Starting /dee2/code/volunteer_pipeline.sh SRR3208011 current disk space = 3051364851712 free memory = 1103401336 SRR3208011 SRAfilesize f00b37ef29cd13e9f924ffa5f783b64a SRR3208011.sra SRR3208011.sra file validated SRR3208011 is single end SRR3208011 is conventional basespace SRR3208011 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208011_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.56825 33.0 33.0 33.0 33.0 33.0 2 32.27425 33.0 33.0 33.0 33.0 33.0 3 32.369 33.0 33.0 33.0 33.0 33.0 4 32.492 33.0 33.0 33.0 33.0 33.0 5 32.569 33.0 33.0 33.0 33.0 33.0 6 36.23325 37.0 37.0 37.0 37.0 37.0 7 36.43175 37.0 37.0 37.0 37.0 37.0 8 36.38775 37.0 37.0 37.0 37.0 37.0 9 36.3685 37.0 37.0 37.0 37.0 37.0 10-11 36.421125 37.0 37.0 37.0 37.0 37.0 12-13 36.413 37.0 37.0 37.0 37.0 37.0 14-15 36.40325 37.0 37.0 37.0 37.0 37.0 16-17 36.309875000000005 37.0 37.0 37.0 37.0 37.0 18-19 36.422125 37.0 37.0 37.0 37.0 37.0 20-21 36.426249999999996 37.0 37.0 37.0 37.0 37.0 22-23 36.392624999999995 37.0 37.0 37.0 37.0 37.0 24-25 36.3575 37.0 37.0 37.0 37.0 37.0 26-27 36.373375 37.0 37.0 37.0 37.0 37.0 28-29 36.360625 37.0 37.0 37.0 37.0 37.0 30-31 36.435500000000005 37.0 37.0 37.0 37.0 37.0 32-33 36.37 37.0 37.0 37.0 37.0 37.0 34-35 36.387375 37.0 37.0 37.0 37.0 37.0 36-37 36.407250000000005 37.0 37.0 37.0 37.0 37.0 38-39 36.401875 37.0 37.0 37.0 37.0 37.0 40-41 36.40025 37.0 37.0 37.0 37.0 37.0 42-43 36.416875 37.0 37.0 37.0 37.0 37.0 44-45 36.47325 37.0 37.0 37.0 37.0 37.0 46-47 36.44499999999999 37.0 37.0 37.0 37.0 37.0 48-49 36.46825 37.0 37.0 37.0 37.0 37.0 50-51 36.42125 37.0 37.0 37.0 37.0 37.0 52-53 36.459125 37.0 37.0 37.0 37.0 37.0 54-55 36.424499999999995 37.0 37.0 37.0 37.0 37.0 56-57 36.453 37.0 37.0 37.0 37.0 37.0 58-59 36.380624999999995 37.0 37.0 37.0 37.0 37.0 60-61 36.386875 37.0 37.0 37.0 37.0 37.0 62-63 36.346125 37.0 37.0 37.0 37.0 37.0 64-65 36.33975 37.0 37.0 37.0 37.0 37.0 66-67 36.431125 37.0 37.0 37.0 37.0 37.0 68-69 36.33425 37.0 37.0 37.0 37.0 37.0 70-71 36.37287499999999 37.0 37.0 37.0 37.0 37.0 72-73 36.345875 37.0 37.0 37.0 37.0 37.0 74-75 36.208749999999995 37.0 37.0 37.0 37.0 37.0 76-77 36.23425 37.0 37.0 37.0 37.0 37.0 78-79 36.21575 37.0 37.0 37.0 37.0 37.0 80-81 36.246125 37.0 37.0 37.0 37.0 37.0 82-83 36.266 37.0 37.0 37.0 37.0 37.0 84-85 36.213750000000005 37.0 37.0 37.0 37.0 37.0 86-87 36.29125 37.0 37.0 37.0 37.0 37.0 88-89 36.261125 37.0 37.0 37.0 37.0 37.0 90-91 36.26475 37.0 37.0 37.0 37.0 37.0 92-93 36.24875 37.0 37.0 37.0 37.0 37.0 94-95 36.237375 37.0 37.0 37.0 37.0 37.0 96-97 36.176500000000004 37.0 37.0 37.0 37.0 37.0 98-99 36.16375 37.0 37.0 37.0 37.0 37.0 100-101 36.166250000000005 37.0 37.0 37.0 37.0 37.0 102-103 36.166125 37.0 37.0 37.0 37.0 37.0 104-105 36.175125 37.0 37.0 37.0 37.0 37.0 106-107 36.177 37.0 37.0 37.0 37.0 37.0 108-109 36.161 37.0 37.0 37.0 37.0 37.0 110-111 36.116875 37.0 37.0 37.0 37.0 37.0 112-113 36.081375 37.0 37.0 37.0 37.0 37.0 114-115 36.014875 37.0 37.0 37.0 37.0 37.0 116-117 36.067 37.0 37.0 37.0 37.0 37.0 118-119 36.02375000000001 37.0 37.0 37.0 37.0 37.0 120-121 35.970375000000004 37.0 37.0 37.0 37.0 37.0 122-123 35.8965 37.0 37.0 37.0 37.0 37.0 124-125 34.647375 37.0 37.0 37.0 32.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 2.0 9 0.0 10 1.0 11 1.0 12 0.0 13 1.0 14 0.0 15 0.0 16 2.0 17 2.0 18 0.0 19 0.0 20 0.0 21 4.0 22 4.0 23 1.0 24 3.0 25 7.0 26 6.0 27 15.0 28 12.0 29 17.0 30 29.0 31 26.0 32 43.0 33 64.0 34 119.0 35 227.0 36 3403.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.45055227331107 14.17929617261752 12.124325712817878 51.245825841253534 2 18.413810357768327 21.065799349512133 41.7813360020015 18.739054290718038 3 21.55 24.65 27.375 26.424999999999997 4 25.374999999999996 29.975 21.0 23.65 5 24.95 34.175 22.7 18.175 6 19.575 36.1 25.525 18.8 7 17.974999999999998 19.775000000000002 42.449999999999996 19.8 8 18.5 23.025000000000002 30.925000000000004 27.55 9 20.075000000000003 23.200000000000003 32.550000000000004 24.175 10-11 22.7125 33.775 22.8625 20.65 12-13 20.3625 26.7125 28.749999999999996 24.175 14-15 21.125 28.7 28.1625 22.0125 16-17 22.5 27.500000000000004 27.9375 22.0625 18-19 22.225 28.0875 27.6875 22.0 20-21 21.762500000000003 28.9125 27.4125 21.912499999999998 22-23 22.162499999999998 28.599999999999998 28.012500000000003 21.224999999999998 24-25 20.9 28.349999999999998 27.487499999999997 23.2625 26-27 21.65 29.212500000000002 27.3375 21.8 28-29 21.0 29.525000000000002 27.1625 22.3125 30-31 22.0 28.5625 27.05 22.3875 32-33 20.9 28.812500000000004 27.675 22.6125 34-35 21.837500000000002 28.199999999999996 27.474999999999998 22.4875 36-37 22.1375 27.9375 27.925 22.0 38-39 21.987499999999997 28.9 27.187499999999996 21.925 40-41 21.337500000000002 28.6875 27.725 22.25 42-43 21.712500000000002 28.462500000000002 28.125 21.7 44-45 21.912499999999998 27.5875 28.050000000000004 22.45 46-47 22.3625 28.762500000000003 27.0 21.875 48-49 22.1375 27.975 27.675 22.2125 50-51 22.575 27.8875 28.012500000000003 21.525 52-53 22.45 27.8875 27.1375 22.525000000000002 54-55 21.512500000000003 27.800000000000004 28.1 22.5875 56-57 21.725 28.037499999999998 28.262500000000003 21.975 58-59 22.075 28.275 28.125 21.525 60-61 21.9625 27.85 27.9375 22.25 62-63 21.8125 29.125 27.8125 21.25 64-65 21.5625 27.987499999999997 28.3875 22.0625 66-67 21.6875 28.225 27.6875 22.400000000000002 68-69 21.9375 28.012500000000003 27.05 23.0 70-71 21.25 28.549999999999997 27.825 22.375 72-73 21.5625 28.787499999999998 27.537499999999998 22.112499999999997 74-75 21.75 28.037499999999998 27.8125 22.400000000000002 76-77 21.5625 28.8375 27.6375 21.9625 78-79 22.345879704889335 28.42315868450669 27.022633487557833 22.208328123046144 80-81 21.398199099549775 28.85192596298149 27.876438219109556 21.87343671835918 82-83 21.95396547410558 27.60820615461596 27.995996997748314 22.441831373530146 84-85 22.355588897224308 27.806951737934483 27.056764191047762 22.780695173793447 86-87 21.725 28.299999999999997 27.8875 22.0875 88-89 22.237499999999997 27.900000000000002 28.375 21.4875 90-91 22.7625 27.6875 27.537499999999998 22.0125 92-93 22.25 27.8125 27.075 22.8625 94-95 22.6 27.762500000000003 27.825 21.8125 96-97 22.1 28.5875 26.937499999999996 22.375 98-99 21.9375 29.0875 27.1 21.875 100-101 22.900000000000002 28.1625 27.287499999999998 21.65 102-103 23.375 27.525 27.05 22.05 104-105 21.93322495935976 28.460672752282107 27.447792922345883 22.158309366012254 106-107 22.936468234117058 28.70185092546273 26.775887943971988 21.585792896448226 108-109 22.168042010502624 29.80745186296574 27.24431107776944 20.78019504876219 110-111 23.51543942992874 28.42855356919615 26.553319164895612 21.502687835979497 112-113 22.2 29.4125 26.0 22.3875 114-115 23.143285821455365 29.41985496374094 25.131282820705174 22.305576394098527 116-117 23.10577644411103 29.43235808952238 25.968992248062015 21.492873218304574 118-119 24.121545579592347 28.74828060522696 26.39739902463424 20.732774790546454 120-121 23.325000000000003 29.25 25.5125 21.912499999999998 122-123 23.655913978494624 28.832208052013 25.268817204301076 22.2430607651913 124-125 23.4204929313149 29.751032153133995 25.29713499311898 21.531339922432128 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.5 24 2.5 25 3.0 26 4.0 27 8.0 28 10.0 29 11.0 30 19.0 31 28.0 32 35.5 33 43.5 34 65.5 35 89.5 36 104.0 37 128.5 38 142.0 39 164.0 40 195.5 41 219.0 42 243.5 43 249.5 44 251.5 45 242.5 46 237.0 47 232.5 48 213.0 49 196.0 50 163.0 51 126.5 52 101.0 53 86.5 54 69.5 55 50.5 56 44.0 57 37.5 58 30.0 59 28.0 60 28.5 61 21.5 62 12.5 63 11.0 64 8.5 65 10.0 66 10.0 67 3.0 68 2.0 69 4.0 70 3.5 71 1.5 72 0.5 73 1.0 74 1.0 75 1.0 76 1.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.675 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0375 80-81 0.05 82-83 0.075 84-85 0.025 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0375 106-107 0.05 108-109 0.025 110-111 0.0125 112-113 0.0 114-115 0.025 116-117 0.025 118-119 0.0375 120-121 0.0 122-123 0.025 124-125 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.37678975131876413 0.75 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5875 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.1875 0.0 0.0 0.0 0.0 102-103 1.6 0.0 0.0 0.0 0.0 104-105 2.0875 0.0 0.0 0.0 0.0 106-107 2.625 0.0 0.0 0.0 0.0 108-109 3.1624999999999996 0.0 0.0 0.0 0.0 110-111 3.85 0.0 0.0 0.0 0.0 112-113 4.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1525238 spots for SRR3208011.sra Written 1525238 spots for SRR3208011.sra Read 1525238 spots for SRR3208011.sra Written 1525238 spots for SRR3208011.sra Read 1525238 spots for SRR3208011.sra Written 1525238 spots for SRR3208011.sra Read 1525238 spots for SRR3208011.sra Written 1525238 spots for SRR3208011.sra Read 1525238 spots for SRR3208011.sra Written 1525238 spots for SRR3208011.sra Read 1525238 spots for SRR3208011.sra Written 1525238 spots for SRR3208011.sra Read 1525238 spots for SRR3208011.sra Written 1525238 spots for SRR3208011.sra Read 1525238 spots for SRR3208011.sra Written 1525238 spots for SRR3208011.sra Read 1525238 spots for SRR3208011.sra Written 1525238 spots for SRR3208011.sra Read 1525238 spots for SRR3208011.sra Written 1525238 spots for SRR3208011.sra Read 1525238 spots for SRR3208011.sra Written 1525238 spots for SRR3208011.sra Read 1525238 spots for SRR3208011.sra Written 1525238 spots for SRR3208011.sra Read 1525238 spots for SRR3208011.sra Written 1525238 spots for SRR3208011.sra Read 1525238 spots for SRR3208011.sra Written 1525238 spots for SRR3208011.sra Read 1525238 spots for SRR3208011.sra Written 1525238 spots for SRR3208011.sra Read 1525238 spots for SRR3208011.sra Written 1525238 spots for SRR3208011.sra Read 1525238 spots for SRR3208011.sra Written 1525238 spots for SRR3208011.sra Read 1525246 spots for SRR3208011.sra Written 1525246 spots for SRR3208011.sra Read 1525238 spots for SRR3208011.sra Written 1525238 spots for SRR3208011.sra Read 1525238 spots for SRR3208011.sra Written 1525238 spots for SRR3208011.sra SRR ids: ['SRR3208011.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pihwcetf SRR3208011.sra spots: 30504768 blocks: [[1, 1525238], [1525239, 3050476], [3050477, 4575714], [4575715, 6100952], [6100953, 7626190], [7626191, 9151428], [9151429, 10676666], [10676667, 12201904], [12201905, 13727142], [13727143, 15252380], [15252381, 16777618], [16777619, 18302856], [18302857, 19828094], [19828095, 21353332], [21353333, 22878570], [22878571, 24403808], [24403809, 25929046], [25929047, 27454284], [27454285, 28979522], [28979523, 30504768]] SRR3208011 file size 9774961 SRR3208011 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208011 SRR3208011_1.fastq Input file: SRR3208011_1.fastq trimmed: SRR3208011-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 00:33:10 2025 >> started Wed Feb 12 00:33:28 2025 >> done (18.123s) 30504768 reads processed; of these: 19208 ( 0.06%) short reads filtered out after trimming by size control 80035 ( 0.26%) empty reads filtered out after trimming by size control 30405525 (99.67%) reads available; of these: 3043865 (10.01%) trimmed reads available after processing 27361660 (89.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 710 0.00% 19 772 0.00% 20 813 0.00% 21 871 0.00% 22 978 0.00% 23 1115 0.00% 24 1308 0.00% 25 1426 0.00% 26 1490 0.00% 27 1366 0.00% 28 1487 0.00% 29 1549 0.01% 30 2168 0.01% 31 1788 0.01% 32 1512 0.00% 33 1373 0.00% 34 1388 0.00% 35 1412 0.00% 36 1441 0.00% 37 1504 0.00% 38 1418 0.00% 39 1538 0.01% 40 1464 0.00% 41 1479 0.00% 42 1545 0.01% 43 1610 0.01% 44 1604 0.01% 45 1656 0.01% 46 1588 0.01% 47 1603 0.01% 48 1605 0.01% 49 1740 0.01% 50 1661 0.01% 51 1856 0.01% 52 1761 0.01% 53 1987 0.01% 54 1869 0.01% 55 1955 0.01% 56 1869 0.01% 57 2052 0.01% 58 2112 0.01% 59 2256 0.01% 60 2258 0.01% 61 2318 0.01% 62 3192 0.01% 63 2613 0.01% 64 2906 0.01% 65 2432 0.01% 66 2477 0.01% 67 2897 0.01% 68 2743 0.01% 69 2900 0.01% 70 2988 0.01% 71 3325 0.01% 72 3426 0.01% 73 3849 0.01% 74 4132 0.01% 75 3890 0.01% 76 4079 0.01% 77 4245 0.01% 78 4676 0.02% 79 5193 0.02% 80 5642 0.02% 81 6172 0.02% 82 6979 0.02% 83 7747 0.03% 84 8270 0.03% 85 9079 0.03% 86 10023 0.03% 87 10542 0.03% 88 11912 0.04% 89 13735 0.05% 90 15744 0.05% 91 18165 0.06% 92 21000 0.07% 93 23695 0.08% 94 3784 0.01% 95 4035 0.01% 96 4304 0.01% 97 5180 0.02% 98 4704 0.02% 99 4815 0.02% 100 5496 0.02% 101 5355 0.02% 102 6415 0.02% 103 9054 0.03% 104 6874 0.02% 105 6676 0.02% 106 7280 0.02% 107 7646 0.03% 108 8542 0.03% 109 9597 0.03% 110 10461 0.03% 111 11483 0.04% 112 13057 0.04% 113 14716 0.05% 114 17475 0.06% 115 20228 0.07% 116 25185 0.08% 117 28138 0.09% 118 35332 0.12% 119 45739 0.15% 120 62686 0.21% 121 88554 0.29% 122 147302 0.48% 123 319175 1.05% 124 1804634 5.94% 125 27361660 89.99% 30405525 reads passed initial QC criterion=sequence-density sequence-density=4.08 sequence-density-rank=1 fanout-score=47.45 fanout-score-rank=1 prefix-density=5.65 prefix-fanout=34.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=4.08 sequence-density-rank=1 fanout-score=47.45 fanout-score-rank=1 prefix-density=5.65 prefix-fanout=34.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGAAAAAA -o SRR3208011 - Input file: STDIN trimmed: SRR3208011-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 00:34:42 2025 >> started Wed Feb 12 00:35:04 2025 >> done (22.071s) 18243315 reads processed; of these: 160 ( 0.00%) short reads filtered out after trimming by size control 1026 ( 0.01%) empty reads filtered out after trimming by size control 18242129 (99.99%) reads available; of these: 2378533 (13.04%) trimmed reads available after processing 15863596 (86.96%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 440 0.00% 19 482 0.00% 20 531 0.00% 21 540 0.00% 22 561 0.00% 23 652 0.00% 24 787 0.00% 25 863 0.00% 26 903 0.00% 27 840 0.00% 28 905 0.00% 29 954 0.01% 30 1355 0.01% 31 1090 0.01% 32 895 0.00% 33 819 0.00% 34 783 0.00% 35 867 0.00% 36 876 0.00% 37 915 0.01% 38 886 0.00% 39 920 0.01% 40 878 0.00% 41 898 0.00% 42 923 0.01% 43 994 0.01% 44 951 0.01% 45 1010 0.01% 46 956 0.01% 47 963 0.01% 48 943 0.01% 49 1051 0.01% 50 1014 0.01% 51 1147 0.01% 52 1054 0.01% 53 1169 0.01% 54 1090 0.01% 55 1194 0.01% 56 1110 0.01% 57 1270 0.01% 58 1261 0.01% 59 1375 0.01% 60 1356 0.01% 61 1406 0.01% 62 1958 0.01% 63 1479 0.01% 64 1712 0.01% 65 1462 0.01% 66 1478 0.01% 67 1774 0.01% 68 1644 0.01% 69 1713 0.01% 70 1824 0.01% 71 1940 0.01% 72 2015 0.01% 73 2077 0.01% 74 2169 0.01% 75 2275 0.01% 76 2413 0.01% 77 2529 0.01% 78 2779 0.02% 79 3069 0.02% 80 3372 0.02% 81 3690 0.02% 82 4193 0.02% 83 4654 0.03% 84 4925 0.03% 85 5476 0.03% 86 6078 0.03% 87 6325 0.03% 88 7141 0.04% 89 8291 0.05% 90 9417 0.05% 91 10794 0.06% 92 12389 0.07% 93 14204 0.08% 94 15975 0.09% 95 17938 0.10% 96 19330 0.11% 97 21681 0.12% 98 23704 0.13% 99 26385 0.14% 100 30235 0.17% 101 34253 0.19% 102 40032 0.22% 103 45303 0.25% 104 48120 0.26% 105 51351 0.28% 106 54566 0.30% 107 58420 0.32% 108 62704 0.34% 109 67974 0.37% 110 74763 0.41% 111 82805 0.45% 112 91851 0.50% 113 99456 0.55% 114 108013 0.59% 115 116106 0.64% 116 121907 0.67% 117 124909 0.68% 118 131877 0.72% 119 145896 0.80% 120 179772 0.99% 121 265168 1.45% 122 560530 3.07% 123 172298 0.94% 124 974625 5.34% 125 14195046 77.81% criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=3.48 fanout-score-rank=18 prefix-density=0.15 prefix-fanout=2.8 sequence=TTCAACCAAGCGCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=159.35 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=12.7 sequence=AAGAAAATTAATTTGTTCATATATATAGTTGAGATACAGAAATATGGAGGCTCCTCTTAAATTCATCGGTCTTCTGGGATTGCTTGTGCTTTTGAGTGTTGCTGGAGGGGCTGATGCTGCGGGGGAATGTGGAAAATCTTCCCCAGACAATGAAGCCATGAAGCTGGCTCCTTGTGCAGAAGCAGCACAAGATGAGAAAGCTGCTGTGTCAGACAGTTGCTGCCTTCAGGTGAAGAGAATGGGCCAGAAGCCAAGCTGTCTTTGTGCTGTAATGCTTTCAGACACTGCTAAGGCATCTGGAGTCAAGATTGAAACTGCCATTACCATCCCCAAACGTTGCAACATTGCCAACCGTCCAGTGGGATACAAGTGTGGAGGTTATACACTTCCATGATGGGATAACACATCAGAATTGAAGACCATAGCTAGCGACCATGAACTTAGAAGTACTTAAAAGCTGGTAGCTACTTCTGTAACTAGCAACTACGTAAGCTTTACTTCTCCTTC Started job on | Feb 12 00:35:39 Started mapping on | Feb 12 00:35:40 Finished on | Feb 12 00:36:29 Mapping speed, Million of reads per hour | 2233.79 Number of input reads | 30404339 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 27279678 Uniquely mapped reads % | 89.72% Average mapped length | 122.69 Number of splices: Total | 9983819 Number of splices: Annotated (sjdb) | 9737045 Number of splices: GT/AG | 9806969 Number of splices: GC/AG | 142953 Number of splices: AT/AC | 12546 Number of splices: Non-canonical | 21351 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 1.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 712903 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 1649273 % of reads mapped to too many loci | 5.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.49% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2411758 2411758 2411758 N_multimapping 712903 712903 712903 N_noFeature 1509817 14301474 14341619 N_ambiguous 264868 59231 59790 UnstrandedReadsAssigned:25504993 PositiveStrandReadsAssigned:12918973 NegativeStrandReadsAssigned:12878269 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208011 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208011-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,404,339 reads, 27,480,092 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,169 rounds 52401 SRR3208011.ke.tsv 34699 SRR3208011.se.tsv 87100 total ==> SRR3208011.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2157 53.0055 Potri.005G024800.1.v4.1 1035 936 4081 205.606 Potri.004G059700.1.v4.1 961 862 9 0.492358 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 702.474 11.6479 Potri.016G087400.1.v4.1 270 171 763 210.414 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 196 5.52136 Potri.012G127500.1.v4.1 977 878 11889 638.552 ==> SRR3208011.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1402 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 426 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 24 SRR3208011 completed mapping pipeline successfully