Starting /dee2/code/volunteer_pipeline.sh SRR3208012 current disk space = 3051264659456 free memory = 1298509196 SRR3208012 SRAfilesize 7b1096609dace479a65e266db0d1d337 SRR3208012.sra SRR3208012.sra file validated SRR3208012 is single end SRR3208012 is conventional basespace SRR3208012 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208012_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.682 33.0 33.0 33.0 33.0 33.0 2 32.35775 33.0 33.0 33.0 33.0 33.0 3 32.417 33.0 33.0 33.0 33.0 33.0 4 32.50675 33.0 33.0 33.0 33.0 33.0 5 32.5545 33.0 33.0 33.0 33.0 33.0 6 36.213 37.0 37.0 37.0 37.0 37.0 7 36.379 37.0 37.0 37.0 37.0 37.0 8 36.40075 37.0 37.0 37.0 37.0 37.0 9 36.46725 37.0 37.0 37.0 37.0 37.0 10-11 36.373875 37.0 37.0 37.0 37.0 37.0 12-13 36.4005 37.0 37.0 37.0 37.0 37.0 14-15 36.3915 37.0 37.0 37.0 37.0 37.0 16-17 36.334875 37.0 37.0 37.0 37.0 37.0 18-19 36.436875 37.0 37.0 37.0 37.0 37.0 20-21 36.399 37.0 37.0 37.0 37.0 37.0 22-23 36.393875 37.0 37.0 37.0 37.0 37.0 24-25 36.417 37.0 37.0 37.0 37.0 37.0 26-27 36.337500000000006 37.0 37.0 37.0 37.0 37.0 28-29 36.428375 37.0 37.0 37.0 37.0 37.0 30-31 36.421625 37.0 37.0 37.0 37.0 37.0 32-33 36.397625000000005 37.0 37.0 37.0 37.0 37.0 34-35 36.34625 37.0 37.0 37.0 37.0 37.0 36-37 36.35825 37.0 37.0 37.0 37.0 37.0 38-39 36.36225 37.0 37.0 37.0 37.0 37.0 40-41 36.373875 37.0 37.0 37.0 37.0 37.0 42-43 36.42875 37.0 37.0 37.0 37.0 37.0 44-45 36.411125 37.0 37.0 37.0 37.0 37.0 46-47 36.423249999999996 37.0 37.0 37.0 37.0 37.0 48-49 36.433 37.0 37.0 37.0 37.0 37.0 50-51 36.3955 37.0 37.0 37.0 37.0 37.0 52-53 36.43 37.0 37.0 37.0 37.0 37.0 54-55 36.442875 37.0 37.0 37.0 37.0 37.0 56-57 36.42425 37.0 37.0 37.0 37.0 37.0 58-59 36.427 37.0 37.0 37.0 37.0 37.0 60-61 36.45675 37.0 37.0 37.0 37.0 37.0 62-63 36.430625000000006 37.0 37.0 37.0 37.0 37.0 64-65 36.309250000000006 37.0 37.0 37.0 37.0 37.0 66-67 36.326375 37.0 37.0 37.0 37.0 37.0 68-69 36.42725 37.0 37.0 37.0 37.0 37.0 70-71 36.425 37.0 37.0 37.0 37.0 37.0 72-73 36.37712500000001 37.0 37.0 37.0 37.0 37.0 74-75 36.310375 37.0 37.0 37.0 37.0 37.0 76-77 36.260374999999996 37.0 37.0 37.0 37.0 37.0 78-79 36.243625 37.0 37.0 37.0 37.0 37.0 80-81 36.257625000000004 37.0 37.0 37.0 37.0 37.0 82-83 36.284000000000006 37.0 37.0 37.0 37.0 37.0 84-85 36.304 37.0 37.0 37.0 37.0 37.0 86-87 36.238875 37.0 37.0 37.0 37.0 37.0 88-89 36.290875 37.0 37.0 37.0 37.0 37.0 90-91 36.30175 37.0 37.0 37.0 37.0 37.0 92-93 36.285250000000005 37.0 37.0 37.0 37.0 37.0 94-95 36.273624999999996 37.0 37.0 37.0 37.0 37.0 96-97 36.201375 37.0 37.0 37.0 37.0 37.0 98-99 36.185874999999996 37.0 37.0 37.0 37.0 37.0 100-101 36.186 37.0 37.0 37.0 37.0 37.0 102-103 36.201875 37.0 37.0 37.0 37.0 37.0 104-105 36.267875000000004 37.0 37.0 37.0 37.0 37.0 106-107 36.205875 37.0 37.0 37.0 37.0 37.0 108-109 36.127750000000006 37.0 37.0 37.0 37.0 37.0 110-111 36.062749999999994 37.0 37.0 37.0 37.0 37.0 112-113 35.998125 37.0 37.0 37.0 37.0 37.0 114-115 35.979749999999996 37.0 37.0 37.0 37.0 37.0 116-117 35.961875 37.0 37.0 37.0 37.0 37.0 118-119 35.96825 37.0 37.0 37.0 37.0 37.0 120-121 35.91225 37.0 37.0 37.0 37.0 37.0 122-123 35.77275 37.0 37.0 37.0 37.0 37.0 124-125 34.509625 37.0 37.0 37.0 32.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 2.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 0.0 16 2.0 17 1.0 18 1.0 19 2.0 20 1.0 21 0.0 22 8.0 23 4.0 24 2.0 25 3.0 26 5.0 27 11.0 28 13.0 29 17.0 30 35.0 31 41.0 32 53.0 33 70.0 34 113.0 35 189.0 36 3415.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 19.448698315467077 14.67585502807555 11.306789178152119 54.56865747830526 2 17.804451112778192 20.305076269067268 42.36059014753689 19.529882470617654 3 21.025 24.575 28.199999999999996 26.200000000000003 4 24.875 30.025000000000002 19.6 25.5 5 25.45 33.6 23.225 17.724999999999998 6 21.4 34.775 23.025000000000002 20.8 7 17.325 18.275 43.45 20.95 8 18.8 23.075000000000003 31.65 26.474999999999998 9 20.0 22.625 33.074999999999996 24.3 10-11 22.1 32.925 22.6375 22.3375 12-13 20.8875 26.1 29.3875 23.625 14-15 21.4375 27.537499999999998 28.225 22.8 16-17 22.2625 27.5625 27.975 22.2 18-19 22.5625 27.187499999999996 26.8375 23.4125 20-21 23.0 27.775 26.775 22.45 22-23 20.775 28.1 27.750000000000004 23.375 24-25 21.2875 28.3125 27.150000000000002 23.25 26-27 21.762500000000003 27.462500000000002 28.025 22.75 28-29 21.425 27.737499999999997 27.250000000000004 23.5875 30-31 22.625 27.525 26.75 23.1 32-33 22.55 27.250000000000004 26.7125 23.4875 34-35 22.1375 29.299999999999997 26.787499999999998 21.775 36-37 21.4 27.825 27.950000000000003 22.825 38-39 20.8125 28.325 27.3 23.5625 40-41 22.3625 28.625 26.787499999999998 22.225 42-43 21.925 28.15 26.724999999999998 23.200000000000003 44-45 22.8125 26.3125 27.975 22.900000000000002 46-47 23.25 27.975 26.775 22.0 48-49 21.7875 27.575 27.275 23.3625 50-51 22.975 27.150000000000002 27.3125 22.5625 52-53 22.2 27.6625 27.450000000000003 22.6875 54-55 21.8625 27.3375 27.537499999999998 23.2625 56-57 21.7 27.425 27.474999999999998 23.400000000000002 58-59 22.225 28.249999999999996 27.1625 22.3625 60-61 23.150000000000002 27.1375 27.787499999999998 21.925 62-63 21.915239404925615 26.940867608451057 27.51593949243655 23.627953494186773 64-65 22.152769096137018 28.028503562945367 27.028378547318415 22.7903487935992 66-67 22.0875 28.1375 27.1125 22.662499999999998 68-69 22.211105552776388 28.451725862931465 26.538269134567283 22.798899449724864 70-71 23.1375 27.825 26.2125 22.825 72-73 22.393098274568644 26.70667666916729 28.19454863715929 22.705676419104776 74-75 22.6125 28.1625 27.212500000000002 22.0125 76-77 22.696011004126547 28.310616481180446 27.072652244591723 21.920720270101288 78-79 22.329246935201404 27.920940705529144 27.145359019264447 22.604453340005005 80-81 22.75456592444333 28.008506379784837 26.90768076057043 22.329246935201404 82-83 22.38208432378331 27.63668209683473 27.023645689978732 22.95758788940323 84-85 22.038774233896184 27.554721701063162 27.204502814258912 23.20200125078174 86-87 22.475 27.575 27.875 22.075 88-89 22.9625 28.025 27.2625 21.75 90-91 21.80545136284071 28.34458614653663 27.144286071517882 22.705676419104776 92-93 22.400000000000002 27.700000000000003 27.5625 22.3375 94-95 22.95 27.6125 27.3875 22.05 96-97 22.1 27.987499999999997 26.8625 23.05 98-99 23.140392549068633 27.315914489311165 27.428428553569194 22.115264408051004 100-101 22.787499999999998 27.700000000000003 27.1625 22.35 102-103 23.215401925240656 28.128516064508062 26.903362920365048 21.752719089886234 104-105 23.167375531648737 28.546409807355516 26.882661996497376 21.403552664498374 106-107 23.15486614961221 27.995996997748314 26.80760570427821 22.041531148361273 108-109 23.374187093546773 27.838919459729865 26.91345672836418 21.87343671835918 110-111 23.521320495185694 28.648243091159188 26.28485682130799 21.54557959234713 112-113 23.940492561570196 28.378547318414803 26.115764470558823 21.565195649456182 114-115 23.44258193645234 28.77157868401301 25.168876657493122 22.61696272204153 116-117 23.652282676672918 27.954971857410882 25.878674171357098 22.5140712945591 118-119 23.577235772357724 29.743589743589745 25.278298936835526 21.40087554721701 120-121 24.33108277069267 28.294573643410853 25.618904726181547 21.75543885971493 122-123 24.20907840440165 28.48568213079905 25.872202075778418 21.433037389020885 124-125 24.274274274274273 28.72872872872873 24.774774774774773 22.22222222222222 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 2.0 23 1.5 24 0.0 25 2.0 26 3.5 27 7.0 28 13.5 29 15.5 30 18.0 31 24.5 32 29.5 33 41.5 34 61.0 35 75.5 36 91.5 37 117.5 38 137.0 39 157.5 40 180.0 41 212.0 42 232.5 43 222.5 44 228.5 45 246.5 46 226.5 47 213.0 48 212.5 49 182.5 50 156.0 51 147.0 52 122.0 53 92.0 54 76.0 55 62.0 56 59.5 57 54.0 58 35.5 59 31.0 60 36.5 61 28.5 62 20.0 63 19.0 64 15.0 65 7.5 66 8.0 67 11.0 68 12.5 69 8.5 70 7.5 71 6.5 72 4.0 73 4.5 74 4.0 75 6.5 76 5.5 77 1.5 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0500000000000003 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0125 64-65 0.0125 66-67 0.0 68-69 0.05 70-71 0.0 72-73 0.025 74-75 0.0 76-77 0.0375 78-79 0.075 80-81 0.075 82-83 0.08750000000000001 84-85 0.0625 86-87 0.0 88-89 0.0 90-91 0.025 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0125 100-101 0.0 102-103 0.0125 104-105 0.075 106-107 0.075 108-109 0.05 110-111 0.0375 112-113 0.0125 114-115 0.075 116-117 0.0625 118-119 0.0625 120-121 0.025 122-123 0.0375 124-125 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93751581077662 97.775 2 0.9359979762205919 1.8499999999999999 3 0.12648621300278268 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.0875 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 1.1125 0.0 0.0 0.0 0.0 98-99 1.425 0.0 0.0 0.0 0.0 100-101 1.8625 0.0 0.0 0.0 0.0 102-103 2.25 0.0 0.0 0.0 0.0 104-105 2.6625 0.0 0.0 0.0 0.0 106-107 3.2125 0.0 0.0 0.0 0.0 108-109 3.8875 0.0 0.0 0.0 0.0 110-111 4.7375 0.0 0.0 0.0 0.0 112-113 5.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1149631 spots for SRR3208012.sra Written 1149631 spots for SRR3208012.sra Read 1149631 spots for SRR3208012.sra Written 1149631 spots for SRR3208012.sra Read 1149631 spots for SRR3208012.sra Written 1149631 spots for SRR3208012.sra Read 1149631 spots for SRR3208012.sra Written 1149631 spots for SRR3208012.sra Read 1149631 spots for SRR3208012.sra Written 1149631 spots for SRR3208012.sra Read 1149631 spots for SRR3208012.sra Written 1149631 spots for SRR3208012.sra Read 1149631 spots for SRR3208012.sra Written 1149631 spots for SRR3208012.sra Read 1149631 spots for SRR3208012.sra Written 1149631 spots for SRR3208012.sra Read 1149631 spots for SRR3208012.sra Written 1149631 spots for SRR3208012.sra Read 1149631 spots for SRR3208012.sra Written 1149631 spots for SRR3208012.sra Read 1149631 spots for SRR3208012.sra Written 1149631 spots for SRR3208012.sra Read 1149631 spots for SRR3208012.sra Written 1149631 spots for SRR3208012.sra Read 1149631 spots for SRR3208012.sra Written 1149631 spots for SRR3208012.sra Read 1149631 spots for SRR3208012.sra Written 1149631 spots for SRR3208012.sra Read 1149631 spots for SRR3208012.sra Written 1149631 spots for SRR3208012.sra Read 1149631 spots for SRR3208012.sra Written 1149631 spots for SRR3208012.sra Read 1149631 spots for SRR3208012.sra Written 1149631 spots for SRR3208012.sra Read 1149643 spots for SRR3208012.sra Written 1149643 spots for SRR3208012.sra Read 1149631 spots for SRR3208012.sra Written 1149631 spots for SRR3208012.sra Read 1149631 spots for SRR3208012.sra Written 1149631 spots for SRR3208012.sra SRR ids: ['SRR3208012.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rzlcpcup SRR3208012.sra spots: 22992632 blocks: [[1, 1149631], [1149632, 2299262], [2299263, 3448893], [3448894, 4598524], [4598525, 5748155], [5748156, 6897786], [6897787, 8047417], [8047418, 9197048], [9197049, 10346679], [10346680, 11496310], [11496311, 12645941], [12645942, 13795572], [13795573, 14945203], [14945204, 16094834], [16094835, 17244465], [17244466, 18394096], [18394097, 19543727], [19543728, 20693358], [20693359, 21842989], [21842990, 22992632]] SRR3208012 file size 7365096 SRR3208012 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208012 SRR3208012_1.fastq Input file: SRR3208012_1.fastq trimmed: SRR3208012-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 00:54:57 2025 >> started Wed Feb 12 00:55:09 2025 >> done (11.976s) 22992632 reads processed; of these: 20703 ( 0.09%) short reads filtered out after trimming by size control 61588 ( 0.27%) empty reads filtered out after trimming by size control 22910341 (99.64%) reads available; of these: 2359686 (10.30%) trimmed reads available after processing 20550655 (89.70%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 818 0.00% 19 751 0.00% 20 799 0.00% 21 844 0.00% 22 991 0.00% 23 991 0.00% 24 1085 0.00% 25 1273 0.01% 26 1255 0.01% 27 1188 0.01% 28 1198 0.01% 29 1296 0.01% 30 2077 0.01% 31 1678 0.01% 32 1210 0.01% 33 1096 0.00% 34 1103 0.00% 35 1082 0.00% 36 1219 0.01% 37 1188 0.01% 38 1180 0.01% 39 1184 0.01% 40 1130 0.00% 41 1164 0.01% 42 1169 0.01% 43 1293 0.01% 44 1183 0.01% 45 1223 0.01% 46 1256 0.01% 47 1217 0.01% 48 1246 0.01% 49 1409 0.01% 50 1373 0.01% 51 1366 0.01% 52 1400 0.01% 53 1462 0.01% 54 1453 0.01% 55 1485 0.01% 56 1591 0.01% 57 1592 0.01% 58 1793 0.01% 59 1758 0.01% 60 1863 0.01% 61 1954 0.01% 62 2728 0.01% 63 1960 0.01% 64 2248 0.01% 65 1899 0.01% 66 2188 0.01% 67 2474 0.01% 68 2372 0.01% 69 2629 0.01% 70 2732 0.01% 71 2981 0.01% 72 3193 0.01% 73 3619 0.02% 74 3784 0.02% 75 3704 0.02% 76 3887 0.02% 77 4257 0.02% 78 4721 0.02% 79 5233 0.02% 80 6006 0.03% 81 6884 0.03% 82 7600 0.03% 83 8468 0.04% 84 9290 0.04% 85 10047 0.04% 86 11111 0.05% 87 12006 0.05% 88 13621 0.06% 89 15278 0.07% 90 17737 0.08% 91 20569 0.09% 92 23884 0.10% 93 26419 0.12% 94 2693 0.01% 95 2873 0.01% 96 3065 0.01% 97 3798 0.02% 98 3428 0.01% 99 3503 0.02% 100 3959 0.02% 101 4042 0.02% 102 4612 0.02% 103 6696 0.03% 104 4877 0.02% 105 4762 0.02% 106 5101 0.02% 107 5584 0.02% 108 6197 0.03% 109 6756 0.03% 110 7719 0.03% 111 8379 0.04% 112 9434 0.04% 113 10743 0.05% 114 12428 0.05% 115 14887 0.06% 116 18476 0.08% 117 20373 0.09% 118 25937 0.11% 119 33806 0.15% 120 46740 0.20% 121 66747 0.29% 122 111150 0.49% 123 240573 1.05% 124 1357933 5.93% 125 20550655 89.70% 22910341 reads passed initial QC criterion=sequence-density sequence-density=5.54 sequence-density-rank=1 fanout-score=41.62 fanout-score-rank=1 prefix-density=7.45 prefix-fanout=30.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=fanout-score sequence-density=5.54 sequence-density-rank=1 fanout-score=41.62 fanout-score-rank=1 prefix-density=7.45 prefix-fanout=30.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTGAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTGAAAA -o SRR3208012 - Input file: STDIN trimmed: SRR3208012-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 00:56:01 2025 >> started Wed Feb 12 00:56:17 2025 >> done (15.943s) 15273561 reads processed; of these: 289 ( 0.00%) short reads filtered out after trimming by size control 609 ( 0.00%) empty reads filtered out after trimming by size control 15272663 (99.99%) reads available; of these: 2365892 (15.49%) trimmed reads available after processing 12906771 (84.51%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 556 0.00% 19 533 0.00% 20 566 0.00% 21 548 0.00% 22 675 0.00% 23 675 0.00% 24 728 0.00% 25 889 0.01% 26 836 0.01% 27 815 0.01% 28 742 0.00% 29 875 0.01% 30 1415 0.01% 31 1083 0.01% 32 808 0.01% 33 769 0.01% 34 704 0.00% 35 722 0.00% 36 846 0.01% 37 792 0.01% 38 791 0.01% 39 783 0.01% 40 767 0.01% 41 774 0.01% 42 794 0.01% 43 833 0.01% 44 803 0.01% 45 828 0.01% 46 837 0.01% 47 820 0.01% 48 816 0.01% 49 966 0.01% 50 894 0.01% 51 912 0.01% 52 942 0.01% 53 971 0.01% 54 946 0.01% 55 955 0.01% 56 1080 0.01% 57 1102 0.01% 58 1217 0.01% 59 1222 0.01% 60 1258 0.01% 61 1306 0.01% 62 1769 0.01% 63 1323 0.01% 64 1522 0.01% 65 1289 0.01% 66 1456 0.01% 67 1650 0.01% 68 1620 0.01% 69 1769 0.01% 70 1799 0.01% 71 1976 0.01% 72 2063 0.01% 73 2290 0.01% 74 2358 0.02% 75 2408 0.02% 76 2621 0.02% 77 2878 0.02% 78 3239 0.02% 79 3556 0.02% 80 4029 0.03% 81 4531 0.03% 82 5090 0.03% 83 5581 0.04% 84 6271 0.04% 85 6768 0.04% 86 7363 0.05% 87 7987 0.05% 88 9183 0.06% 89 10318 0.07% 90 11905 0.08% 91 13315 0.09% 92 15687 0.10% 93 17775 0.12% 94 19759 0.13% 95 21830 0.14% 96 23365 0.15% 97 25797 0.17% 98 28762 0.19% 99 31517 0.21% 100 35582 0.23% 101 39696 0.26% 102 46481 0.30% 103 51299 0.34% 104 54603 0.36% 105 57458 0.38% 106 59862 0.39% 107 63757 0.42% 108 66837 0.44% 109 71638 0.47% 110 77988 0.51% 111 85733 0.56% 112 94095 0.62% 113 101710 0.67% 114 108337 0.71% 115 113924 0.75% 116 119920 0.79% 117 120062 0.79% 118 124000 0.81% 119 136125 0.89% 120 163683 1.07% 121 227442 1.49% 122 470196 3.08% 123 141728 0.93% 124 799675 5.24% 125 11488219 75.22% criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=27 prefix-density=0.30 prefix-fanout=2.3 sequence=TTCAACCAAGCGCG criterion=fanout-score sequence-density=0.05 sequence-density-rank=16 fanout-score=230.51 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=24.7 sequence=AAGAAGAAGAAA Started job on | Feb 12 00:56:47 Started mapping on | Feb 12 00:56:47 Finished on | Feb 12 00:57:27 Mapping speed, Million of reads per hour | 2061.85 Number of input reads | 22909443 Average input read length | 122 UNIQUE READS: Uniquely mapped reads number | 18707192 Uniquely mapped reads % | 81.66% Average mapped length | 122.19 Number of splices: Total | 7125052 Number of splices: Annotated (sjdb) | 6971086 Number of splices: GT/AG | 7007149 Number of splices: GC/AG | 96180 Number of splices: AT/AC | 7461 Number of splices: Non-canonical | 14262 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.34 Insertion rate per base | 0.02% Insertion average length | 1.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 620571 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 3108153 % of reads mapped to too many loci | 13.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.03% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3581680 3581680 3581680 N_multimapping 620571 620571 620571 N_noFeature 915745 9753541 9759965 N_ambiguous 184642 37742 37814 UnstrandedReadsAssigned:17606805 PositiveStrandReadsAssigned:8915909 NegativeStrandReadsAssigned:8909413 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208012 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208012-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,909,443 reads, 20,842,762 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,217 rounds 52401 SRR3208012.ke.tsv 34699 SRR3208012.se.tsv 87100 total ==> SRR3208012.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1312 42.1098 Potri.005G024800.1.v4.1 1035 936 1709 112.458 Potri.004G059700.1.v4.1 961 862 10 0.714524 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 534.746 11.5809 Potri.016G087400.1.v4.1 270 171 749 269.78 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 402.764 14.819 Potri.012G127500.1.v4.1 977 878 4731 331.881 ==> SRR3208012.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1288 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 321 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 41 SRR3208012 completed mapping pipeline successfully