Starting /dee2/code/volunteer_pipeline.sh SRR3208005 current disk space = 3051203821568 free memory = 1579138484 SRR3208005 SRAfilesize a4b754f0e8568061dcf50a38ff028f02 SRR3208005.sra SRR3208005.sra file validated SRR3208005 is single end SRR3208005 is conventional basespace SRR3208005 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208005_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.62225 33.0 33.0 34.0 30.0 34.0 2 32.369 33.0 33.0 34.0 30.0 34.0 3 32.3145 33.0 33.0 34.0 30.0 34.0 4 32.082 33.0 33.0 34.0 30.0 34.0 5 32.231 33.0 33.0 34.0 31.0 34.0 6 35.826 38.0 37.0 38.0 31.0 38.0 7 36.2665 38.0 37.0 38.0 33.0 38.0 8 36.40625 38.0 37.0 38.0 34.0 38.0 9 36.48275 38.0 38.0 38.0 34.0 38.0 10-11 36.47 38.0 38.0 38.0 34.0 38.0 12-13 36.43275 38.0 38.0 38.0 33.5 38.0 14-15 36.4865 38.0 38.0 38.0 34.0 38.0 16-17 36.546625000000006 38.0 38.0 38.0 34.0 38.0 18-19 36.44425 38.0 38.0 38.0 34.0 38.0 20-21 36.495999999999995 38.0 38.0 38.0 34.0 38.0 22-23 36.509625 38.0 38.0 38.0 34.0 38.0 24-25 36.584625 38.0 38.0 38.0 34.0 38.0 26-27 36.457 38.0 38.0 38.0 33.5 38.0 28-29 36.423875 38.0 38.0 38.0 34.0 38.0 30-31 36.455749999999995 38.0 38.0 38.0 34.0 38.0 32-33 36.41675 38.0 38.0 38.0 34.0 38.0 34-35 36.427375 38.0 38.0 38.0 33.5 38.0 36-37 36.449 38.0 38.0 38.0 34.0 38.0 38-39 36.439375 38.0 38.0 38.0 34.0 38.0 40-41 36.55875 38.0 38.0 38.0 34.0 38.0 42-43 36.479375000000005 38.0 38.0 38.0 34.0 38.0 44-45 36.427375 38.0 38.0 38.0 34.0 38.0 46-47 36.515249999999995 38.0 38.0 38.0 34.0 38.0 48-49 36.47475 38.0 38.0 38.0 34.0 38.0 50-51 36.42675 38.0 38.0 38.0 34.0 38.0 52-53 36.455 38.0 38.0 38.0 34.0 38.0 54-55 36.459125 38.0 38.0 38.0 34.0 38.0 56-57 36.422375 38.0 38.0 38.0 34.0 38.0 58-59 36.3705 38.0 38.0 38.0 34.0 38.0 60-61 36.3895 38.0 38.0 38.0 34.0 38.0 62-63 36.48625 38.0 38.0 38.0 34.0 38.0 64-65 36.329375 38.0 38.0 38.0 33.5 38.0 66-67 36.35825 38.0 38.0 38.0 34.0 38.0 68-69 36.365625 38.0 38.0 38.0 34.0 38.0 70-71 36.29175 38.0 38.0 38.0 33.5 38.0 72-73 36.244 38.0 38.0 38.0 33.0 38.0 74-75 36.243875 38.0 38.0 38.0 33.5 38.0 76-77 36.01575 38.0 37.5 38.0 33.0 38.0 78-79 36.069500000000005 38.0 38.0 38.0 33.0 38.0 80-81 36.22125 38.0 38.0 38.0 34.0 38.0 82-83 36.044125 38.0 37.5 38.0 33.0 38.0 84-85 36.076750000000004 38.0 38.0 38.0 33.0 38.0 86-87 36.138875 38.0 38.0 38.0 33.5 38.0 88-89 36.077875 38.0 38.0 38.0 33.5 38.0 90-91 35.956375 38.0 38.0 38.0 33.0 38.0 92-93 36.04425 38.0 38.0 38.0 33.0 38.0 94-95 35.985 38.0 38.0 38.0 33.0 38.0 96-97 35.898125 38.0 37.5 38.0 32.5 38.0 98-99 35.940250000000006 38.0 37.5 38.0 33.0 38.0 100-101 35.9 38.0 37.0 38.0 33.0 38.0 102-103 35.8105 38.0 37.0 38.0 32.0 38.0 104-105 35.847125000000005 38.0 37.0 38.0 33.0 38.0 106-107 35.4945 38.0 37.0 38.0 31.0 38.0 108-109 35.12575 38.0 37.0 38.0 30.0 38.0 110-111 35.108374999999995 38.0 37.0 38.0 29.0 38.0 112-113 34.854124999999996 38.0 37.0 38.0 28.0 38.0 114-115 34.95375 38.0 37.0 38.0 28.0 38.0 116-117 35.12375 38.0 37.0 38.0 28.5 38.0 118-119 35.2815 38.0 37.0 38.0 30.0 38.0 120-121 35.19175 38.0 37.0 38.0 30.0 38.0 122-123 35.0435 38.0 37.0 38.0 30.0 38.0 124-125 33.518875 37.5 34.0 38.0 23.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 3.0 15 0.0 16 2.0 17 2.0 18 2.0 19 7.0 20 4.0 21 4.0 22 9.0 23 18.0 24 3.0 25 19.0 26 22.0 27 30.0 28 46.0 29 63.0 30 70.0 31 84.0 32 110.0 33 157.0 34 205.0 35 272.0 36 517.0 37 2344.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.118279569892472 16.231438812083972 12.749615975422426 47.900665642601126 2 17.10855427713857 22.686343171585793 41.02051025512756 19.18459229614807 3 19.775000000000002 25.650000000000002 28.749999999999996 25.825 4 22.725 30.175 22.25 24.85 5 25.124999999999996 33.725 23.45 17.7 6 19.8 38.15 22.125 19.925 7 16.625 20.65 42.875 19.85 8 17.525 24.325 31.525 26.625 9 20.575 22.925 32.625 23.875 10-11 22.650000000000002 33.4375 23.7375 20.175 12-13 20.1625 26.637499999999996 30.275000000000002 22.925 14-15 20.775 28.975 27.900000000000002 22.35 16-17 20.7625 29.2 27.487499999999997 22.55 18-19 21.6875 27.6125 27.787499999999998 22.912499999999998 20-21 21.625 28.299999999999997 27.800000000000004 22.275 22-23 21.0375 29.725 28.012500000000003 21.224999999999998 24-25 21.325 28.537499999999998 27.6 22.537499999999998 26-27 20.8625 27.375 28.7 23.0625 28-29 21.462500000000002 29.45 27.825 21.2625 30-31 20.8125 27.5625 28.8375 22.787499999999998 32-33 20.925 28.4125 28.249999999999996 22.412499999999998 34-35 21.6125 28.4125 27.975 22.0 36-37 21.4375 29.4875 27.775 21.3 38-39 21.6625 28.5625 27.1 22.675 40-41 21.175 28.849999999999998 28.15 21.825 42-43 21.3875 28.287499999999998 28.575 21.75 44-45 20.8125 27.6625 28.599999999999998 22.925 46-47 21.025 27.800000000000004 29.4 21.775 48-49 21.05 28.249999999999996 28.812500000000004 21.8875 50-51 20.9875 28.0875 29.275000000000002 21.65 52-53 20.95 28.675 27.9125 22.4625 54-55 21.337500000000002 28.000000000000004 28.425 22.237499999999997 56-57 20.9875 28.6375 28.799999999999997 21.575 58-59 21.7875 28.525 27.925 21.762500000000003 60-61 21.8125 28.1625 28.15 21.875 62-63 21.05 28.1875 28.050000000000004 22.7125 64-65 21.55 27.962500000000002 28.7 21.7875 66-67 20.65 29.7375 27.650000000000002 21.9625 68-69 22.125 28.3125 27.6 21.9625 70-71 21.712500000000002 28.725 27.900000000000002 21.6625 72-73 20.8125 28.462500000000002 28.050000000000004 22.675 74-75 22.35 28.462500000000002 27.700000000000003 21.4875 76-77 20.837500000000002 28.825 28.599999999999998 21.7375 78-79 21.425 27.8875 28.537499999999998 22.15 80-81 21.5625 28.487499999999997 28.275 21.675 82-83 21.85 28.487499999999997 27.5125 22.15 84-85 21.337500000000002 28.875 28.175 21.6125 86-87 22.025 27.325 29.362500000000004 21.2875 88-89 22.25 27.975 28.175 21.6 90-91 21.875 27.6625 28.15 22.3125 92-93 21.65 27.750000000000004 28.787499999999998 21.8125 94-95 21.4375 27.8375 28.225 22.5 96-97 21.425 27.6375 28.449999999999996 22.4875 98-99 22.05 28.1 28.125 21.725 100-101 21.075 28.65 28.3375 21.9375 102-103 23.1375 27.500000000000004 27.6625 21.7 104-105 22.45 28.4375 27.700000000000003 21.4125 106-107 23.424899193548388 28.62903225806452 27.16733870967742 20.77872983870968 108-109 22.549394518801787 29.623964308476737 27.22753346080306 20.599107711918418 110-111 22.734215885947044 28.487780040733195 27.673116089613035 21.10488798370672 112-113 22.041911576795297 28.494761052900586 27.536417071300797 21.92691029900332 114-115 22.23632440665059 28.721919025257016 27.0465795151669 21.9951770529255 116-117 21.979127373318246 29.133660253992204 28.12775053438954 20.759461838300012 118-119 23.0625 29.2875 26.400000000000002 21.25 120-121 22.8875 29.362500000000004 25.4 22.35 122-123 22.5 28.225 27.325 21.95 124-125 23.0875 28.3625 26.2625 22.287499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 0.5 22 0.5 23 0.5 24 1.5 25 4.5 26 5.5 27 8.5 28 15.5 29 20.5 30 23.5 31 33.0 32 36.0 33 37.5 34 57.5 35 81.5 36 105.5 37 128.5 38 148.0 39 168.5 40 186.5 41 213.0 42 256.0 43 284.0 44 274.5 45 259.0 46 271.5 47 254.0 48 224.5 49 206.5 50 167.0 51 125.0 52 94.5 53 77.0 54 59.5 55 39.5 56 26.5 57 24.5 58 19.0 59 12.5 60 11.0 61 8.5 62 2.5 63 1.5 64 4.5 65 3.0 66 1.0 67 2.5 68 2.0 69 2.5 70 3.0 71 1.0 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.35 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.8 108-109 1.9375 110-111 1.7999999999999998 112-113 2.175 114-115 1.5125 116-117 0.5875 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.89901540015148 98.925 2 0.050492299924261554 0.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.050492299924261554 0.975 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTAT 29 0.7250000000000001 TruSeq Adapter, Index 15 (97% over 40bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTA 10 0.25 TruSeq Adapter, Index 15 (97% over 40bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.275 0.0 0.0 0.0 0.0 2 0.275 0.0 0.0 0.0 0.0 3 0.275 0.0 0.0 0.0 0.0 4 0.275 0.0 0.0 0.0 0.0 5 0.275 0.0 0.0 0.0 0.0 6 0.275 0.0 0.0 0.0 0.0 7 0.275 0.0 0.0 0.0 0.0 8 0.275 0.0 0.0 0.0 0.0 9 0.275 0.0 0.0 0.0 0.0 10-11 0.275 0.0 0.0 0.0 0.0 12-13 0.275 0.0 0.0 0.0 0.0 14-15 0.275 0.0 0.0 0.0 0.0 16-17 0.275 0.0 0.0 0.0 0.0 18-19 0.275 0.0 0.0 0.0 0.0 20-21 0.275 0.0 0.0 0.0 0.0 22-23 0.275 0.0 0.0 0.0 0.0 24-25 0.275 0.0 0.0 0.0 0.0 26-27 0.275 0.0 0.0 0.0 0.0 28-29 0.3 0.0 0.0 0.0 0.0 30-31 0.3 0.0 0.0 0.0 0.0 32-33 0.3 0.0 0.0 0.0 0.0 34-35 0.3 0.0 0.0 0.0 0.0 36-37 0.3 0.0 0.0 0.0 0.0 38-39 0.3 0.0 0.0 0.0 0.0 40-41 0.3 0.0 0.0 0.0 0.0 42-43 0.3 0.0 0.0 0.0 0.0 44-45 0.3 0.0 0.0 0.0 0.0 46-47 0.3 0.0 0.0 0.0 0.0 48-49 0.3 0.0 0.0 0.0 0.0 50-51 0.3 0.0 0.0 0.0 0.0 52-53 0.3 0.0 0.0 0.0 0.0 54-55 0.3 0.0 0.0 0.0 0.0 56-57 0.325 0.0 0.0 0.0 0.0 58-59 0.3375 0.0 0.0 0.0 0.0 60-61 0.35 0.0 0.0 0.0 0.0 62-63 0.35 0.0 0.0 0.0 0.0 64-65 0.375 0.0 0.0 0.0 0.0 66-67 0.4 0.0 0.0 0.0 0.0 68-69 0.4125 0.0 0.0 0.0 0.0 70-71 0.45 0.0 0.0 0.0 0.0 72-73 0.4875 0.0 0.0 0.0 0.0 74-75 0.55 0.0 0.0 0.0 0.0 76-77 0.55 0.0 0.0 0.0 0.0 78-79 0.55 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.55 0.0 0.0 0.0 0.0 84-85 0.6 0.0 0.0 0.0 0.0 86-87 0.6875 0.0 0.0 0.0 0.0 88-89 0.8625 0.0 0.0 0.0 0.0 90-91 0.95 0.0 0.0 0.0 0.0 92-93 1.075 0.0 0.0 0.0 0.0 94-95 1.2 0.0 0.0 0.0 0.0 96-97 1.375 0.0 0.0 0.0 0.0 98-99 1.6125 0.0 0.0 0.0 0.0 100-101 1.9124999999999999 0.0 0.0 0.0 0.0 102-103 2.2750000000000004 0.0 0.0 0.0 0.0 104-105 2.7625 0.0 0.0 0.0 0.0 106-107 3.2625 0.0 0.0 0.0 0.0 108-109 3.95 0.0 0.0 0.0 0.0 110-111 4.4875 0.0 0.0 0.0 0.0 112-113 5.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 946349 spots for SRR3208005.sra Written 946349 spots for SRR3208005.sra Read 946349 spots for SRR3208005.sra Written 946349 spots for SRR3208005.sra Read 946349 spots for SRR3208005.sra Written 946349 spots for SRR3208005.sra Read 946349 spots for SRR3208005.sra Written 946349 spots for SRR3208005.sra Read 946349 spots for SRR3208005.sra Written 946349 spots for SRR3208005.sra Read 946349 spots for SRR3208005.sra Written 946349 spots for SRR3208005.sra Read 946349 spots for SRR3208005.sra Written 946349 spots for SRR3208005.sra Read 946349 spots for SRR3208005.sra Written 946349 spots for SRR3208005.sra Read 946349 spots for SRR3208005.sra Written 946349 spots for SRR3208005.sra Read 946349 spots for SRR3208005.sra Written 946349 spots for SRR3208005.sra Read 946349 spots for SRR3208005.sra Written 946349 spots for SRR3208005.sra Read 946349 spots for SRR3208005.sra Written 946349 spots for SRR3208005.sra Read 946354 spots for SRR3208005.sra Written 946354 spots for SRR3208005.sra Read 946349 spots for SRR3208005.sra Written 946349 spots for SRR3208005.sra Read 946349 spots for SRR3208005.sra Written 946349 spots for SRR3208005.sra Read 946349 spots for SRR3208005.sra Written 946349 spots for SRR3208005.sra Read 946349 spots for SRR3208005.sra Written 946349 spots for SRR3208005.sra Read 946349 spots for SRR3208005.sra Written 946349 spots for SRR3208005.sra Read 946349 spots for SRR3208005.sra Written 946349 spots for SRR3208005.sra Read 946349 spots for SRR3208005.sra Written 946349 spots for SRR3208005.sra SRR ids: ['SRR3208005.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__haqrv_1 SRR3208005.sra spots: 18926985 blocks: [[1, 946349], [946350, 1892698], [1892699, 2839047], [2839048, 3785396], [3785397, 4731745], [4731746, 5678094], [5678095, 6624443], [6624444, 7570792], [7570793, 8517141], [8517142, 9463490], [9463491, 10409839], [10409840, 11356188], [11356189, 12302537], [12302538, 13248886], [13248887, 14195235], [14195236, 15141584], [15141585, 16087933], [16087934, 17034282], [17034283, 17980631], [17980632, 18926985]] SRR3208005 file size 6060994 SRR3208005 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208005 SRR3208005_1.fastq Input file: SRR3208005_1.fastq trimmed: SRR3208005-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 01:05:51 2025 >> started Wed Feb 12 01:06:01 2025 >> done (10.010s) 18926985 reads processed; of these: 19048 ( 0.10%) short reads filtered out after trimming by size control 286889 ( 1.52%) empty reads filtered out after trimming by size control 18621048 (98.38%) reads available; of these: 1484652 ( 7.97%) trimmed reads available after processing 17136396 (92.03%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 750 0.00% 19 665 0.00% 20 850 0.00% 21 644 0.00% 22 747 0.00% 23 753 0.00% 24 2926 0.02% 25 3042 0.02% 26 903 0.00% 27 707 0.00% 28 721 0.00% 29 831 0.00% 30 1191 0.01% 31 977 0.01% 32 1331 0.01% 33 1483 0.01% 34 696 0.00% 35 602 0.00% 36 703 0.00% 37 645 0.00% 38 644 0.00% 39 701 0.00% 40 2107 0.01% 41 736 0.00% 42 800 0.00% 43 742 0.00% 44 712 0.00% 45 739 0.00% 46 760 0.00% 47 790 0.00% 48 770 0.00% 49 839 0.00% 50 944 0.01% 51 891 0.00% 52 987 0.01% 53 973 0.01% 54 979 0.01% 55 1003 0.01% 56 1024 0.01% 57 1125 0.01% 58 1202 0.01% 59 1283 0.01% 60 1404 0.01% 61 1457 0.01% 62 1511 0.01% 63 1640 0.01% 64 2244 0.01% 65 13367 0.07% 66 2971 0.02% 67 1864 0.01% 68 2126 0.01% 69 2166 0.01% 70 2345 0.01% 71 2487 0.01% 72 2727 0.01% 73 3248 0.02% 74 4151 0.02% 75 5354 0.03% 76 6055 0.03% 77 3895 0.02% 78 3627 0.02% 79 4131 0.02% 80 4559 0.02% 81 5079 0.03% 82 5703 0.03% 83 6286 0.03% 84 6813 0.04% 85 7400 0.04% 86 7894 0.04% 87 8731 0.05% 88 9522 0.05% 89 10824 0.06% 90 12431 0.07% 91 14827 0.08% 92 16651 0.09% 93 18024 0.10% 94 2705 0.01% 95 2744 0.01% 96 2811 0.02% 97 3034 0.02% 98 3184 0.02% 99 3357 0.02% 100 3844 0.02% 101 4091 0.02% 102 4262 0.02% 103 4721 0.03% 104 4966 0.03% 105 6362 0.03% 106 5707 0.03% 107 6245 0.03% 108 6537 0.04% 109 7199 0.04% 110 8308 0.04% 111 9140 0.05% 112 10051 0.05% 113 11624 0.06% 114 12961 0.07% 115 15518 0.08% 116 18385 0.10% 117 22774 0.12% 118 28567 0.15% 119 35560 0.19% 120 46405 0.25% 121 65259 0.35% 122 100451 0.54% 123 187476 1.01% 124 594972 3.20% 125 17136396 92.03% 18621048 reads passed initial QC criterion=sequence-density sequence-density=4.60 sequence-density-rank=1 fanout-score=47.60 fanout-score-rank=1 prefix-density=6.22 prefix-fanout=35.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=4.60 sequence-density-rank=1 fanout-score=47.60 fanout-score-rank=1 prefix-density=6.22 prefix-fanout=35.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR3208005 - Input file: STDIN trimmed: SRR3208005-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 01:06:52 2025 >> started Wed Feb 12 01:07:04 2025 >> done (11.873s) 11172629 reads processed; of these: 869 ( 0.01%) short reads filtered out after trimming by size control 18478 ( 0.17%) empty reads filtered out after trimming by size control 11153282 (99.83%) reads available; of these: 1585455 (14.22%) trimmed reads available after processing 9567827 (85.78%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 487 0.00% 19 435 0.00% 20 557 0.00% 21 448 0.00% 22 502 0.00% 23 500 0.00% 24 1825 0.02% 25 1814 0.02% 26 553 0.00% 27 422 0.00% 28 423 0.00% 29 534 0.00% 30 729 0.01% 31 572 0.01% 32 824 0.01% 33 1256 0.01% 34 452 0.00% 35 365 0.00% 36 435 0.00% 37 393 0.00% 38 380 0.00% 39 433 0.00% 40 1746 0.02% 41 431 0.00% 42 515 0.00% 43 472 0.00% 44 467 0.00% 45 506 0.00% 46 471 0.00% 47 497 0.00% 48 470 0.00% 49 534 0.00% 50 550 0.00% 51 524 0.00% 52 609 0.01% 53 577 0.01% 54 625 0.01% 55 636 0.01% 56 637 0.01% 57 652 0.01% 58 759 0.01% 59 788 0.01% 60 830 0.01% 61 863 0.01% 62 891 0.01% 63 943 0.01% 64 871 0.01% 65 1078 0.01% 66 1007 0.01% 67 1002 0.01% 68 1127 0.01% 69 1193 0.01% 70 1310 0.01% 71 1315 0.01% 72 1497 0.01% 73 1680 0.02% 74 1735 0.02% 75 1741 0.02% 76 2064 0.02% 77 1921 0.02% 78 2220 0.02% 79 2471 0.02% 80 2772 0.02% 81 3009 0.03% 82 3354 0.03% 83 3807 0.03% 84 4052 0.04% 85 4428 0.04% 86 4709 0.04% 87 5146 0.05% 88 5728 0.05% 89 6443 0.06% 90 7242 0.06% 91 8411 0.08% 92 9775 0.09% 93 10899 0.10% 94 12380 0.11% 95 13409 0.12% 96 14202 0.13% 97 15644 0.14% 98 17097 0.15% 99 19255 0.17% 100 21972 0.20% 101 25054 0.22% 102 28250 0.25% 103 31709 0.28% 104 34887 0.31% 105 37545 0.34% 106 38957 0.35% 107 41005 0.37% 108 42829 0.38% 109 46528 0.42% 110 51084 0.46% 111 56234 0.50% 112 62421 0.56% 113 67794 0.61% 114 73020 0.65% 115 77499 0.69% 116 80238 0.72% 117 83634 0.75% 118 87959 0.79% 119 96200 0.86% 120 115550 1.04% 121 169761 1.52% 122 361302 3.24% 123 95763 0.86% 124 304623 2.73% 125 8795138 78.86% criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=4.91 fanout-score-rank=28 prefix-density=0.09 prefix-fanout=3.2 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=16 fanout-score=342.53 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=32.5 sequence=TTCTTCTTCTTT Started job on | Feb 12 01:07:32 Started mapping on | Feb 12 01:07:33 Finished on | Feb 12 01:08:00 Mapping speed, Million of reads per hour | 2480.23 Number of input reads | 18601701 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 17680089 Uniquely mapped reads % | 95.05% Average mapped length | 122.45 Number of splices: Total | 6709684 Number of splices: Annotated (sjdb) | 6587125 Number of splices: GT/AG | 6608071 Number of splices: GC/AG | 82925 Number of splices: AT/AC | 6768 Number of splices: Non-canonical | 11920 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.02% Deletion average length | 2.16 Insertion rate per base | 0.02% Insertion average length | 1.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 363547 % of reads mapped to multiple loci | 1.95% Number of reads mapped to too many loci | 232994 % of reads mapped to too many loci | 1.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.74% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 558065 558065 558065 N_multimapping 363547 363547 363547 N_noFeature 710561 9130939 9146244 N_ambiguous 176406 31387 31819 UnstrandedReadsAssigned:16793122 PositiveStrandReadsAssigned:8517763 NegativeStrandReadsAssigned:8502026 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208005 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208005-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,601,701 reads, 17,268,606 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,349 rounds 52401 SRR3208005.ke.tsv 34699 SRR3208005.se.tsv 87100 total ==> SRR3208005.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 624 27.858 Potri.005G024800.1.v4.1 1035 936 68.0067 6.22466 Potri.004G059700.1.v4.1 961 862 15 1.49082 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 280.396 8.4466 Potri.016G087400.1.v4.1 270 171 809 405.315 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 94.5734 4.84009 Potri.012G127500.1.v4.1 977 878 3435 335.176 ==> SRR3208005.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1944 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 319 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3208005 completed mapping pipeline successfully