Starting /dee2/code/volunteer_pipeline.sh SRR3208009 current disk space = 3051222687744 free memory = 1538047452 SRR3208009 SRAfilesize 64b35b3154cc4906425bf850286f959d SRR3208009.sra SRR3208009.sra file validated SRR3208009 is single end SRR3208009 is conventional basespace SRR3208009 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208009_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.53075 33.0 33.0 33.0 33.0 33.0 2 32.2785 33.0 33.0 33.0 33.0 33.0 3 32.371 33.0 33.0 33.0 33.0 33.0 4 32.39725 33.0 33.0 33.0 33.0 33.0 5 32.42525 33.0 33.0 33.0 33.0 33.0 6 36.08825 37.0 37.0 37.0 37.0 37.0 7 36.257 37.0 37.0 37.0 37.0 37.0 8 36.2695 37.0 37.0 37.0 37.0 37.0 9 36.29725 37.0 37.0 37.0 37.0 37.0 10-11 36.310874999999996 37.0 37.0 37.0 37.0 37.0 12-13 36.304 37.0 37.0 37.0 37.0 37.0 14-15 36.287000000000006 37.0 37.0 37.0 37.0 37.0 16-17 36.285624999999996 37.0 37.0 37.0 37.0 37.0 18-19 36.41475 37.0 37.0 37.0 37.0 37.0 20-21 36.37025 37.0 37.0 37.0 37.0 37.0 22-23 36.299875 37.0 37.0 37.0 37.0 37.0 24-25 36.3155 37.0 37.0 37.0 37.0 37.0 26-27 36.313625 37.0 37.0 37.0 37.0 37.0 28-29 36.274375 37.0 37.0 37.0 37.0 37.0 30-31 36.289375 37.0 37.0 37.0 37.0 37.0 32-33 36.264875 37.0 37.0 37.0 37.0 37.0 34-35 36.30225 37.0 37.0 37.0 37.0 37.0 36-37 36.322625 37.0 37.0 37.0 37.0 37.0 38-39 36.29575 37.0 37.0 37.0 37.0 37.0 40-41 36.274625 37.0 37.0 37.0 37.0 37.0 42-43 36.302875 37.0 37.0 37.0 37.0 37.0 44-45 36.291375 37.0 37.0 37.0 37.0 37.0 46-47 36.326375 37.0 37.0 37.0 37.0 37.0 48-49 36.3545 37.0 37.0 37.0 37.0 37.0 50-51 36.325374999999994 37.0 37.0 37.0 37.0 37.0 52-53 36.30525 37.0 37.0 37.0 37.0 37.0 54-55 36.34475 37.0 37.0 37.0 37.0 37.0 56-57 36.333124999999995 37.0 37.0 37.0 37.0 37.0 58-59 36.35 37.0 37.0 37.0 37.0 37.0 60-61 36.253375000000005 37.0 37.0 37.0 37.0 37.0 62-63 36.27875 37.0 37.0 37.0 37.0 37.0 64-65 36.25725 37.0 37.0 37.0 37.0 37.0 66-67 36.24725 37.0 37.0 37.0 37.0 37.0 68-69 36.28125 37.0 37.0 37.0 37.0 37.0 70-71 36.309 37.0 37.0 37.0 37.0 37.0 72-73 36.21625 37.0 37.0 37.0 37.0 37.0 74-75 36.171375 37.0 37.0 37.0 37.0 37.0 76-77 36.171499999999995 37.0 37.0 37.0 37.0 37.0 78-79 36.1515 37.0 37.0 37.0 37.0 37.0 80-81 36.121875 37.0 37.0 37.0 37.0 37.0 82-83 36.163875000000004 37.0 37.0 37.0 37.0 37.0 84-85 36.13225 37.0 37.0 37.0 37.0 37.0 86-87 36.190125 37.0 37.0 37.0 37.0 37.0 88-89 36.22075 37.0 37.0 37.0 37.0 37.0 90-91 36.224875 37.0 37.0 37.0 37.0 37.0 92-93 36.15475 37.0 37.0 37.0 37.0 37.0 94-95 36.112375 37.0 37.0 37.0 37.0 37.0 96-97 36.136875 37.0 37.0 37.0 37.0 37.0 98-99 36.059124999999995 37.0 37.0 37.0 37.0 37.0 100-101 36.1105 37.0 37.0 37.0 37.0 37.0 102-103 36.072375 37.0 37.0 37.0 37.0 37.0 104-105 36.051 37.0 37.0 37.0 37.0 37.0 106-107 35.980999999999995 37.0 37.0 37.0 37.0 37.0 108-109 35.991 37.0 37.0 37.0 37.0 37.0 110-111 35.9585 37.0 37.0 37.0 37.0 37.0 112-113 35.925250000000005 37.0 37.0 37.0 37.0 37.0 114-115 35.9 37.0 37.0 37.0 37.0 37.0 116-117 35.804 37.0 37.0 37.0 37.0 37.0 118-119 35.832750000000004 37.0 37.0 37.0 37.0 37.0 120-121 35.761250000000004 37.0 37.0 37.0 37.0 37.0 122-123 35.656625 37.0 37.0 37.0 37.0 37.0 124-125 34.327875 37.0 35.0 37.0 32.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 2.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 2.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 3.0 17 0.0 18 0.0 19 4.0 20 0.0 21 2.0 22 4.0 23 3.0 24 5.0 25 4.0 26 12.0 27 12.0 28 13.0 29 25.0 30 23.0 31 36.0 32 48.0 33 68.0 34 97.0 35 209.0 36 3407.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.2214523992815 15.832691814216062 11.957916345907108 50.98793944059533 2 16.975 21.425 41.925000000000004 19.675 3 19.400000000000002 25.650000000000002 28.7 26.25 4 24.625 30.375000000000004 20.674999999999997 24.325 5 25.825 34.625 22.225 17.325 6 19.5 37.475 24.4 18.625 7 16.7 19.175 43.075 21.05 8 18.275 23.625 31.95 26.150000000000002 9 19.675 23.400000000000002 32.375 24.55 10-11 22.575 33.537499999999994 23.175 20.7125 12-13 19.6 26.924999999999997 30.5125 22.9625 14-15 21.2 28.249999999999996 28.3625 22.1875 16-17 21.675 28.462500000000002 26.775 23.0875 18-19 21.837500000000002 29.175 27.037499999999998 21.95 20-21 21.275 28.050000000000004 28.199999999999996 22.475 22-23 22.0 27.85 28.000000000000004 22.15 24-25 21.349999999999998 28.812500000000004 27.6125 22.225 26-27 21.512500000000003 27.6 28.712500000000002 22.175 28-29 22.475 27.975 27.3875 22.162499999999998 30-31 21.1875 28.775000000000002 28.3875 21.65 32-33 21.7 27.825 27.9375 22.537499999999998 34-35 21.25 28.749999999999996 28.1125 21.8875 36-37 20.5375 28.4125 27.875 23.175 38-39 21.25 28.275 28.6625 21.8125 40-41 21.912499999999998 29.4 26.937499999999996 21.75 42-43 21.2875 27.962500000000002 28.212500000000002 22.537499999999998 44-45 21.4375 29.325000000000003 27.2625 21.975 46-47 21.725 28.787499999999998 27.4125 22.075 48-49 21.1625 28.212500000000002 27.400000000000002 23.225 50-51 22.4375 28.4 27.537499999999998 21.625 52-53 21.9 28.925 27.275 21.9 54-55 21.712500000000002 28.9375 27.1375 22.2125 56-57 22.3 27.962500000000002 27.712500000000002 22.025 58-59 22.3125 27.5875 28.799999999999997 21.3 60-61 22.3625 28.575 27.025 22.037499999999998 62-63 21.625 27.6 28.962500000000002 21.8125 64-65 21.527690961370173 28.328541067633456 28.253531691461433 21.890236279534943 66-67 21.6875 28.3125 26.474999999999998 23.525 68-69 21.342835708927232 28.19454863715929 28.68217054263566 21.780445111277817 70-71 21.462500000000002 27.800000000000004 28.65 22.0875 72-73 21.65270658832354 28.6160770096262 27.903487935992 21.827728466058257 74-75 21.825 28.237499999999997 28.037499999999998 21.9 76-77 22.615326915864483 28.79109888736092 26.453306663332913 22.14026753344168 78-79 22.938305593793018 26.61744462520335 27.706169440620698 22.73808034038293 80-81 22.298735445098288 28.346062351320896 27.63240265431326 21.72279954926756 82-83 22.508763144717076 28.85578367551327 26.71507260891337 21.920380570856285 84-85 21.093456774677843 27.43650694357563 28.650068810208936 22.819967471537595 86-87 22.075 27.800000000000004 28.499999999999996 21.625 88-89 21.587500000000002 28.15 27.950000000000003 22.3125 90-91 22.22777847230904 27.765970746343292 27.54094261782723 22.46530816352044 92-93 22.3 28.65 28.287499999999998 20.7625 94-95 22.7625 27.4125 27.8625 21.9625 96-97 21.85 27.737499999999997 28.6875 21.725 98-99 22.6125 28.025 28.15 21.212500000000002 100-101 21.837500000000002 28.9 28.849999999999998 20.4125 102-103 22.8625 27.775 27.037499999999998 22.325 104-105 22.575397321987236 28.044049555750217 28.181704417469653 21.19884870479289 106-107 22.2806358743272 27.65051946426336 27.98848416572788 22.08036049568156 108-109 21.916437327995997 28.48386289717288 27.89592194145609 21.70377783337503 110-111 23.19909954977489 28.68934467233617 26.988494247123562 21.123061530765384 112-113 22.9375 28.075 27.0875 21.9 114-115 22.372372372372375 29.567067067067065 27.077077077077078 20.983483483483482 116-117 22.384884884884883 28.303303303303302 27.52752752752753 21.784284284284283 118-119 23.382960090078818 28.012010509195544 27.073689478293506 21.531339922432128 120-121 23.19039879984998 28.766095761970245 26.553319164895612 21.49018627328416 122-123 23.97748592870544 28.955597248280174 25.95372107567229 21.11319574734209 124-125 22.57135703555333 29.44416624937406 25.88883324987481 22.0956434651978 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 1.0 22 1.5 23 1.5 24 3.0 25 4.0 26 5.5 27 6.0 28 11.5 29 13.0 30 19.5 31 33.0 32 39.0 33 47.5 34 55.5 35 77.5 36 102.5 37 117.0 38 126.0 39 151.0 40 195.0 41 242.0 42 264.0 43 258.5 44 249.0 45 258.0 46 275.5 47 249.0 48 209.0 49 175.0 50 157.0 51 148.0 52 114.0 53 79.0 54 58.5 55 45.5 56 40.0 57 36.5 58 28.5 59 21.5 60 18.0 61 12.5 62 7.5 63 4.5 64 5.5 65 7.5 66 4.0 67 2.5 68 4.5 69 4.0 70 1.5 71 0.5 72 0.5 73 1.0 74 1.5 75 1.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5749999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0125 66-67 0.0 68-69 0.025 70-71 0.0 72-73 0.0125 74-75 0.0 76-77 0.0125 78-79 0.11249999999999999 80-81 0.1625 82-83 0.15 84-85 0.08750000000000001 86-87 0.0 88-89 0.0 90-91 0.0125 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.11249999999999999 106-107 0.13749999999999998 108-109 0.075 110-111 0.05 112-113 0.0 114-115 0.1 116-117 0.1 118-119 0.08750000000000001 120-121 0.0125 122-123 0.0625 124-125 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.3875 0.0 0.0 0.0 0.0 104-105 1.725 0.0 0.0 0.0 0.0 106-107 2.175 0.0 0.0 0.0 0.0 108-109 2.6375 0.0 0.0 0.0 0.0 110-111 3.075 0.0 0.0 0.0 0.0 112-113 3.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCAAC 15 0.0040863203 59.49375 94-95 >>END_MODULE Read 1253638 spots for SRR3208009.sra Written 1253638 spots for SRR3208009.sra Read 1253638 spots for SRR3208009.sra Written 1253638 spots for SRR3208009.sra Read 1253638 spots for SRR3208009.sra Written 1253638 spots for SRR3208009.sra Read 1253638 spots for SRR3208009.sra Written 1253638 spots for SRR3208009.sra Read 1253638 spots for SRR3208009.sra Written 1253638 spots for SRR3208009.sra Read 1253638 spots for SRR3208009.sra Written 1253638 spots for SRR3208009.sra Read 1253638 spots for SRR3208009.sra Written 1253638 spots for SRR3208009.sra Read 1253638 spots for SRR3208009.sra Written 1253638 spots for SRR3208009.sra Read 1253638 spots for SRR3208009.sra Written 1253638 spots for SRR3208009.sra Read 1253638 spots for SRR3208009.sra Written 1253638 spots for SRR3208009.sra Read 1253638 spots for SRR3208009.sra Written 1253638 spots for SRR3208009.sra Read 1253638 spots for SRR3208009.sra Written 1253638 spots for SRR3208009.sra Read 1253638 spots for SRR3208009.sra Written 1253638 spots for SRR3208009.sra Read 1253638 spots for SRR3208009.sra Written 1253638 spots for SRR3208009.sra Read 1253638 spots for SRR3208009.sra Written 1253638 spots for SRR3208009.sra Read 1253638 spots for SRR3208009.sra Written 1253638 spots for SRR3208009.sra Read 1253638 spots for SRR3208009.sra Written 1253638 spots for SRR3208009.sra Read 1253638 spots for SRR3208009.sra Written 1253638 spots for SRR3208009.sra Read 1253638 spots for SRR3208009.sra Written 1253638 spots for SRR3208009.sra Read 1253638 spots for SRR3208009.sra Written 1253638 spots for SRR3208009.sra SRR ids: ['SRR3208009.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o11fbgh4 SRR3208009.sra spots: 25072760 blocks: [[1, 1253638], [1253639, 2507276], [2507277, 3760914], [3760915, 5014552], [5014553, 6268190], [6268191, 7521828], [7521829, 8775466], [8775467, 10029104], [10029105, 11282742], [11282743, 12536380], [12536381, 13790018], [13790019, 15043656], [15043657, 16297294], [16297295, 17550932], [17550933, 18804570], [18804571, 20058208], [20058209, 21311846], [21311847, 22565484], [22565485, 23819122], [23819123, 25072760]] SRR3208009 file size 8032390 SRR3208009 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208009 SRR3208009_1.fastq Input file: SRR3208009_1.fastq trimmed: SRR3208009-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 00:49:27 2025 >> started Wed Feb 12 00:49:47 2025 >> done (19.778s) 25072760 reads processed; of these: 25149 ( 0.10%) short reads filtered out after trimming by size control 76963 ( 0.31%) empty reads filtered out after trimming by size control 24970648 (99.59%) reads available; of these: 2598327 (10.41%) trimmed reads available after processing 22372321 (89.59%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 905 0.00% 19 807 0.00% 20 957 0.00% 21 912 0.00% 22 1024 0.00% 23 1080 0.00% 24 1229 0.00% 25 1465 0.01% 26 1439 0.01% 27 1364 0.01% 28 1430 0.01% 29 1426 0.01% 30 1929 0.01% 31 1581 0.01% 32 1319 0.01% 33 1249 0.01% 34 1246 0.00% 35 1294 0.01% 36 1376 0.01% 37 1281 0.01% 38 1277 0.01% 39 1305 0.01% 40 1338 0.01% 41 1394 0.01% 42 1410 0.01% 43 1385 0.01% 44 1386 0.01% 45 1372 0.01% 46 1483 0.01% 47 1380 0.01% 48 1514 0.01% 49 1454 0.01% 50 1519 0.01% 51 1541 0.01% 52 1533 0.01% 53 1672 0.01% 54 1590 0.01% 55 1676 0.01% 56 1704 0.01% 57 1771 0.01% 58 1860 0.01% 59 1907 0.01% 60 2078 0.01% 61 2104 0.01% 62 2768 0.01% 63 2101 0.01% 64 2434 0.01% 65 2218 0.01% 66 2243 0.01% 67 2688 0.01% 68 2378 0.01% 69 2680 0.01% 70 2701 0.01% 71 2830 0.01% 72 3019 0.01% 73 3419 0.01% 74 3368 0.01% 75 3357 0.01% 76 3614 0.01% 77 3836 0.02% 78 4261 0.02% 79 4756 0.02% 80 5264 0.02% 81 5555 0.02% 82 6340 0.03% 83 7008 0.03% 84 7573 0.03% 85 8105 0.03% 86 8813 0.04% 87 9757 0.04% 88 11043 0.04% 89 12484 0.05% 90 14268 0.06% 91 16445 0.07% 92 18599 0.07% 93 20955 0.08% 94 3453 0.01% 95 3707 0.01% 96 3891 0.02% 97 4654 0.02% 98 4314 0.02% 99 4519 0.02% 100 5043 0.02% 101 5135 0.02% 102 5740 0.02% 103 8068 0.03% 104 6042 0.02% 105 6115 0.02% 106 6499 0.03% 107 7016 0.03% 108 7658 0.03% 109 8735 0.03% 110 9328 0.04% 111 10397 0.04% 112 11653 0.05% 113 13423 0.05% 114 15363 0.06% 115 18032 0.07% 116 22234 0.09% 117 24889 0.10% 118 31125 0.12% 119 40412 0.16% 120 54873 0.22% 121 76792 0.31% 122 127373 0.51% 123 274009 1.10% 124 1507989 6.04% 125 22372321 89.59% 24970648 reads passed initial QC criterion=sequence-density sequence-density=4.07 sequence-density-rank=1 fanout-score=45.53 fanout-score-rank=1 prefix-density=5.56 prefix-fanout=33.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTGAAA criterion=fanout-score sequence-density=4.07 sequence-density-rank=1 fanout-score=45.53 fanout-score-rank=1 prefix-density=5.56 prefix-fanout=33.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTGAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTGAAA -o SRR3208009 - Input file: STDIN trimmed: SRR3208009-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 00:50:48 2025 >> started Wed Feb 12 00:51:07 2025 >> done (19.393s) 14982389 reads processed; of these: 194 ( 0.00%) short reads filtered out after trimming by size control 394 ( 0.00%) empty reads filtered out after trimming by size control 14981801 (100.00%) reads available; of these: 1918770 (12.81%) trimmed reads available after processing 13063031 (87.19%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 553 0.00% 19 504 0.00% 20 557 0.00% 21 547 0.00% 22 593 0.00% 23 649 0.00% 24 741 0.00% 25 870 0.01% 26 859 0.01% 27 826 0.01% 28 842 0.01% 29 852 0.01% 30 1200 0.01% 31 947 0.01% 32 784 0.01% 33 738 0.00% 34 767 0.01% 35 758 0.01% 36 821 0.01% 37 783 0.01% 38 739 0.00% 39 775 0.01% 40 815 0.01% 41 848 0.01% 42 881 0.01% 43 836 0.01% 44 808 0.01% 45 817 0.01% 46 896 0.01% 47 826 0.01% 48 922 0.01% 49 837 0.01% 50 916 0.01% 51 929 0.01% 52 935 0.01% 53 985 0.01% 54 947 0.01% 55 1038 0.01% 56 1024 0.01% 57 1114 0.01% 58 1090 0.01% 59 1172 0.01% 60 1241 0.01% 61 1301 0.01% 62 1654 0.01% 63 1252 0.01% 64 1485 0.01% 65 1321 0.01% 66 1361 0.01% 67 1622 0.01% 68 1424 0.01% 69 1605 0.01% 70 1632 0.01% 71 1666 0.01% 72 1827 0.01% 73 1929 0.01% 74 1950 0.01% 75 1996 0.01% 76 2201 0.01% 77 2314 0.02% 78 2542 0.02% 79 2919 0.02% 80 3213 0.02% 81 3361 0.02% 82 3784 0.03% 83 4261 0.03% 84 4541 0.03% 85 4876 0.03% 86 5295 0.04% 87 5993 0.04% 88 6678 0.04% 89 7617 0.05% 90 8510 0.06% 91 9761 0.07% 92 11137 0.07% 93 12569 0.08% 94 13971 0.09% 95 15706 0.10% 96 16818 0.11% 97 18772 0.13% 98 20401 0.14% 99 22719 0.15% 100 26291 0.18% 101 29330 0.20% 102 33486 0.22% 103 38482 0.26% 104 40484 0.27% 105 43350 0.29% 106 45277 0.30% 107 48088 0.32% 108 51587 0.34% 109 56550 0.38% 110 61078 0.41% 111 67496 0.45% 112 73830 0.49% 113 81123 0.54% 114 86904 0.58% 115 91727 0.61% 116 95760 0.64% 117 99544 0.66% 118 105474 0.70% 119 116504 0.78% 120 145765 0.97% 121 215807 1.44% 122 458387 3.06% 123 148488 0.99% 124 817775 5.46% 125 11632648 77.65% criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=37 prefix-density=0.06 prefix-fanout=2.0 sequence=CAGTTGGGCACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=227.25 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=15.6 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC Started job on | Feb 12 00:51:36 Started mapping on | Feb 12 00:51:36 Finished on | Feb 12 00:52:14 Mapping speed, Million of reads per hour | 2365.58 Number of input reads | 24970060 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 23193360 Uniquely mapped reads % | 92.88% Average mapped length | 122.63 Number of splices: Total | 8532677 Number of splices: Annotated (sjdb) | 8367324 Number of splices: GT/AG | 8400702 Number of splices: GC/AG | 107277 Number of splices: AT/AC | 8947 Number of splices: Non-canonical | 15751 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.17 Insertion rate per base | 0.02% Insertion average length | 1.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 493987 % of reads mapped to multiple loci | 1.98% Number of reads mapped to too many loci | 727039 % of reads mapped to too many loci | 2.91% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.22% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1282713 1282713 1282713 N_multimapping 493987 493987 493987 N_noFeature 984603 12000032 12008486 N_ambiguous 252781 41341 42462 UnstrandedReadsAssigned:21955976 PositiveStrandReadsAssigned:11151987 NegativeStrandReadsAssigned:11142412 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208009 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208009-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,970,060 reads, 23,028,241 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,254 rounds 52401 SRR3208009.ke.tsv 34699 SRR3208009.se.tsv 87100 total ==> SRR3208009.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 657 20.8199 Potri.005G024800.1.v4.1 1035 936 122 7.92633 Potri.004G059700.1.v4.1 961 862 31 2.18697 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 354.177 7.57319 Potri.016G087400.1.v4.1 270 171 1155 410.747 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 92 3.34211 Potri.012G127500.1.v4.1 977 878 3686 255.299 ==> SRR3208009.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2748 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 432 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR3208009 completed mapping pipeline successfully