Starting /dee2/code/volunteer_pipeline.sh SRR3208007 current disk space = 3051617099776 free memory = 1282327904 SRR3208007 SRAfilesize f438101c0c13325631dafacb0acc31e7 SRR3208007.sra SRR3208007.sra file validated SRR3208007 is single end SRR3208007 is conventional basespace SRR3208007 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208007_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.12275 33.0 32.0 34.0 27.0 34.0 2 32.0105 33.0 32.0 34.0 28.0 34.0 3 31.98625 33.0 32.0 34.0 28.0 34.0 4 31.6405 33.0 32.0 34.0 28.0 34.0 5 31.83525 33.0 32.0 34.0 28.0 34.0 6 35.3865 38.0 36.0 38.0 29.0 38.0 7 35.97525 38.0 37.0 38.0 31.0 38.0 8 36.162 38.0 37.0 38.0 33.0 38.0 9 36.314 38.0 37.0 38.0 33.0 38.0 10-11 36.222625 38.0 37.0 38.0 33.0 38.0 12-13 36.22175 38.0 37.0 38.0 33.0 38.0 14-15 36.278 38.0 37.5 38.0 33.0 38.0 16-17 36.311875 38.0 37.0 38.0 33.0 38.0 18-19 36.149125 38.0 37.0 38.0 33.0 38.0 20-21 36.289125 38.0 37.0 38.0 33.0 38.0 22-23 36.30925 38.0 37.0 38.0 33.0 38.0 24-25 36.325 38.0 37.0 38.0 33.0 38.0 26-27 36.0965 38.0 37.0 38.0 32.0 38.0 28-29 36.081500000000005 38.0 37.0 38.0 32.0 38.0 30-31 36.164249999999996 38.0 37.0 38.0 33.0 38.0 32-33 36.174625 38.0 37.0 38.0 33.0 38.0 34-35 36.08525 38.0 37.0 38.0 32.5 38.0 36-37 36.028999999999996 38.0 37.0 38.0 32.0 38.0 38-39 36.131875 38.0 37.0 38.0 32.0 38.0 40-41 36.187749999999994 38.0 37.5 38.0 33.0 38.0 42-43 36.085750000000004 38.0 37.0 38.0 33.0 38.0 44-45 36.128125 38.0 37.0 38.0 32.0 38.0 46-47 36.166375 38.0 37.0 38.0 33.0 38.0 48-49 35.97475 38.0 37.0 38.0 32.0 38.0 50-51 36.15325 38.0 37.0 38.0 33.0 38.0 52-53 36.176249999999996 38.0 37.0 38.0 33.0 38.0 54-55 36.11125 38.0 37.0 38.0 33.0 38.0 56-57 36.017875000000004 38.0 37.0 38.0 32.0 38.0 58-59 36.101375000000004 38.0 37.0 38.0 33.0 38.0 60-61 36.059625 38.0 37.0 38.0 33.0 38.0 62-63 36.09125 38.0 37.0 38.0 33.0 38.0 64-65 35.992375 38.0 37.0 38.0 32.0 38.0 66-67 36.092625 38.0 37.0 38.0 32.0 38.0 68-69 36.198499999999996 38.0 37.0 38.0 33.0 38.0 70-71 36.08575 38.0 37.0 38.0 32.5 38.0 72-73 36.001374999999996 38.0 37.0 38.0 32.5 38.0 74-75 35.975125 38.0 37.0 38.0 32.0 38.0 76-77 35.522875 38.0 37.0 38.0 29.0 38.0 78-79 35.606750000000005 38.0 37.0 38.0 30.0 38.0 80-81 35.7615 38.0 37.0 38.0 31.0 38.0 82-83 35.653125 38.0 37.0 38.0 31.0 38.0 84-85 35.666250000000005 38.0 37.0 38.0 31.0 38.0 86-87 35.678375 38.0 37.0 38.0 31.0 38.0 88-89 35.58125 38.0 37.0 38.0 30.0 38.0 90-91 35.639624999999995 38.0 37.0 38.0 31.0 38.0 92-93 35.55925 38.0 37.0 38.0 30.0 38.0 94-95 35.54975 38.0 37.0 38.0 30.5 38.0 96-97 35.489000000000004 38.0 37.0 38.0 30.0 38.0 98-99 35.603125 38.0 37.0 38.0 31.0 38.0 100-101 35.361000000000004 38.0 37.0 38.0 30.0 38.0 102-103 35.390125 38.0 37.0 38.0 29.0 38.0 104-105 35.57825 38.0 37.0 38.0 31.0 38.0 106-107 35.077 38.0 36.5 38.0 29.0 38.0 108-109 34.478625 38.0 36.0 38.0 26.0 38.0 110-111 34.457875 38.0 36.0 38.0 26.0 38.0 112-113 34.424875 38.0 36.0 38.0 25.5 38.0 114-115 34.473875 38.0 36.0 38.0 24.5 38.0 116-117 34.797 38.0 36.0 38.0 26.5 38.0 118-119 34.9005 38.0 36.0 38.0 27.5 38.0 120-121 34.755125 38.0 36.0 38.0 27.0 38.0 122-123 34.789500000000004 38.0 36.0 38.0 28.0 38.0 124-125 33.042 37.0 33.5 38.0 22.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 3.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 2.0 17 3.0 18 4.0 19 4.0 20 7.0 21 9.0 22 12.0 23 19.0 24 10.0 25 28.0 26 36.0 27 37.0 28 56.0 29 65.0 30 82.0 31 112.0 32 122.0 33 168.0 34 269.0 35 297.0 36 568.0 37 2081.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.29971554176364 14.48151021463667 12.309283682441169 49.90949056115852 2 17.825 21.65 39.775 20.75 3 20.95 24.5 28.875 25.674999999999997 4 22.775000000000002 31.324999999999996 21.375 24.525 5 25.525 34.075 22.425 17.974999999999998 6 21.45 36.0 23.325000000000003 19.225 7 16.2 20.9 43.525000000000006 19.375 8 18.35 25.575 29.95 26.125 9 18.975 24.175 32.675 24.175 10-11 21.8 33.4 22.75 22.05 12-13 19.525000000000002 28.1625 29.7 22.6125 14-15 20.8875 27.437499999999996 28.5875 23.0875 16-17 22.2625 28.4375 26.887499999999996 22.412499999999998 18-19 21.4875 29.025000000000002 26.450000000000003 23.0375 20-21 21.8875 28.325 27.8625 21.925 22-23 21.3 29.45 28.075 21.175 24-25 20.65 27.900000000000002 28.325 23.125 26-27 20.424999999999997 28.7375 27.8875 22.95 28-29 21.6 27.725 28.287499999999998 22.3875 30-31 21.3625 27.925 28.3625 22.35 32-33 21.95 29.562500000000004 26.700000000000003 21.7875 34-35 21.9625 28.012500000000003 28.925 21.099999999999998 36-37 21.1625 28.599999999999998 27.400000000000002 22.8375 38-39 22.3125 27.474999999999998 27.8875 22.325 40-41 21.775 28.475 28.249999999999996 21.5 42-43 21.637500000000003 29.475 27.700000000000003 21.1875 44-45 21.5375 27.737499999999997 29.099999999999998 21.625 46-47 21.675 28.65 27.825 21.85 48-49 21.85 28.8375 27.35 21.9625 50-51 21.9625 27.325 28.4125 22.3 52-53 21.725 27.8625 28.225 22.1875 54-55 22.287499999999998 28.499999999999996 27.3125 21.9 56-57 20.9 28.1625 28.787499999999998 22.15 58-59 21.725 28.3875 27.9375 21.95 60-61 22.175 28.262500000000003 28.487499999999997 21.075 62-63 21.575 27.175 29.475 21.775 64-65 21.475 27.925 29.037499999999998 21.5625 66-67 21.475 28.962500000000002 28.175 21.3875 68-69 21.65 28.7 27.975 21.675 70-71 21.6 28.65 27.900000000000002 21.85 72-73 21.512500000000003 29.349999999999998 27.250000000000004 21.8875 74-75 21.4125 28.6125 28.249999999999996 21.725 76-77 21.987499999999997 28.1625 27.9375 21.912499999999998 78-79 21.775 28.6875 27.525 22.0125 80-81 22.0625 28.725 28.199999999999996 21.0125 82-83 22.1 28.8875 27.487499999999997 21.525 84-85 22.3125 27.6 27.925 22.162499999999998 86-87 22.2125 27.625 28.375 21.7875 88-89 21.4125 28.1375 28.225 22.225 90-91 21.325 28.999999999999996 28.012500000000003 21.6625 92-93 21.675 28.962500000000002 27.250000000000004 22.112499999999997 94-95 22.225 28.6125 27.6125 21.55 96-97 22.2 27.487499999999997 28.1625 22.15 98-99 22.3 27.825 27.6625 22.2125 100-101 22.05 27.925 27.950000000000003 22.075 102-103 20.6125 30.162499999999998 27.750000000000004 21.475 104-105 22.2125 28.037499999999998 28.075 21.675 106-107 22.408998988877656 29.23407482305359 26.579878665318503 21.777047522750255 108-109 21.858134155744025 28.87432536622976 27.3580056540735 21.90953482395271 110-111 22.270574683220275 28.068603609369003 27.902214258287472 21.758607449123257 112-113 21.753121379842966 29.617711417170806 26.592869095121635 22.036298107864592 114-115 22.847301951779563 29.41701747671897 26.342645745630822 21.393034825870647 116-117 22.18588856747579 29.19129669223997 27.543705194315184 21.07910954596906 118-119 22.775000000000002 29.0875 27.1625 20.974999999999998 120-121 22.775000000000002 28.525 27.150000000000002 21.55 122-123 22.875 30.475 25.525 21.125 124-125 23.4125 28.6125 26.5 21.475 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 2.5 25 3.5 26 5.5 27 7.5 28 10.5 29 11.5 30 15.0 31 28.0 32 43.5 33 55.5 34 59.0 35 76.0 36 106.0 37 125.0 38 141.5 39 177.5 40 206.5 41 210.5 42 227.0 43 260.5 44 274.5 45 278.0 46 267.0 47 241.0 48 225.5 49 200.0 50 164.5 51 128.5 52 98.5 53 76.5 54 57.5 55 45.0 56 36.0 57 30.5 58 25.5 59 17.5 60 11.5 61 8.0 62 9.0 63 7.0 64 4.5 65 4.5 66 2.5 67 4.0 68 3.0 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.5 75 2.0 76 1.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 1.0999999999999999 108-109 2.725 110-111 2.3375 112-113 2.8875 114-115 2.0125 116-117 0.6125 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87351378699721 98.7 2 0.10118897040222614 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025297242600556536 1.0999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTAT 44 1.0999999999999999 TruSeq Adapter, Index 18 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.0625 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.35 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.7875 0.0 0.0 0.0 0.0 108-109 2.4 0.0 0.0 0.0 0.0 110-111 2.875 0.0 0.0 0.0 0.0 112-113 3.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1027431 spots for SRR3208007.sra Written 1027431 spots for SRR3208007.sra Read 1027431 spots for SRR3208007.sra Written 1027431 spots for SRR3208007.sra Read 1027431 spots for SRR3208007.sra Written 1027431 spots for SRR3208007.sra Read 1027431 spots for SRR3208007.sra Written 1027431 spots for SRR3208007.sra Read 1027431 spots for SRR3208007.sra Written 1027431 spots for SRR3208007.sra Read 1027431 spots for SRR3208007.sra Written 1027431 spots for SRR3208007.sra Read 1027431 spots for SRR3208007.sra Written 1027431 spots for SRR3208007.sra Read 1027431 spots for SRR3208007.sra Written 1027431 spots for SRR3208007.sra Read 1027431 spots for SRR3208007.sra Written 1027431 spots for SRR3208007.sra Read 1027431 spots for SRR3208007.sra Written 1027431 spots for SRR3208007.sra Read 1027431 spots for SRR3208007.sra Written 1027431 spots for SRR3208007.sra Read 1027431 spots for SRR3208007.sra Written 1027431 spots for SRR3208007.sra Read 1027431 spots for SRR3208007.sra Written 1027431 spots for SRR3208007.sra Read 1027431 spots for SRR3208007.sra Written 1027431 spots for SRR3208007.sra Read 1027431 spots for SRR3208007.sra Written 1027431 spots for SRR3208007.sra Read 1027431 spots for SRR3208007.sra Written 1027431 spots for SRR3208007.sra Read 1027431 spots for SRR3208007.sra Written 1027431 spots for SRR3208007.sra Read 1027449 spots for SRR3208007.sra Written 1027449 spots for SRR3208007.sra Read 1027431 spots for SRR3208007.sra Written 1027431 spots for SRR3208007.sra Read 1027431 spots for SRR3208007.sra Written 1027431 spots for SRR3208007.sra SRR ids: ['SRR3208007.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fqfuy18h SRR3208007.sra spots: 20548638 blocks: [[1, 1027431], [1027432, 2054862], [2054863, 3082293], [3082294, 4109724], [4109725, 5137155], [5137156, 6164586], [6164587, 7192017], [7192018, 8219448], [8219449, 9246879], [9246880, 10274310], [10274311, 11301741], [11301742, 12329172], [12329173, 13356603], [13356604, 14384034], [14384035, 15411465], [15411466, 16438896], [16438897, 17466327], [17466328, 18493758], [18493759, 19521189], [19521190, 20548638]] SRR3208007 file size 6581268 SRR3208007 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208007 SRR3208007_1.fastq Input file: SRR3208007_1.fastq trimmed: SRR3208007-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 00:18:39 2025 >> started Wed Feb 12 00:18:49 2025 >> done (10.641s) 20548638 reads processed; of these: 9015 ( 0.04%) short reads filtered out after trimming by size control 198008 ( 0.96%) empty reads filtered out after trimming by size control 20341615 (98.99%) reads available; of these: 1686065 ( 8.29%) trimmed reads available after processing 18655550 (91.71%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 406 0.00% 19 345 0.00% 20 408 0.00% 21 398 0.00% 22 456 0.00% 23 560 0.00% 24 2774 0.01% 25 3036 0.01% 26 789 0.00% 27 516 0.00% 28 541 0.00% 29 682 0.00% 30 1121 0.01% 31 854 0.00% 32 788 0.00% 33 464 0.00% 34 437 0.00% 35 487 0.00% 36 511 0.00% 37 480 0.00% 38 514 0.00% 39 501 0.00% 40 508 0.00% 41 539 0.00% 42 539 0.00% 43 609 0.00% 44 543 0.00% 45 584 0.00% 46 616 0.00% 47 665 0.00% 48 678 0.00% 49 751 0.00% 50 760 0.00% 51 791 0.00% 52 781 0.00% 53 833 0.00% 54 800 0.00% 55 862 0.00% 56 836 0.00% 57 995 0.00% 58 1029 0.01% 59 1080 0.01% 60 1162 0.01% 61 1194 0.01% 62 1248 0.01% 63 1324 0.01% 64 1813 0.01% 65 3005 0.01% 66 1815 0.01% 67 1556 0.01% 68 1684 0.01% 69 1998 0.01% 70 2100 0.01% 71 2462 0.01% 72 2425 0.01% 73 2909 0.01% 74 3510 0.02% 75 4553 0.02% 76 5024 0.02% 77 3369 0.02% 78 3199 0.02% 79 3364 0.02% 80 3870 0.02% 81 4101 0.02% 82 4733 0.02% 83 5316 0.03% 84 5719 0.03% 85 5981 0.03% 86 6462 0.03% 87 7071 0.03% 88 7722 0.04% 89 8902 0.04% 90 10199 0.05% 91 11881 0.06% 92 13667 0.07% 93 15034 0.07% 94 2724 0.01% 95 2902 0.01% 96 2956 0.01% 97 3162 0.02% 98 3377 0.02% 99 3493 0.02% 100 3882 0.02% 101 4095 0.02% 102 4452 0.02% 103 4900 0.02% 104 5399 0.03% 105 6608 0.03% 106 6267 0.03% 107 6767 0.03% 108 7230 0.04% 109 8252 0.04% 110 9231 0.05% 111 10482 0.05% 112 11700 0.06% 113 13286 0.07% 114 15388 0.08% 115 18316 0.09% 116 21628 0.11% 117 27445 0.13% 118 34956 0.17% 119 43645 0.21% 120 57339 0.28% 121 82284 0.40% 122 125718 0.62% 123 235786 1.16% 124 710156 3.49% 125 18655550 91.71% 20341615 reads passed initial QC criterion=sequence-density sequence-density=3.62 sequence-density-rank=1 fanout-score=48.16 fanout-score-rank=1 prefix-density=4.98 prefix-fanout=35.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA criterion=fanout-score sequence-density=3.62 sequence-density-rank=1 fanout-score=48.16 fanout-score-rank=1 prefix-density=4.98 prefix-fanout=35.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA -o SRR3208007 - Input file: STDIN trimmed: SRR3208007-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 00:20:07 2025 >> started Wed Feb 12 00:20:19 2025 >> done (11.803s) 10170808 reads processed; of these: 194 ( 0.00%) short reads filtered out after trimming by size control 6363 ( 0.06%) empty reads filtered out after trimming by size control 10164251 (99.94%) reads available; of these: 1246398 (12.26%) trimmed reads available after processing 8917853 (87.74%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 214 0.00% 19 186 0.00% 20 208 0.00% 21 247 0.00% 22 235 0.00% 23 306 0.00% 24 1330 0.01% 25 1361 0.01% 26 404 0.00% 27 265 0.00% 28 273 0.00% 29 375 0.00% 30 555 0.01% 31 433 0.00% 32 382 0.00% 33 224 0.00% 34 230 0.00% 35 267 0.00% 36 248 0.00% 37 245 0.00% 38 262 0.00% 39 258 0.00% 40 264 0.00% 41 252 0.00% 42 286 0.00% 43 296 0.00% 44 266 0.00% 45 305 0.00% 46 301 0.00% 47 337 0.00% 48 344 0.00% 49 358 0.00% 50 378 0.00% 51 400 0.00% 52 386 0.00% 53 410 0.00% 54 393 0.00% 55 450 0.00% 56 415 0.00% 57 543 0.01% 58 509 0.01% 59 522 0.01% 60 595 0.01% 61 604 0.01% 62 610 0.01% 63 632 0.01% 64 659 0.01% 65 693 0.01% 66 668 0.01% 67 715 0.01% 68 795 0.01% 69 939 0.01% 70 927 0.01% 71 1011 0.01% 72 1054 0.01% 73 1236 0.01% 74 1222 0.01% 75 1286 0.01% 76 1476 0.01% 77 1413 0.01% 78 1550 0.02% 79 1668 0.02% 80 1921 0.02% 81 2019 0.02% 82 2353 0.02% 83 2640 0.03% 84 2863 0.03% 85 2983 0.03% 86 3154 0.03% 87 3539 0.03% 88 3854 0.04% 89 4491 0.04% 90 5094 0.05% 91 5834 0.06% 92 6737 0.07% 93 7520 0.07% 94 8438 0.08% 95 9347 0.09% 96 10068 0.10% 97 11026 0.11% 98 12202 0.12% 99 13548 0.13% 100 15558 0.15% 101 17912 0.18% 102 20400 0.20% 103 23083 0.23% 104 25159 0.25% 105 27811 0.27% 106 28444 0.28% 107 30219 0.30% 108 32400 0.32% 109 35491 0.35% 110 39331 0.39% 111 43618 0.43% 112 48538 0.48% 113 53524 0.53% 114 57754 0.57% 115 61495 0.61% 116 64740 0.64% 117 68395 0.67% 118 72593 0.71% 119 81504 0.80% 120 101182 1.00% 121 151876 1.49% 122 327118 3.22% 123 102487 1.01% 124 311005 3.06% 125 8167307 80.35% criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=3.74 fanout-score-rank=29 prefix-density=0.07 prefix-fanout=3.3 sequence=CTCCACACTTGTA criterion=fanout-score sequence-density=0.04 sequence-density-rank=18 fanout-score=397.88 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=32.6 sequence=TTCTTCTTCTTT Started job on | Feb 12 00:20:53 Started mapping on | Feb 12 00:20:53 Finished on | Feb 12 00:21:23 Mapping speed, Million of reads per hour | 2440.21 Number of input reads | 20335058 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 19096786 Uniquely mapped reads % | 93.91% Average mapped length | 122.83 Number of splices: Total | 7232790 Number of splices: Annotated (sjdb) | 7084723 Number of splices: GT/AG | 7113934 Number of splices: GC/AG | 97503 Number of splices: AT/AC | 7349 Number of splices: Non-canonical | 14004 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.02% Deletion average length | 2.31 Insertion rate per base | 0.02% Insertion average length | 1.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 447950 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 367817 % of reads mapped to too many loci | 1.81% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.06% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 790322 790322 790322 N_multimapping 447950 447950 447950 N_noFeature 855755 9889430 9947001 N_ambiguous 195440 39637 40044 UnstrandedReadsAssigned:18045591 PositiveStrandReadsAssigned:9167719 NegativeStrandReadsAssigned:9109741 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 SRR3208007 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208007-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,335,058 reads, 18,704,867 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,259 rounds 52401 SRR3208007.ke.tsv 34699 SRR3208007.se.tsv 87100 total ==> SRR3208007.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1064 40.5427 Potri.005G024800.1.v4.1 1035 936 1138 88.9021 Potri.004G059700.1.v4.1 961 862 11 0.933106 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 410.549 10.5556 Potri.016G087400.1.v4.1 270 171 679 290.348 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 348 15.2009 Potri.012G127500.1.v4.1 977 878 2678 223.029 ==> SRR3208007.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2220 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 366 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 18 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 30 SRR3208007 completed mapping pipeline successfully