Starting /dee2/code/volunteer_pipeline.sh SRR3208010 current disk space = 3051349340160 free memory = 1453069100 SRR3208010 SRAfilesize 09329c169eaebdb0e362d6aa2e0b9454 SRR3208010.sra SRR3208010.sra file validated SRR3208010 is single end SRR3208010 is conventional basespace SRR3208010 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208010_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9505 33.0 33.0 33.0 33.0 33.0 2 32.3285 33.0 33.0 33.0 33.0 33.0 3 32.427 33.0 33.0 33.0 33.0 33.0 4 32.45125 33.0 33.0 33.0 33.0 33.0 5 32.542 33.0 33.0 33.0 33.0 33.0 6 36.12975 37.0 37.0 37.0 37.0 37.0 7 36.297 37.0 37.0 37.0 37.0 37.0 8 36.31725 37.0 37.0 37.0 37.0 37.0 9 36.34825 37.0 37.0 37.0 37.0 37.0 10-11 36.35325 37.0 37.0 37.0 37.0 37.0 12-13 36.38275 37.0 37.0 37.0 37.0 37.0 14-15 36.362 37.0 37.0 37.0 37.0 37.0 16-17 36.326499999999996 37.0 37.0 37.0 37.0 37.0 18-19 36.35675 37.0 37.0 37.0 37.0 37.0 20-21 36.3035 37.0 37.0 37.0 37.0 37.0 22-23 36.297625 37.0 37.0 37.0 37.0 37.0 24-25 36.358875 37.0 37.0 37.0 37.0 37.0 26-27 36.300875000000005 37.0 37.0 37.0 37.0 37.0 28-29 36.291125 37.0 37.0 37.0 37.0 37.0 30-31 36.312375 37.0 37.0 37.0 37.0 37.0 32-33 36.289625 37.0 37.0 37.0 37.0 37.0 34-35 36.319874999999996 37.0 37.0 37.0 37.0 37.0 36-37 36.267375 37.0 37.0 37.0 37.0 37.0 38-39 36.288875000000004 37.0 37.0 37.0 37.0 37.0 40-41 36.303875 37.0 37.0 37.0 37.0 37.0 42-43 36.33075 37.0 37.0 37.0 37.0 37.0 44-45 36.348 37.0 37.0 37.0 37.0 37.0 46-47 36.319374999999994 37.0 37.0 37.0 37.0 37.0 48-49 36.274625 37.0 37.0 37.0 37.0 37.0 50-51 36.30525 37.0 37.0 37.0 37.0 37.0 52-53 36.34625 37.0 37.0 37.0 37.0 37.0 54-55 36.365 37.0 37.0 37.0 37.0 37.0 56-57 36.344375 37.0 37.0 37.0 37.0 37.0 58-59 36.251125 37.0 37.0 37.0 37.0 37.0 60-61 36.22725 37.0 37.0 37.0 37.0 37.0 62-63 36.268249999999995 37.0 37.0 37.0 37.0 37.0 64-65 36.20325 37.0 37.0 37.0 37.0 37.0 66-67 36.219875 37.0 37.0 37.0 37.0 37.0 68-69 36.177375 37.0 37.0 37.0 37.0 37.0 70-71 36.2305 37.0 37.0 37.0 37.0 37.0 72-73 36.245125 37.0 37.0 37.0 37.0 37.0 74-75 36.0385 37.0 37.0 37.0 37.0 37.0 76-77 36.019125 37.0 37.0 37.0 37.0 37.0 78-79 36.042625 37.0 37.0 37.0 37.0 37.0 80-81 35.975125000000006 37.0 37.0 37.0 37.0 37.0 82-83 35.998625000000004 37.0 37.0 37.0 37.0 37.0 84-85 36.017625 37.0 37.0 37.0 37.0 37.0 86-87 36.100625 37.0 37.0 37.0 37.0 37.0 88-89 36.057500000000005 37.0 37.0 37.0 37.0 37.0 90-91 36.04025 37.0 37.0 37.0 37.0 37.0 92-93 36.028875 37.0 37.0 37.0 37.0 37.0 94-95 36.003875 37.0 37.0 37.0 37.0 37.0 96-97 35.959625 37.0 37.0 37.0 37.0 37.0 98-99 35.951125000000005 37.0 37.0 37.0 37.0 37.0 100-101 35.975375 37.0 37.0 37.0 37.0 37.0 102-103 35.953375 37.0 37.0 37.0 37.0 37.0 104-105 35.95225 37.0 37.0 37.0 37.0 37.0 106-107 35.929125 37.0 37.0 37.0 37.0 37.0 108-109 35.969750000000005 37.0 37.0 37.0 37.0 37.0 110-111 35.791875000000005 37.0 37.0 37.0 37.0 37.0 112-113 35.792500000000004 37.0 37.0 37.0 37.0 37.0 114-115 35.807500000000005 37.0 37.0 37.0 37.0 37.0 116-117 35.792874999999995 37.0 37.0 37.0 37.0 37.0 118-119 35.789375 37.0 37.0 37.0 37.0 37.0 120-121 35.768625 37.0 37.0 37.0 37.0 37.0 122-123 35.64375 37.0 37.0 37.0 37.0 37.0 124-125 34.44 37.0 37.0 37.0 32.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 2.0 4 2.0 5 0.0 6 1.0 7 1.0 8 1.0 9 1.0 10 0.0 11 2.0 12 0.0 13 1.0 14 1.0 15 0.0 16 3.0 17 1.0 18 2.0 19 0.0 20 2.0 21 6.0 22 15.0 23 5.0 24 2.0 25 7.0 26 6.0 27 12.0 28 10.0 29 20.0 30 21.0 31 37.0 32 44.0 33 60.0 34 88.0 35 214.0 36 3416.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.832952526021835 14.800710840314801 12.033511043412034 51.33282559025133 2 17.90447611902976 20.655163790947736 41.76044011002751 19.679919979995 3 20.8 24.85 28.125 26.224999999999998 4 24.85 29.7 20.5 24.95 5 25.5 33.95 22.75 17.8 6 19.35 37.35 23.400000000000002 19.900000000000002 7 17.224999999999998 19.875 43.05 19.85 8 19.900000000000002 23.025000000000002 29.175 27.900000000000002 9 19.925 22.775000000000002 32.725 24.575 10-11 21.75 33.4625 23.625 21.1625 12-13 21.4375 26.1625 29.2 23.200000000000003 14-15 21.425 27.9125 27.987499999999997 22.675 16-17 22.6125 27.712500000000002 26.8 22.875 18-19 20.849999999999998 27.400000000000002 28.8875 22.8625 20-21 22.25 28.225 27.9375 21.587500000000002 22-23 21.0125 27.987499999999997 28.1375 22.8625 24-25 21.825 28.15 28.3625 21.6625 26-27 21.099999999999998 28.487499999999997 27.400000000000002 23.0125 28-29 21.375 28.6625 27.3625 22.6 30-31 22.4625 27.3125 27.375 22.85 32-33 21.349999999999998 28.037499999999998 27.825 22.787499999999998 34-35 22.225 28.212500000000002 27.075 22.4875 36-37 21.2375 28.6625 26.974999999999998 23.125 38-39 21.4 27.875 28.5875 22.1375 40-41 22.025 27.8375 28.1125 22.025 42-43 20.8875 27.975 28.125 23.0125 44-45 22.0125 27.487499999999997 27.8875 22.6125 46-47 21.6125 28.625 27.212500000000002 22.55 48-49 21.3 28.237499999999997 27.8375 22.625 50-51 21.5375 28.875 27.5125 22.075 52-53 22.0875 28.1625 26.974999999999998 22.775000000000002 54-55 21.825 27.800000000000004 27.875 22.5 56-57 21.4375 28.287499999999998 28.012500000000003 22.2625 58-59 22.175 27.8625 28.5875 21.375 60-61 21.525 27.800000000000004 27.400000000000002 23.275000000000002 62-63 21.7875 28.3375 28.037499999999998 21.837500000000002 64-65 22.05 29.175 27.250000000000004 21.525 66-67 21.625 29.325000000000003 27.6875 21.3625 68-69 21.705426356589147 28.119529882470616 28.032008002000502 22.143035758939735 70-71 21.2625 28.4125 28.175 22.15 72-73 21.8304576144036 28.532133033258315 27.85696424106027 21.780445111277817 74-75 21.6875 29.825000000000003 27.224999999999998 21.2625 76-77 21.525 28.4375 27.762500000000003 22.275 78-79 21.778834125594194 27.5331498623968 28.13360020015011 22.554415811858895 80-81 21.84958077837567 27.74371167563509 28.206732574145914 22.19997497184332 82-83 22.290362953692114 28.67334167709637 27.334167709637047 21.70212765957447 84-85 22.091568676507382 27.745809357017766 28.05854390793095 22.10407805854391 86-87 21.675 28.625 28.1125 21.587500000000002 88-89 22.325 28.625 27.8625 21.1875 90-91 21.637500000000003 28.050000000000004 28.050000000000004 22.2625 92-93 21.762500000000003 28.299999999999997 28.249999999999996 21.6875 94-95 22.875 27.500000000000004 27.787499999999998 21.837500000000002 96-97 22.15 28.1375 27.224999999999998 22.4875 98-99 22.4625 28.375 27.9375 21.224999999999998 100-101 23.1625 26.974999999999998 27.425 22.4375 102-103 22.25 28.0625 27.762500000000003 21.925 104-105 22.21944201176029 28.449893656949833 27.398974102339547 21.93169022895033 106-107 22.585085085085087 28.265765765765767 28.128128128128125 21.02102102102102 108-109 23.411705852926463 27.388694347173587 27.176088044022013 22.02351175587794 110-111 23.258722020757787 27.547830436413655 27.672877328998375 21.520570213830187 112-113 22.625 28.6125 27.325 21.4375 114-115 22.404303227420566 28.071053289967473 27.24543407555667 22.27920940705529 116-117 23.095208307268862 29.288127111222316 26.21043412986363 21.40623045164519 118-119 23.14235676757568 28.221165874405806 27.50813109832374 21.128346259694773 120-121 23.7125 28.3625 26.8125 21.1125 122-123 23.574287143571787 28.8144072036018 26.18809404702351 21.4232116058029 124-125 23.028785982478098 29.46182728410513 25.894868585732166 21.614518147684606 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 2.0 23 2.0 24 0.5 25 1.0 26 2.5 27 7.5 28 11.5 29 15.5 30 25.5 31 28.0 32 25.5 33 36.5 34 63.0 35 80.5 36 90.0 37 116.5 38 143.0 39 167.0 40 180.0 41 211.0 42 259.0 43 262.0 44 255.5 45 266.5 46 266.5 47 233.0 48 215.5 49 210.5 50 166.0 51 123.5 52 106.0 53 93.5 54 77.0 55 55.5 56 36.5 57 28.5 58 21.5 59 18.0 60 14.0 61 8.0 62 9.5 63 11.0 64 7.5 65 5.5 66 4.5 67 3.5 68 4.0 69 4.5 70 4.5 71 4.0 72 3.0 73 2.5 74 2.5 75 1.5 76 2.0 77 2.5 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.525 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.025 70-71 0.0 72-73 0.025 74-75 0.0 76-77 0.0 78-79 0.075 80-81 0.11249999999999999 82-83 0.125 84-85 0.075 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.08750000000000001 106-107 0.1 108-109 0.05 110-111 0.0375 112-113 0.0 114-115 0.075 116-117 0.08750000000000001 118-119 0.075 120-121 0.0 122-123 0.05 124-125 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34243803743044 98.2 2 0.6069802731411229 1.2 3 0.025290844714213456 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025290844714213456 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC 21 0.525 TruSeq Adapter, Index 4 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.36250000000000004 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.6000000000000001 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.9625 0.0 0.0 0.0 0.0 100-101 1.1375000000000002 0.0 0.0 0.0 0.0 102-103 1.3875 0.0 0.0 0.0 0.0 104-105 1.9 0.0 0.0 0.0 0.0 106-107 2.425 0.0 0.0 0.0 0.0 108-109 2.8125 0.0 0.0 0.0 0.0 110-111 3.2875 0.0 0.0 0.0 0.0 112-113 4.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 795034 spots for SRR3208010.sra Written 795034 spots for SRR3208010.sra Read 795034 spots for SRR3208010.sra Written 795034 spots for SRR3208010.sra Read 795034 spots for SRR3208010.sra Written 795034 spots for SRR3208010.sra Read 795034 spots for SRR3208010.sra Written 795034 spots for SRR3208010.sra Read 795034 spots for SRR3208010.sra Written 795034 spots for SRR3208010.sra Read 795034 spots for SRR3208010.sra Written 795034 spots for SRR3208010.sra Read 795034 spots for SRR3208010.sra Written 795034 spots for SRR3208010.sra Read 795034 spots for SRR3208010.sra Written 795034 spots for SRR3208010.sra Read 795034 spots for SRR3208010.sra Written 795034 spots for SRR3208010.sra Read 795034 spots for SRR3208010.sra Written 795034 spots for SRR3208010.sra Read 795034 spots for SRR3208010.sra Written 795034 spots for SRR3208010.sra Read 795034 spots for SRR3208010.sra Written 795034 spots for SRR3208010.sra Read 795034 spots for SRR3208010.sra Written 795034 spots for SRR3208010.sra Read 795034 spots for SRR3208010.sra Read 795034 spots for SRR3208010.sra Written 795034 spots for SRR3208010.sra Written 795034 spots for SRR3208010.sra Read 795041 spots for SRR3208010.sra Written 795041 spots for SRR3208010.sra Read 795034 spots for SRR3208010.sra Written 795034 spots for SRR3208010.sra Read 795034 spots for SRR3208010.sra Written 795034 spots for SRR3208010.sra Read 795034 spots for SRR3208010.sra Written 795034 spots for SRR3208010.sra Read 795034 spots for SRR3208010.sra Written 795034 spots for SRR3208010.sra SRR ids: ['SRR3208010.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u8ae4l56 SRR3208010.sra spots: 15900687 blocks: [[1, 795034], [795035, 1590068], [1590069, 2385102], [2385103, 3180136], [3180137, 3975170], [3975171, 4770204], [4770205, 5565238], [5565239, 6360272], [6360273, 7155306], [7155307, 7950340], [7950341, 8745374], [8745375, 9540408], [9540409, 10335442], [10335443, 11130476], [11130477, 11925510], [11925511, 12720544], [12720545, 13515578], [13515579, 14310612], [14310613, 15105646], [15105647, 15900687]] SRR3208010 file size 5090021 SRR3208010 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208010 SRR3208010_1.fastq Input file: SRR3208010_1.fastq trimmed: SRR3208010-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 00:43:42 2025 >> started Wed Feb 12 00:43:51 2025 >> done (9.482s) 15900687 reads processed; of these: 19144 ( 0.12%) short reads filtered out after trimming by size control 132059 ( 0.83%) empty reads filtered out after trimming by size control 15749484 (99.05%) reads available; of these: 1619260 (10.28%) trimmed reads available after processing 14130224 (89.72%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 708 0.00% 19 755 0.00% 20 4562 0.03% 21 778 0.00% 22 778 0.00% 23 971 0.01% 24 1082 0.01% 25 1038 0.01% 26 1180 0.01% 27 884 0.01% 28 962 0.01% 29 1197 0.01% 30 1514 0.01% 31 1460 0.01% 32 953 0.01% 33 859 0.01% 34 893 0.01% 35 872 0.01% 36 918 0.01% 37 934 0.01% 38 961 0.01% 39 886 0.01% 40 904 0.01% 41 912 0.01% 42 990 0.01% 43 1007 0.01% 44 916 0.01% 45 1014 0.01% 46 928 0.01% 47 1037 0.01% 48 1011 0.01% 49 1020 0.01% 50 1054 0.01% 51 1111 0.01% 52 1050 0.01% 53 1099 0.01% 54 1154 0.01% 55 1204 0.01% 56 1278 0.01% 57 1309 0.01% 58 1343 0.01% 59 1398 0.01% 60 1461 0.01% 61 1535 0.01% 62 2353 0.01% 63 5037 0.03% 64 2127 0.01% 65 1773 0.01% 66 1686 0.01% 67 1909 0.01% 68 1769 0.01% 69 1969 0.01% 70 2034 0.01% 71 2293 0.01% 72 3235 0.02% 73 4113 0.03% 74 3472 0.02% 75 2842 0.02% 76 2600 0.02% 77 2556 0.02% 78 2901 0.02% 79 3328 0.02% 80 3485 0.02% 81 3987 0.03% 82 4479 0.03% 83 4926 0.03% 84 5537 0.04% 85 5635 0.04% 86 5961 0.04% 87 6501 0.04% 88 7567 0.05% 89 8962 0.06% 90 9536 0.06% 91 10913 0.07% 92 12516 0.08% 93 14195 0.09% 94 2432 0.02% 95 2498 0.02% 96 2485 0.02% 97 2972 0.02% 98 2646 0.02% 99 2824 0.02% 100 3138 0.02% 101 3123 0.02% 102 3568 0.02% 103 5024 0.03% 104 3718 0.02% 105 3675 0.02% 106 3944 0.03% 107 4210 0.03% 108 4714 0.03% 109 5212 0.03% 110 5769 0.04% 111 6200 0.04% 112 7064 0.04% 113 8276 0.05% 114 9226 0.06% 115 10861 0.07% 116 13485 0.09% 117 14904 0.09% 118 18651 0.12% 119 24239 0.15% 120 32933 0.21% 121 46268 0.29% 122 76330 0.48% 123 164613 1.05% 124 922181 5.86% 125 14130224 89.72% 15749484 reads passed initial QC criterion=sequence-density sequence-density=4.26 sequence-density-rank=1 fanout-score=46.72 fanout-score-rank=1 prefix-density=5.83 prefix-fanout=34.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=4.26 sequence-density-rank=1 fanout-score=46.72 fanout-score-rank=1 prefix-density=5.83 prefix-fanout=34.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR3208010 - Input file: STDIN trimmed: SRR3208010-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 00:44:40 2025 >> started Wed Feb 12 00:44:51 2025 >> done (11.075s) 9449691 reads processed; of these: 337 ( 0.00%) short reads filtered out after trimming by size control 7099 ( 0.08%) empty reads filtered out after trimming by size control 9442255 (99.92%) reads available; of these: 1245884 (13.19%) trimmed reads available after processing 8196371 (86.81%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 464 0.00% 19 437 0.00% 20 4474 0.05% 21 503 0.01% 22 500 0.01% 23 609 0.01% 24 665 0.01% 25 625 0.01% 26 843 0.01% 27 572 0.01% 28 567 0.01% 29 726 0.01% 30 893 0.01% 31 872 0.01% 32 566 0.01% 33 528 0.01% 34 545 0.01% 35 524 0.01% 36 561 0.01% 37 581 0.01% 38 620 0.01% 39 551 0.01% 40 555 0.01% 41 541 0.01% 42 593 0.01% 43 600 0.01% 44 540 0.01% 45 625 0.01% 46 578 0.01% 47 631 0.01% 48 620 0.01% 49 604 0.01% 50 645 0.01% 51 669 0.01% 52 628 0.01% 53 675 0.01% 54 702 0.01% 55 761 0.01% 56 779 0.01% 57 770 0.01% 58 806 0.01% 59 818 0.01% 60 868 0.01% 61 905 0.01% 62 1162 0.01% 63 951 0.01% 64 1098 0.01% 65 920 0.01% 66 931 0.01% 67 1113 0.01% 68 1032 0.01% 69 1137 0.01% 70 1153 0.01% 71 1197 0.01% 72 1259 0.01% 73 1260 0.01% 74 1319 0.01% 75 1406 0.01% 76 1454 0.02% 77 1496 0.02% 78 1694 0.02% 79 1932 0.02% 80 2006 0.02% 81 2250 0.02% 82 2587 0.03% 83 2816 0.03% 84 3046 0.03% 85 3300 0.03% 86 3564 0.04% 87 3950 0.04% 88 4396 0.05% 89 4960 0.05% 90 5659 0.06% 91 6303 0.07% 92 7234 0.08% 93 8350 0.09% 94 9285 0.10% 95 10174 0.11% 96 11020 0.12% 97 12116 0.13% 98 13229 0.14% 99 14675 0.16% 100 16826 0.18% 101 19091 0.20% 102 21888 0.23% 103 25262 0.27% 104 26215 0.28% 105 28199 0.30% 106 29482 0.31% 107 31055 0.33% 108 32837 0.35% 109 35841 0.38% 110 39818 0.42% 111 43428 0.46% 112 48610 0.51% 113 51993 0.55% 114 56706 0.60% 115 59618 0.63% 116 62797 0.67% 117 63785 0.68% 118 68083 0.72% 119 74866 0.79% 120 92514 0.98% 121 136446 1.45% 122 289127 3.06% 123 88859 0.94% 124 497439 5.27% 125 7315897 77.48% criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=5.90 fanout-score-rank=12 prefix-density=0.13 prefix-fanout=3.6 sequence=TTCAACCAAGCGCG criterion=fanout-score sequence-density=0.06 sequence-density-rank=6 fanout-score=79.56 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=17.6 sequence=TTCTTTCTTTCT Started job on | Feb 12 00:45:25 Started mapping on | Feb 12 00:45:26 Finished on | Feb 12 00:45:51 Mapping speed, Million of reads per hour | 2266.85 Number of input reads | 15742048 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 14498369 Uniquely mapped reads % | 92.10% Average mapped length | 122.58 Number of splices: Total | 5346924 Number of splices: Annotated (sjdb) | 5244616 Number of splices: GT/AG | 5265495 Number of splices: GC/AG | 65704 Number of splices: AT/AC | 5755 Number of splices: Non-canonical | 9970 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.14 Insertion rate per base | 0.02% Insertion average length | 1.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 326114 % of reads mapped to multiple loci | 2.07% Number of reads mapped to too many loci | 625917 % of reads mapped to too many loci | 3.98% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.84% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 917565 917565 917565 N_multimapping 326114 326114 326114 N_noFeature 579510 7473423 7493405 N_ambiguous 162243 25487 25936 UnstrandedReadsAssigned:13756616 PositiveStrandReadsAssigned:6999459 NegativeStrandReadsAssigned:6979028 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208010 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208010-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,742,048 reads, 14,594,804 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52401 SRR3208010.ke.tsv 34699 SRR3208010.se.tsv 87100 total ==> SRR3208010.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 458 22.7278 Potri.005G024800.1.v4.1 1035 936 75 7.63047 Potri.004G059700.1.v4.1 961 862 27 2.98279 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 224.044 7.50186 Potri.016G087400.1.v4.1 270 171 761 423.794 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 37.4004 2.12758 Potri.012G127500.1.v4.1 977 878 1834 198.916 ==> SRR3208010.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1592 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 330 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 33 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3208010 completed mapping pipeline successfully