 2679 0.02% 100 3004 0.02% 101 3177 0.02% 102 3370 0.02% 103 3767 0.02% 104 4075 0.03% 105 5110 0.03% 106 4738 0.03% 107 5218 0.03% 108 5548 0.04% 109 6208 0.04% 110 6931 0.04% 111 7890 0.05% 112 8870 0.06% 113 10147 0.06% 114 11693 0.07% 115 14152 0.09% 116 16816 0.11% 117 20816 0.13% 118 26370 0.17% 119 33071 0.21% 120 44081 0.28% 121 62434 0.39% 122 96510 0.61% 123 181153 1.14% 124 556106 3.51% 125 14527456 91.78% 15827861 reads passed initial QC criterion=sequence-density sequence-density=3.91 sequence-density-rank=1 fanout-score=47.82 fanout-score-rank=1 prefix-density=5.34 prefix-fanout=35.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA criterion=fanout-score sequence-density=3.91 sequence-density-rank=1 fanout-score=47.82 fanout-score-rank=1 prefix-density=5.34 prefix-fanout=35.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA -o SRR3208004 - Input file: STDIN trimmed: SRR3208004-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 00:03:30 2025 >> started Wed Feb 12 00:03:40 2025 >> done (9.593s) 7913931 reads processed; of these: 120 ( 0.00%) short reads filtered out after trimming by size control 720 ( 0.01%) empty reads filtered out after trimming by size control 7913091 (99.99%) reads available; of these: 1020204 (12.89%) trimmed reads available after processing 6892887 (87.11%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 156 0.00% 19 159 0.00% 20 202 0.00% 21 174 0.00% 22 168 0.00% 23 234 0.00% 24 1022 0.01% 25 1013 0.01% 26 300 0.00% 27 157 0.00% 28 192 0.00% 29 260 0.00% 30 347 0.00% 31 284 0.00% 32 290 0.00% 33 162 0.00% 34 156 0.00% 35 158 0.00% 36 175 0.00% 37 161 0.00% 38 169 0.00% 39 190 0.00% 40 194 0.00% 41 200 0.00% 42 208 0.00% 43 215 0.00% 44 211 0.00% 45 223 0.00% 46 210 0.00% 47 240 0.00% 48 257 0.00% 49 263 0.00% 50 271 0.00% 51 229 0.00% 52 267 0.00% 53 279 0.00% 54 303 0.00% 55 289 0.00% 56 328 0.00% 57 347 0.00% 58 359 0.00% 59 384 0.00% 60 420 0.01% 61 447 0.01% 62 449 0.01% 63 465 0.01% 64 441 0.01% 65 458 0.01% 66 514 0.01% 67 547 0.01% 68 560 0.01% 69 670 0.01% 70 752 0.01% 71 753 0.01% 72 858 0.01% 73 928 0.01% 74 971 0.01% 75 1034 0.01% 76 1016 0.01% 77 1082 0.01% 78 1233 0.02% 79 1415 0.02% 80 1593 0.02% 81 1767 0.02% 82 1951 0.02% 83 2056 0.03% 84 2222 0.03% 85 2571 0.03% 86 2711 0.03% 87 2956 0.04% 88 3250 0.04% 89 3809 0.05% 90 4278 0.05% 91 4953 0.06% 92 5637 0.07% 93 6247 0.08% 94 7054 0.09% 95 7817 0.10% 96 8266 0.10% 97 9314 0.12% 98 10350 0.13% 99 11471 0.14% 100 13178 0.17% 101 15046 0.19% 102 17117 0.22% 103 19311 0.24% 104 21089 0.27% 105 22954 0.29% 106 23736 0.30% 107 25392 0.32% 108 26960 0.34% 109 29625 0.37% 110 32667 0.41% 111 35982 0.45% 112 40014 0.51% 113 43789 0.55% 114 47112 0.60% 115 50720 0.64% 116 53108 0.67% 117 55312 0.70% 118 58777 0.74% 119 64920 0.82% 120 80211 1.01% 121 119407 1.51% 122 256334 3.24% 123 77941 0.98% 124 239472 3.03% 125 6316225 79.82% criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=4.37 fanout-score-rank=20 prefix-density=0.14 prefix-fanout=3.1 sequence=TTCAACCAAGCGCG criterion=fanout-score sequence-density=0.05 sequence-density-rank=13 fanout-score=319.61 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=30.4 sequence=TTCTTCTTCTTT Started job on | Feb 12 00:04:06 Started mapping on | Feb 12 00:04:07 Finished on | Feb 12 00:04:32 Mapping speed, Million of reads per hour | 2279.09 Number of input reads | 15827021 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 14524542 Uniquely mapped reads % | 91.77% Average mapped length | 122.78 Number of splices: Total | 5553861 Number of splices: Annotated (sjdb) | 5450103 Number of splices: GT/AG | 5468816 Number of splices: GC/AG | 69503 Number of splices: AT/AC | 5571 Number of splices: Non-canonical | 9971 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.02% Deletion average length | 2.16 Insertion rate per base | 0.02% Insertion average length | 1.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 311562 % of reads mapped to multiple loci | 1.97% Number of reads mapped to too many loci | 708228 % of reads mapped to too many loci | 4.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.75% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 990917 990917 990917 N_multimapping 311562 311562 311562 N_noFeature 627095 7514714 7541912 N_ambiguous 146287 25727 25808 UnstrandedReadsAssigned:13751160 PositiveStrandReadsAssigned:6984101 NegativeStrandReadsAssigned:6956822 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208004 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208004-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,827,021 reads, 14,613,897 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,324 rounds 52401 SRR3208004.ke.tsv 34699 SRR3208004.se.tsv 87100 total ==> SRR3208004.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 436 22.1033 Potri.005G024800.1.v4.1 1035 936 52 5.40473 Potri.004G059700.1.v4.1 961 862 37 4.17581 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 227.128 7.76941 Potri.016G087400.1.v4.1 270 171 632 359.557 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 47 2.73142 Potri.012G127500.1.v4.1 977 878 2899 321.218 ==> SRR3208004.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1484 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 298 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 24 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3208004 completed mapping pipeline successfully