Starting /dee2/code/volunteer_pipeline.sh SRR3208006 current disk space = 3051189784576 free memory = 1578982016 SRR3208006 SRAfilesize 82a3f97bf229065b52679a568d088319 SRR3208006.sra SRR3208006.sra file validated SRR3208006 is single end SRR3208006 is conventional basespace SRR3208006 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208006_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.0225 33.0 32.0 34.0 25.0 34.0 2 31.89675 33.0 32.0 34.0 28.0 34.0 3 31.84925 33.0 32.0 34.0 28.0 34.0 4 31.6675 33.0 32.0 34.0 28.0 34.0 5 31.8635 33.0 32.0 34.0 28.0 34.0 6 35.39425 38.0 36.0 38.0 29.0 38.0 7 35.9225 38.0 37.0 38.0 31.0 38.0 8 36.058 38.0 37.0 38.0 31.0 38.0 9 36.16275 38.0 37.0 38.0 33.0 38.0 10-11 36.206125 38.0 37.0 38.0 32.5 38.0 12-13 36.20625 38.0 37.0 38.0 33.0 38.0 14-15 36.305375 38.0 37.0 38.0 33.0 38.0 16-17 36.283249999999995 38.0 37.0 38.0 33.5 38.0 18-19 36.202749999999995 38.0 37.0 38.0 33.0 38.0 20-21 36.145250000000004 38.0 37.0 38.0 33.0 38.0 22-23 36.30825 38.0 37.0 38.0 33.0 38.0 24-25 36.281375 38.0 37.0 38.0 33.5 38.0 26-27 36.144999999999996 38.0 37.0 38.0 33.0 38.0 28-29 36.12575 38.0 37.0 38.0 32.5 38.0 30-31 36.246875 38.0 37.5 38.0 33.0 38.0 32-33 36.092 38.0 37.0 38.0 33.0 38.0 34-35 36.113625 38.0 37.0 38.0 33.0 38.0 36-37 36.078 38.0 37.0 38.0 33.0 38.0 38-39 36.1355 38.0 37.0 38.0 33.0 38.0 40-41 36.202375 38.0 37.0 38.0 33.0 38.0 42-43 36.130625 38.0 37.0 38.0 33.0 38.0 44-45 36.17275 38.0 37.0 38.0 33.0 38.0 46-47 36.183 38.0 37.0 38.0 33.0 38.0 48-49 36.047250000000005 38.0 37.0 38.0 32.0 38.0 50-51 36.12325 38.0 37.0 38.0 33.0 38.0 52-53 36.13375 38.0 37.0 38.0 33.0 38.0 54-55 36.13625 38.0 37.0 38.0 33.0 38.0 56-57 36.126625000000004 38.0 37.0 38.0 33.0 38.0 58-59 36.170500000000004 38.0 37.0 38.0 33.0 38.0 60-61 35.991125 38.0 37.0 38.0 32.0 38.0 62-63 35.967625 38.0 37.0 38.0 31.0 38.0 64-65 35.9675 38.0 37.0 38.0 31.0 38.0 66-67 36.073 38.0 37.0 38.0 32.5 38.0 68-69 36.213625 38.0 37.0 38.0 33.0 38.0 70-71 36.12775 38.0 37.0 38.0 33.0 38.0 72-73 36.0705 38.0 37.0 38.0 33.0 38.0 74-75 36.043 38.0 37.0 38.0 32.0 38.0 76-77 35.757999999999996 38.0 37.0 38.0 31.0 38.0 78-79 35.900375 38.0 37.0 38.0 31.0 38.0 80-81 36.03775 38.0 37.0 38.0 32.0 38.0 82-83 35.942375 38.0 37.0 38.0 32.0 38.0 84-85 35.925875 38.0 37.0 38.0 31.0 38.0 86-87 35.925625 38.0 37.0 38.0 32.0 38.0 88-89 35.82125 38.0 37.0 38.0 31.0 38.0 90-91 35.848124999999996 38.0 37.0 38.0 31.0 38.0 92-93 35.76925 38.0 37.0 38.0 31.0 38.0 94-95 35.910125 38.0 37.0 38.0 32.0 38.0 96-97 35.71625 38.0 37.0 38.0 31.0 38.0 98-99 35.778875 38.0 37.0 38.0 31.0 38.0 100-101 35.66675 38.0 37.0 38.0 31.0 38.0 102-103 35.637375 38.0 37.0 38.0 31.0 38.0 104-105 35.714749999999995 38.0 37.0 38.0 31.0 38.0 106-107 35.41225 38.0 36.5 38.0 30.0 38.0 108-109 34.7505 38.0 36.5 38.0 27.0 38.0 110-111 34.83825 38.0 36.0 38.0 27.5 38.0 112-113 34.576499999999996 38.0 36.0 38.0 25.5 38.0 114-115 34.713750000000005 38.0 36.0 38.0 26.5 38.0 116-117 35.006625 38.0 36.0 38.0 27.0 38.0 118-119 35.111000000000004 38.0 36.0 38.0 28.0 38.0 120-121 34.988625 38.0 36.0 38.0 28.5 38.0 122-123 35.074375 38.0 36.0 38.0 30.0 38.0 124-125 33.438375 37.5 33.5 38.0 23.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 0.0 17 1.0 18 4.0 19 5.0 20 4.0 21 4.0 22 7.0 23 9.0 24 7.0 25 22.0 26 26.0 27 38.0 28 61.0 29 64.0 30 55.0 31 121.0 32 158.0 33 192.0 34 266.0 35 321.0 36 598.0 37 2030.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.551546391752577 15.128865979381443 13.067010309278352 49.25257731958763 2 19.11433575181386 22.316737553164874 39.60470352764573 18.964223167375533 3 21.224999999999998 25.424999999999997 27.35 26.0 4 23.45 30.4 21.85 24.3 5 25.3 32.550000000000004 23.25 18.9 6 17.4 38.0 24.15 20.45 7 16.900000000000002 20.175 43.675000000000004 19.25 8 18.325 23.625 30.9 27.150000000000002 9 19.625 22.85 34.0 23.525 10-11 21.0625 33.4375 23.875 21.625 12-13 19.75 27.275 30.587500000000002 22.3875 14-15 21.675 27.8375 28.6125 21.875 16-17 21.9375 27.6375 28.462500000000002 21.9625 18-19 21.8875 28.799999999999997 27.950000000000003 21.3625 20-21 21.85 28.6625 27.925 21.5625 22-23 21.175 28.4125 28.1125 22.3 24-25 20.424999999999997 29.125 28.237499999999997 22.2125 26-27 20.9375 28.1625 28.7 22.2 28-29 21.65 28.15 27.6625 22.537499999999998 30-31 21.075 28.725 27.787499999999998 22.412499999999998 32-33 21.8 29.075 27.3875 21.7375 34-35 21.7375 28.849999999999998 27.3875 22.025 36-37 20.925 28.325 28.275 22.475 38-39 21.087500000000002 28.9125 27.712500000000002 22.287499999999998 40-41 21.5375 29.175 27.200000000000003 22.0875 42-43 21.637500000000003 29.125 28.249999999999996 20.9875 44-45 21.55 28.65 28.475 21.325 46-47 21.675 28.599999999999998 27.525 22.2 48-49 21.2 28.225 28.175 22.400000000000002 50-51 22.2 28.000000000000004 27.6 22.2 52-53 21.2875 28.825 27.9375 21.95 54-55 21.85 28.075 28.249999999999996 21.825 56-57 21.5 27.650000000000002 28.599999999999998 22.25 58-59 20.849999999999998 29.3375 27.787499999999998 22.025 60-61 21.75 28.675 27.525 22.05 62-63 21.425 28.537499999999998 28.625 21.4125 64-65 22.725 28.449999999999996 27.962500000000002 20.8625 66-67 21.4375 28.725 27.8625 21.975 68-69 22.0625 28.299999999999997 27.950000000000003 21.6875 70-71 21.475 28.749999999999996 27.675 22.1 72-73 21.4875 28.8875 27.9375 21.6875 74-75 22.037499999999998 27.5625 28.799999999999997 21.6 76-77 21.075 28.287499999999998 29.075 21.5625 78-79 21.712500000000002 28.000000000000004 28.375 21.912499999999998 80-81 22.1375 28.537499999999998 27.5625 21.762500000000003 82-83 22.825 28.275 28.262500000000003 20.6375 84-85 21.3125 28.712500000000002 28.0625 21.912499999999998 86-87 22.7625 28.9875 27.037499999999998 21.212500000000002 88-89 22.25 29.049999999999997 27.3875 21.3125 90-91 21.512500000000003 28.025 29.075 21.3875 92-93 22.4375 28.212500000000002 28.5875 20.7625 94-95 22.175 28.275 28.3125 21.2375 96-97 21.3625 28.3375 28.1625 22.1375 98-99 21.375 27.712500000000002 28.8875 22.025 100-101 22.3125 28.487499999999997 28.3875 20.8125 102-103 22.5875 28.549999999999997 28.037499999999998 20.825 104-105 21.512500000000003 28.575 28.625 21.2875 106-107 22.288092835519677 28.594853683148337 27.674066599394553 21.442986881937436 108-109 22.759856630824373 28.225806451612907 27.30414746543779 21.710189452124936 110-111 22.826503255457677 27.728839525086173 28.6224945742372 20.822162645218945 112-113 22.63739085772984 28.274268104776578 28.210066769388803 20.878274268104775 114-115 22.55849440488301 29.42522889114954 26.51322482197355 21.503051881993894 116-117 23.13582726587999 29.851870449409994 26.76374592016068 20.248556364549337 118-119 22.537499999999998 28.5625 27.200000000000003 21.7 120-121 22.662499999999998 29.675 26.3 21.3625 122-123 22.725 28.975 27.0625 21.2375 124-125 22.7125 28.8375 26.775 21.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 2.0 23 3.0 24 2.0 25 1.0 26 4.5 27 7.0 28 9.0 29 13.5 30 19.5 31 27.5 32 36.5 33 53.5 34 66.5 35 74.0 36 96.5 37 117.5 38 138.5 39 175.5 40 210.0 41 244.0 42 272.5 43 273.0 44 273.0 45 270.0 46 255.0 47 234.0 48 214.5 49 200.5 50 167.5 51 122.0 52 92.5 53 84.5 54 67.0 55 42.5 56 31.5 57 24.5 58 18.5 59 13.5 60 9.0 61 8.5 62 5.5 63 3.5 64 3.5 65 3.5 66 2.0 67 0.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.5 75 1.0 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.8999999999999999 108-109 2.35 110-111 2.0875 112-113 2.65 114-115 1.7000000000000002 116-117 0.42500000000000004 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.3625 0.0 0.0 0.0 0.0 104-105 1.7375 0.0 0.0 0.0 0.0 106-107 2.2 0.0 0.0 0.0 0.0 108-109 2.825 0.0 0.0 0.0 0.0 110-111 3.45 0.0 0.0 0.0 0.0 112-113 4.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAGAG 45 0.009044812 26.408333 116-117 >>END_MODULE Read 1345468 spots for SRR3208006.sra Written 1345468 spots for SRR3208006.sra Read 1345468 spots for SRR3208006.sra Written 1345468 spots for SRR3208006.sra Read 1345468 spots for SRR3208006.sra Written 1345468 spots for SRR3208006.sra Read 1345468 spots for SRR3208006.sra Written 1345468 spots for SRR3208006.sra Read 1345468 spots for SRR3208006.sra Written 1345468 spots for SRR3208006.sra Read 1345468 spots for SRR3208006.sra Written 1345468 spots for SRR3208006.sra Read 1345468 spots for SRR3208006.sra Written 1345468 spots for SRR3208006.sra Read 1345468 spots for SRR3208006.sra Written 1345468 spots for SRR3208006.sra Read 1345468 spots for SRR3208006.sra Written 1345468 spots for SRR3208006.sra Read 1345468 spots for SRR3208006.sra Written 1345468 spots for SRR3208006.sra Read 1345468 spots for SRR3208006.sra Written 1345468 spots for SRR3208006.sra Read 1345468 spots for SRR3208006.sra Written 1345468 spots for SRR3208006.sra Read 1345468 spots for SRR3208006.sra Written 1345468 spots for SRR3208006.sra Read 1345471 spots for SRR3208006.sra Written 1345471 spots for SRR3208006.sra Read 1345468 spots for SRR3208006.sra Written 1345468 spots for SRR3208006.sra Read 1345468 spots for SRR3208006.sra Written 1345468 spots for SRR3208006.sra Read 1345468 spots for SRR3208006.sra Written 1345468 spots for SRR3208006.sra Read 1345468 spots for SRR3208006.sra Written 1345468 spots for SRR3208006.sra Read 1345468 spots for SRR3208006.sra Written 1345468 spots for SRR3208006.sra Read 1345468 spots for SRR3208006.sra Written 1345468 spots for SRR3208006.sra SRR ids: ['SRR3208006.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b272w5rx SRR3208006.sra spots: 26909363 blocks: [[1, 1345468], [1345469, 2690936], [2690937, 4036404], [4036405, 5381872], [5381873, 6727340], [6727341, 8072808], [8072809, 9418276], [9418277, 10763744], [10763745, 12109212], [12109213, 13454680], [13454681, 14800148], [14800149, 16145616], [16145617, 17491084], [17491085, 18836552], [18836553, 20182020], [20182021, 21527488], [21527489, 22872956], [22872957, 24218424], [24218425, 25563892], [25563893, 26909363]] SRR3208006 file size 8621837 SRR3208006 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208006 SRR3208006_1.fastq Input file: SRR3208006_1.fastq trimmed: SRR3208006-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 01:18:13 2025 >> started Wed Feb 12 01:18:32 2025 >> done (19.324s) 26909363 reads processed; of these: 10400 ( 0.04%) short reads filtered out after trimming by size control 68330 ( 0.25%) empty reads filtered out after trimming by size control 26830633 (99.71%) reads available; of these: 2247153 ( 8.38%) trimmed reads available after processing 24583480 (91.62%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 412 0.00% 19 467 0.00% 20 949 0.00% 21 546 0.00% 22 565 0.00% 23 763 0.00% 24 3679 0.01% 25 3983 0.01% 26 923 0.00% 27 668 0.00% 28 689 0.00% 29 946 0.00% 30 1424 0.01% 31 1111 0.00% 32 1020 0.00% 33 533 0.00% 34 572 0.00% 35 613 0.00% 36 679 0.00% 37 622 0.00% 38 682 0.00% 39 605 0.00% 40 694 0.00% 41 688 0.00% 42 778 0.00% 43 775 0.00% 44 793 0.00% 45 790 0.00% 46 773 0.00% 47 814 0.00% 48 881 0.00% 49 921 0.00% 50 966 0.00% 51 1054 0.00% 52 1025 0.00% 53 1113 0.00% 54 1118 0.00% 55 1173 0.00% 56 1208 0.00% 57 1299 0.00% 58 1342 0.01% 59 1493 0.01% 60 1579 0.01% 61 1554 0.01% 62 1596 0.01% 63 1632 0.01% 64 1829 0.01% 65 1969 0.01% 66 1991 0.01% 67 2121 0.01% 68 2283 0.01% 69 2477 0.01% 70 2670 0.01% 71 2875 0.01% 72 3050 0.01% 73 3494 0.01% 74 3978 0.01% 75 4240 0.02% 76 4363 0.02% 77 4391 0.02% 78 4758 0.02% 79 5151 0.02% 80 5700 0.02% 81 6372 0.02% 82 7088 0.03% 83 7992 0.03% 84 8510 0.03% 85 9119 0.03% 86 10221 0.04% 87 10805 0.04% 88 12135 0.05% 89 13813 0.05% 90 16011 0.06% 91 18495 0.07% 92 21295 0.08% 93 23171 0.09% 94 3868 0.01% 95 3981 0.01% 96 4308 0.02% 97 4224 0.02% 98 4365 0.02% 99 4607 0.02% 100 5204 0.02% 101 5578 0.02% 102 5999 0.02% 103 6537 0.02% 104 7236 0.03% 105 8874 0.03% 106 8456 0.03% 107 9175 0.03% 108 9700 0.04% 109 10982 0.04% 110 12285 0.05% 111 14122 0.05% 112 15552 0.06% 113 17683 0.07% 114 20521 0.08% 115 24545 0.09% 116 29287 0.11% 117 36893 0.14% 118 46545 0.17% 119 58672 0.22% 120 76546 0.29% 121 109220 0.41% 122 168152 0.63% 123 312177 1.16% 124 930982 3.47% 125 24583480 91.62% 26830633 reads passed initial QC criterion=sequence-density sequence-density=4.21 sequence-density-rank=1 fanout-score=47.89 fanout-score-rank=1 prefix-density=5.79 prefix-fanout=34.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=4.21 sequence-density-rank=1 fanout-score=47.89 fanout-score-rank=1 prefix-density=5.79 prefix-fanout=34.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR3208006 - Input file: STDIN trimmed: SRR3208006-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 01:19:35 2025 >> started Wed Feb 12 01:19:59 2025 >> done (24.444s) 16098380 reads processed; of these: 160 ( 0.00%) short reads filtered out after trimming by size control 1690 ( 0.01%) empty reads filtered out after trimming by size control 16096530 (99.99%) reads available; of these: 2202144 (13.68%) trimmed reads available after processing 13894386 (86.32%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 272 0.00% 19 323 0.00% 20 1251 0.01% 21 370 0.00% 22 360 0.00% 23 437 0.00% 24 1980 0.01% 25 1851 0.01% 26 522 0.00% 27 402 0.00% 28 395 0.00% 29 552 0.00% 30 839 0.01% 31 663 0.00% 32 605 0.00% 33 313 0.00% 34 377 0.00% 35 395 0.00% 36 403 0.00% 37 369 0.00% 38 401 0.00% 39 359 0.00% 40 415 0.00% 41 386 0.00% 42 478 0.00% 43 487 0.00% 44 484 0.00% 45 490 0.00% 46 472 0.00% 47 483 0.00% 48 542 0.00% 49 556 0.00% 50 619 0.00% 51 638 0.00% 52 619 0.00% 53 644 0.00% 54 705 0.00% 55 682 0.00% 56 720 0.00% 57 799 0.00% 58 778 0.00% 59 878 0.01% 60 1005 0.01% 61 979 0.01% 62 973 0.01% 63 987 0.01% 64 1065 0.01% 65 1088 0.01% 66 1175 0.01% 67 1314 0.01% 68 1387 0.01% 69 1469 0.01% 70 1641 0.01% 71 1645 0.01% 72 1766 0.01% 73 2023 0.01% 74 2125 0.01% 75 2205 0.01% 76 2412 0.01% 77 2573 0.02% 78 2922 0.02% 79 3131 0.02% 80 3515 0.02% 81 3851 0.02% 82 4250 0.03% 83 4804 0.03% 84 5191 0.03% 85 5445 0.03% 86 6146 0.04% 87 6549 0.04% 88 7346 0.05% 89 8343 0.05% 90 9758 0.06% 91 11002 0.07% 92 12622 0.08% 93 13950 0.09% 94 16132 0.10% 95 17401 0.11% 96 18685 0.12% 97 20712 0.13% 98 22787 0.14% 99 25585 0.16% 100 29219 0.18% 101 33274 0.21% 102 37892 0.24% 103 42362 0.26% 104 47038 0.29% 105 50430 0.31% 106 52952 0.33% 107 56302 0.35% 108 58200 0.36% 109 63673 0.40% 110 69954 0.43% 111 78134 0.49% 112 86741 0.54% 113 94436 0.59% 114 103129 0.64% 115 110080 0.68% 116 114552 0.71% 117 120883 0.75% 118 128042 0.80% 119 141254 0.88% 120 171517 1.07% 121 252675 1.57% 122 526459 3.27% 123 159727 0.99% 124 478508 2.97% 125 12705824 78.94% criterion=sequence-density sequence-density=0.05 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=40 prefix-density=0.05 prefix-fanout=2.3 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.04 sequence-density-rank=11 fanout-score=360.86 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=32.0 sequence=TTCTTCTTCTTC Started job on | Feb 12 01:20:32 Started mapping on | Feb 12 01:20:33 Finished on | Feb 12 01:21:12 Mapping speed, Million of reads per hour | 2476.50 Number of input reads | 26828783 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 25185454 Uniquely mapped reads % | 93.87% Average mapped length | 122.57 Number of splices: Total | 9401262 Number of splices: Annotated (sjdb) | 9207858 Number of splices: GT/AG | 9245659 Number of splices: GC/AG | 127136 Number of splices: AT/AC | 9961 Number of splices: Non-canonical | 18506 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.02% Deletion average length | 2.32 Insertion rate per base | 0.02% Insertion average length | 1.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 605301 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 381708 % of reads mapped to too many loci | 1.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.43% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1038028 1038028 1038028 N_multimapping 605301 605301 605301 N_noFeature 1178264 13054084 13142597 N_ambiguous 267308 50300 50465 UnstrandedReadsAssigned:23739882 PositiveStrandReadsAssigned:12081070 NegativeStrandReadsAssigned:11992392 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208006 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208006-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,828,783 reads, 24,521,343 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52401 SRR3208006.ke.tsv 34699 SRR3208006.se.tsv 87100 total ==> SRR3208006.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1418.58 39.6948 Potri.005G024800.1.v4.1 1035 936 1804 103.494 Potri.004G059700.1.v4.1 961 862 8 0.498355 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 469.386 8.86252 Potri.016G087400.1.v4.1 270 171 963 302.403 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 386.732 12.4054 Potri.012G127500.1.v4.1 977 878 5570 340.657 ==> SRR3208006.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2715 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 397 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 33 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 37 SRR3208006 completed mapping pipeline successfully