Starting /dee2/code/volunteer_pipeline.sh SRR3208008 current disk space = 3051379871744 free memory = 1323183416 SRR3208008 SRAfilesize baca83a4444a3b52c0ce21d7cc2eb765 SRR3208008.sra SRR3208008.sra file validated SRR3208008 is single end SRR3208008 is conventional basespace SRR3208008 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208008_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.09325 33.0 32.0 34.0 27.0 34.0 2 32.00725 33.0 32.0 34.0 28.0 34.0 3 31.95525 33.0 32.0 34.0 28.0 34.0 4 31.80225 33.0 32.0 34.0 28.0 34.0 5 31.80375 33.0 32.0 34.0 28.0 34.0 6 35.388 38.0 36.0 38.0 29.0 38.0 7 35.91175 38.0 37.0 38.0 31.0 38.0 8 36.21425 38.0 37.0 38.0 33.0 38.0 9 36.249 38.0 37.0 38.0 33.0 38.0 10-11 36.25 38.0 37.0 38.0 33.0 38.0 12-13 36.247375000000005 38.0 37.0 38.0 33.0 38.0 14-15 36.249624999999995 38.0 37.0 38.0 33.0 38.0 16-17 36.192750000000004 38.0 37.0 38.0 33.5 38.0 18-19 36.210499999999996 38.0 37.0 38.0 32.5 38.0 20-21 36.191874999999996 38.0 37.0 38.0 33.0 38.0 22-23 36.2345 38.0 37.0 38.0 33.0 38.0 24-25 36.196625 38.0 37.0 38.0 33.0 38.0 26-27 36.11475 38.0 37.0 38.0 32.0 38.0 28-29 36.095 38.0 37.0 38.0 32.5 38.0 30-31 36.209625 38.0 37.0 38.0 33.0 38.0 32-33 36.080124999999995 38.0 37.0 38.0 32.5 38.0 34-35 36.065 38.0 37.0 38.0 32.0 38.0 36-37 36.025125 38.0 37.0 38.0 32.0 38.0 38-39 36.2395 38.0 37.0 38.0 33.0 38.0 40-41 36.28125 38.0 38.0 38.0 33.0 38.0 42-43 36.200375 38.0 37.5 38.0 33.0 38.0 44-45 36.16675 38.0 37.0 38.0 33.0 38.0 46-47 36.10625 38.0 37.0 38.0 33.0 38.0 48-49 36.016999999999996 38.0 37.0 38.0 32.5 38.0 50-51 36.165375 38.0 37.0 38.0 33.0 38.0 52-53 36.15975 38.0 37.0 38.0 33.0 38.0 54-55 36.155125 38.0 37.0 38.0 33.0 38.0 56-57 36.07325 38.0 37.0 38.0 33.0 38.0 58-59 36.1135 38.0 37.0 38.0 33.0 38.0 60-61 36.050375 38.0 37.0 38.0 32.5 38.0 62-63 36.022125 38.0 37.0 38.0 31.5 38.0 64-65 36.07075 38.0 37.0 38.0 32.0 38.0 66-67 36.214875000000006 38.0 37.0 38.0 33.5 38.0 68-69 36.198125000000005 38.0 37.0 38.0 33.0 38.0 70-71 36.141999999999996 38.0 37.0 38.0 33.0 38.0 72-73 36.0685 38.0 37.0 38.0 33.0 38.0 74-75 36.022125 38.0 37.0 38.0 33.0 38.0 76-77 35.934125 38.0 37.0 38.0 32.0 38.0 78-79 35.965625 38.0 37.0 38.0 32.0 38.0 80-81 36.176874999999995 38.0 37.0 38.0 33.5 38.0 82-83 36.045375 38.0 37.0 38.0 33.0 38.0 84-85 36.125125 38.0 37.0 38.0 33.0 38.0 86-87 35.949 38.0 37.0 38.0 32.0 38.0 88-89 35.848749999999995 38.0 37.0 38.0 31.0 38.0 90-91 35.905625 38.0 37.0 38.0 32.0 38.0 92-93 35.972875 38.0 37.0 38.0 33.0 38.0 94-95 35.8485 38.0 37.0 38.0 31.5 38.0 96-97 35.779125 38.0 37.0 38.0 31.0 38.0 98-99 35.786625 38.0 37.0 38.0 31.0 38.0 100-101 35.6815 38.0 37.0 38.0 31.0 38.0 102-103 35.81175 38.0 37.0 38.0 31.0 38.0 104-105 35.782125 38.0 37.0 38.0 31.0 38.0 106-107 35.394 38.0 37.0 38.0 30.0 38.0 108-109 34.841750000000005 38.0 36.5 38.0 27.5 38.0 110-111 34.852999999999994 38.0 36.0 38.0 28.0 38.0 112-113 34.692625 38.0 36.5 38.0 26.5 38.0 114-115 34.78175 38.0 36.5 38.0 26.5 38.0 116-117 35.092749999999995 38.0 36.0 38.0 28.0 38.0 118-119 35.23975 38.0 36.0 38.0 29.0 38.0 120-121 35.039125 38.0 36.0 38.0 28.5 38.0 122-123 34.964 38.0 36.0 38.0 28.5 38.0 124-125 33.324875000000006 37.5 33.5 38.0 22.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 3.0 14 0.0 15 1.0 16 1.0 17 0.0 18 2.0 19 3.0 20 1.0 21 5.0 22 4.0 23 9.0 24 15.0 25 23.0 26 31.0 27 30.0 28 44.0 29 63.0 30 88.0 31 127.0 32 132.0 33 180.0 34 265.0 35 332.0 36 540.0 37 2095.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.48993288590604 14.894166236448116 13.293753226639133 48.322147651006716 2 19.125 22.625 39.2 19.05 3 20.150000000000002 27.200000000000003 28.000000000000004 24.65 4 24.275 31.35 22.075 22.3 5 25.2 34.725 22.650000000000002 17.424999999999997 6 19.275000000000002 37.875 22.95 19.900000000000002 7 16.900000000000002 19.950000000000003 42.975 20.175 8 19.075 23.825 30.275000000000002 26.825 9 20.125 23.825 32.125 23.925 10-11 22.5875 32.8625 22.8125 21.7375 12-13 20.275000000000002 27.05 29.799999999999997 22.875 14-15 21.325 27.487499999999997 28.999999999999996 22.1875 16-17 21.987499999999997 27.9375 27.925 22.15 18-19 21.6 27.950000000000003 28.4 22.05 20-21 22.025 28.1625 27.537499999999998 22.275 22-23 21.087500000000002 27.6875 28.1875 23.0375 24-25 20.849999999999998 28.849999999999998 27.6875 22.6125 26-27 21.0375 28.775000000000002 28.925 21.2625 28-29 22.8875 28.1875 28.000000000000004 20.925 30-31 21.05 28.95 27.575 22.425 32-33 22.2125 28.3625 27.5125 21.912499999999998 34-35 22.55 28.349999999999998 27.925 21.175 36-37 21.2625 28.712500000000002 28.1125 21.912499999999998 38-39 21.462500000000002 29.2375 27.750000000000004 21.55 40-41 21.975 29.262500000000003 28.15 20.6125 42-43 20.7125 29.125 27.950000000000003 22.2125 44-45 21.8 28.625 27.6125 21.9625 46-47 22.3375 28.349999999999998 28.012500000000003 21.3 48-49 21.6625 28.849999999999998 27.6 21.8875 50-51 21.762500000000003 28.212500000000002 28.975 21.05 52-53 22.05 28.6125 27.950000000000003 21.3875 54-55 21.462500000000002 28.3375 28.9875 21.212500000000002 56-57 21.025 28.749999999999996 28.8375 21.3875 58-59 22.45 28.625 27.3625 21.5625 60-61 21.987499999999997 27.450000000000003 28.275 22.287499999999998 62-63 21.512500000000003 27.875 28.675 21.9375 64-65 22.0625 28.762500000000003 27.737499999999997 21.4375 66-67 23.2375 28.012500000000003 27.987499999999997 20.7625 68-69 21.725 28.299999999999997 28.075 21.9 70-71 22.1875 28.575 27.5875 21.65 72-73 21.65 28.749999999999996 28.037499999999998 21.5625 74-75 21.1875 29.2375 28.050000000000004 21.525 76-77 22.2625 28.025 27.525 22.1875 78-79 21.6 27.8375 28.749999999999996 21.8125 80-81 21.4375 28.537499999999998 28.5875 21.4375 82-83 23.325000000000003 28.499999999999996 27.5125 20.6625 84-85 21.0625 27.950000000000003 28.7375 22.25 86-87 21.9375 28.249999999999996 28.625 21.1875 88-89 22.15 28.749999999999996 27.737499999999997 21.3625 90-91 22.037499999999998 27.950000000000003 28.1 21.912499999999998 92-93 21.912499999999998 28.3625 28.3375 21.3875 94-95 22.1 28.0875 28.299999999999997 21.512500000000003 96-97 21.987499999999997 28.050000000000004 27.950000000000003 22.0125 98-99 22.3375 28.549999999999997 28.025 21.087500000000002 100-101 22.075 28.762500000000003 27.6375 21.525 102-103 22.375 28.225 27.425 21.975 104-105 22.25 27.8375 28.15 21.762500000000003 106-107 22.63722397476341 28.41640378548896 28.138801261829656 20.80757097791798 108-109 22.10984509025733 28.715913455383436 27.56369222890795 21.610549225451287 110-111 22.34422880490296 28.281409601634323 27.872829417773236 21.501532175689476 112-113 22.90596094552929 29.44501541623844 26.631551901336074 21.017471736896198 114-115 22.403051493960586 28.963763509218055 27.844882390336934 20.788302606484425 116-117 23.238286647406103 29.179751287526695 25.913829920864213 21.66813214420299 118-119 23.549999999999997 29.2375 26.200000000000003 21.0125 120-121 22.7 30.425 25.662499999999998 21.212500000000002 122-123 23.849999999999998 28.525 26.087500000000002 21.5375 124-125 23.2125 29.825000000000003 26.187500000000004 20.775 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 1.0 23 2.0 24 1.0 25 1.0 26 2.0 27 5.0 28 10.5 29 14.5 30 17.0 31 21.0 32 26.0 33 42.5 34 76.0 35 96.5 36 105.0 37 125.0 38 147.0 39 175.5 40 218.0 41 250.5 42 265.5 43 276.0 44 273.5 45 254.0 46 245.5 47 227.0 48 201.5 49 183.0 50 159.5 51 128.0 52 101.0 53 85.5 54 64.5 55 50.0 56 37.5 57 24.0 58 13.0 59 12.0 60 14.5 61 9.5 62 5.0 63 3.5 64 2.0 65 2.5 66 4.0 67 4.0 68 2.5 69 1.5 70 1.0 71 1.5 72 2.0 73 1.0 74 1.0 75 1.0 76 0.5 77 0.5 78 1.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.9375 108-109 2.3625 110-111 2.1 112-113 2.7 114-115 1.6875 116-117 0.4875 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.0625 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.0875 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.5625 0.0 0.0 0.0 0.0 106-107 2.25 0.0 0.0 0.0 0.0 108-109 3.0250000000000004 0.0 0.0 0.0 0.0 110-111 3.7625 0.0 0.0 0.0 0.0 112-113 4.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1067914 spots for SRR3208008.sra Written 1067914 spots for SRR3208008.sra Read 1067914 spots for SRR3208008.sra Written 1067914 spots for SRR3208008.sra Read 1067914 spots for SRR3208008.sra Written 1067914 spots for SRR3208008.sra Read 1067914 spots for SRR3208008.sra Written 1067914 spots for SRR3208008.sra Read 1067914 spots for SRR3208008.sra Written 1067914 spots for SRR3208008.sra Read 1067914 spots for SRR3208008.sra Written 1067914 spots for SRR3208008.sra Read 1067914 spots for SRR3208008.sra Written 1067914 spots for SRR3208008.sra Read 1067914 spots for SRR3208008.sra Written 1067914 spots for SRR3208008.sra Read 1067914 spots for SRR3208008.sra Written 1067914 spots for SRR3208008.sra Read 1067914 spots for SRR3208008.sra Written 1067914 spots for SRR3208008.sra Read 1067914 spots for SRR3208008.sra Written 1067914 spots for SRR3208008.sra Read 1067914 spots for SRR3208008.sra Written 1067914 spots for SRR3208008.sra Read 1067914 spots for SRR3208008.sra Written 1067914 spots for SRR3208008.sra Read 1067914 spots for SRR3208008.sra Written 1067914 spots for SRR3208008.sra Read 1067914 spots for SRR3208008.sra Written 1067914 spots for SRR3208008.sra Read 1067914 spots for SRR3208008.sra Written 1067914 spots for SRR3208008.sra Read 1067914 spots for SRR3208008.sra Written 1067914 spots for SRR3208008.sra Read 1067927 spots for SRR3208008.sra Written 1067927 spots for SRR3208008.sra Read 1067914 spots for SRR3208008.sra Written 1067914 spots for SRR3208008.sra Read 1067914 spots for SRR3208008.sra Written 1067914 spots for SRR3208008.sra SRR ids: ['SRR3208008.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__rf5qjvo SRR3208008.sra spots: 21358293 blocks: [[1, 1067914], [1067915, 2135828], [2135829, 3203742], [3203743, 4271656], [4271657, 5339570], [5339571, 6407484], [6407485, 7475398], [7475399, 8543312], [8543313, 9611226], [9611227, 10679140], [10679141, 11747054], [11747055, 12814968], [12814969, 13882882], [13882883, 14950796], [14950797, 16018710], [16018711, 17086624], [17086625, 18154538], [18154539, 19222452], [19222453, 20290366], [20290367, 21358293]] SRR3208008 file size 6841009 SRR3208008 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208008 SRR3208008_1.fastq Input file: SRR3208008_1.fastq trimmed: SRR3208008-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 00:26:46 2025 >> started Wed Feb 12 00:26:57 2025 >> done (11.616s) 21358293 reads processed; of these: 10337 ( 0.05%) short reads filtered out after trimming by size control 57034 ( 0.27%) empty reads filtered out after trimming by size control 21290922 (99.68%) reads available; of these: 1718410 ( 8.07%) trimmed reads available after processing 19572512 (91.93%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 490 0.00% 19 545 0.00% 20 1404 0.01% 21 498 0.00% 22 539 0.00% 23 718 0.00% 24 3010 0.01% 25 3169 0.01% 26 725 0.00% 27 474 0.00% 28 573 0.00% 29 717 0.00% 30 927 0.00% 31 821 0.00% 32 864 0.00% 33 484 0.00% 34 449 0.00% 35 504 0.00% 36 567 0.00% 37 560 0.00% 38 577 0.00% 39 555 0.00% 40 548 0.00% 41 523 0.00% 42 562 0.00% 43 626 0.00% 44 596 0.00% 45 596 0.00% 46 574 0.00% 47 667 0.00% 48 672 0.00% 49 686 0.00% 50 747 0.00% 51 754 0.00% 52 706 0.00% 53 845 0.00% 54 810 0.00% 55 866 0.00% 56 895 0.00% 57 949 0.00% 58 981 0.00% 59 1083 0.01% 60 1100 0.01% 61 1220 0.01% 62 1228 0.01% 63 1319 0.01% 64 1300 0.01% 65 1465 0.01% 66 1498 0.01% 67 1485 0.01% 68 1642 0.01% 69 1787 0.01% 70 1933 0.01% 71 2062 0.01% 72 2204 0.01% 73 2465 0.01% 74 2654 0.01% 75 2979 0.01% 76 3291 0.02% 77 3329 0.02% 78 3587 0.02% 79 3882 0.02% 80 4491 0.02% 81 4908 0.02% 82 5509 0.03% 83 6332 0.03% 84 6724 0.03% 85 7556 0.04% 86 8099 0.04% 87 8868 0.04% 88 10001 0.05% 89 11485 0.05% 90 13120 0.06% 91 15231 0.07% 92 17367 0.08% 93 19100 0.09% 94 2924 0.01% 95 3204 0.02% 96 3234 0.02% 97 3235 0.02% 98 3305 0.02% 99 3404 0.02% 100 3825 0.02% 101 4059 0.02% 102 4437 0.02% 103 4759 0.02% 104 5225 0.02% 105 6460 0.03% 106 6141 0.03% 107 6435 0.03% 108 7003 0.03% 109 7801 0.04% 110 8886 0.04% 111 10024 0.05% 112 11213 0.05% 113 12594 0.06% 114 14898 0.07% 115 17860 0.08% 116 21150 0.10% 117 26658 0.13% 118 33495 0.16% 119 42381 0.20% 120 56141 0.26% 121 80204 0.38% 122 124437 0.58% 123 236575 1.11% 124 731366 3.44% 125 19572512 91.93% 21290922 reads passed initial QC criterion=sequence-density sequence-density=4.31 sequence-density-rank=1 fanout-score=47.78 fanout-score-rank=1 prefix-density=5.81 prefix-fanout=35.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=4.31 sequence-density-rank=1 fanout-score=47.78 fanout-score-rank=1 prefix-density=5.81 prefix-fanout=35.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR3208008 - Input file: STDIN trimmed: SRR3208008-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 00:27:50 2025 >> started Wed Feb 12 00:28:06 2025 >> done (15.381s) 12774553 reads processed; of these: 263 ( 0.00%) short reads filtered out after trimming by size control 959 ( 0.01%) empty reads filtered out after trimming by size control 12773331 (99.99%) reads available; of these: 1719580 (13.46%) trimmed reads available after processing 11053751 (86.54%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 300 0.00% 19 364 0.00% 20 1748 0.01% 21 347 0.00% 22 351 0.00% 23 443 0.00% 24 1817 0.01% 25 1926 0.02% 26 450 0.00% 27 283 0.00% 28 346 0.00% 29 431 0.00% 30 546 0.00% 31 483 0.00% 32 514 0.00% 33 316 0.00% 34 285 0.00% 35 290 0.00% 36 345 0.00% 37 345 0.00% 38 362 0.00% 39 338 0.00% 40 341 0.00% 41 329 0.00% 42 327 0.00% 43 381 0.00% 44 354 0.00% 45 353 0.00% 46 372 0.00% 47 419 0.00% 48 420 0.00% 49 422 0.00% 50 446 0.00% 51 480 0.00% 52 450 0.00% 53 521 0.00% 54 494 0.00% 55 556 0.00% 56 550 0.00% 57 580 0.00% 58 601 0.00% 59 664 0.01% 60 663 0.01% 61 750 0.01% 62 740 0.01% 63 813 0.01% 64 736 0.01% 65 818 0.01% 66 870 0.01% 67 878 0.01% 68 964 0.01% 69 1107 0.01% 70 1184 0.01% 71 1235 0.01% 72 1303 0.01% 73 1481 0.01% 74 1471 0.01% 75 1679 0.01% 76 1767 0.01% 77 1942 0.02% 78 2151 0.02% 79 2329 0.02% 80 2680 0.02% 81 2944 0.02% 82 3264 0.03% 83 3808 0.03% 84 4081 0.03% 85 4552 0.04% 86 4956 0.04% 87 5305 0.04% 88 5989 0.05% 89 6904 0.05% 90 7810 0.06% 91 8913 0.07% 92 10309 0.08% 93 11411 0.09% 94 12966 0.10% 95 14496 0.11% 96 15242 0.12% 97 17107 0.13% 98 18695 0.15% 99 21202 0.17% 100 23642 0.19% 101 26712 0.21% 102 30404 0.24% 103 33972 0.27% 104 36695 0.29% 105 40130 0.31% 106 42000 0.33% 107 44074 0.35% 108 46902 0.37% 109 51117 0.40% 110 56189 0.44% 111 60910 0.48% 112 67121 0.53% 113 72922 0.57% 114 78337 0.61% 115 82756 0.65% 116 86422 0.68% 117 90602 0.71% 118 96573 0.76% 119 107166 0.84% 120 130026 1.02% 121 191972 1.50% 122 407869 3.19% 123 121314 0.95% 124 373939 2.93% 125 10144360 79.42% criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=4.99 fanout-score-rank=20 prefix-density=0.10 prefix-fanout=3.2 sequence=TTCAACCAAGCGCG criterion=fanout-score sequence-density=0.05 sequence-density-rank=14 fanout-score=315.69 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=30.6 sequence=TTCTTCTTCTTT Started job on | Feb 12 00:28:38 Started mapping on | Feb 12 00:28:38 Finished on | Feb 12 00:29:12 Mapping speed, Million of reads per hour | 2254.20 Number of input reads | 21289700 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 19903301 Uniquely mapped reads % | 93.49% Average mapped length | 122.62 Number of splices: Total | 7427510 Number of splices: Annotated (sjdb) | 7283243 Number of splices: GT/AG | 7313437 Number of splices: GC/AG | 92861 Number of splices: AT/AC | 7453 Number of splices: Non-canonical | 13759 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.02% Deletion average length | 2.21 Insertion rate per base | 0.02% Insertion average length | 1.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 415801 % of reads mapped to multiple loci | 1.95% Number of reads mapped to too many loci | 640968 % of reads mapped to too many loci | 3.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.52% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 970598 970598 970598 N_multimapping 415801 415801 415801 N_noFeature 872034 10321631 10311804 N_ambiguous 215854 37120 37258 UnstrandedReadsAssigned:18815413 PositiveStrandReadsAssigned:9544550 NegativeStrandReadsAssigned:9554239 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208008 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208008-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,289,700 reads, 19,696,501 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52401 SRR3208008.ke.tsv 34699 SRR3208008.se.tsv 87100 total ==> SRR3208008.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 718 26.816 Potri.005G024800.1.v4.1 1035 936 229 17.5349 Potri.004G059700.1.v4.1 961 862 20 1.6629 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 296.277 7.46642 Potri.016G087400.1.v4.1 270 171 790.434 331.294 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 94.131 4.03015 Potri.012G127500.1.v4.1 977 878 3561 290.685 ==> SRR3208008.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2637 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 481 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 24 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 6 SRR3208008 completed mapping pipeline successfully