Starting /dee2/code/volunteer_pipeline.sh SRR3208013 current disk space = 3051239591936 free memory = 1479126220 SRR3208013 SRAfilesize 03e3d58d82aba6eeb90bd02390ab3a59 SRR3208013.sra SRR3208013.sra file validated SRR3208013 is single end SRR3208013 is conventional basespace SRR3208013 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208013_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.078 33.0 33.0 33.0 33.0 33.0 2 32.4785 33.0 33.0 33.0 33.0 33.0 3 32.55175 33.0 33.0 33.0 33.0 33.0 4 32.56375 33.0 33.0 33.0 33.0 33.0 5 32.611 33.0 33.0 33.0 33.0 33.0 6 36.32275 37.0 37.0 37.0 37.0 37.0 7 36.38425 37.0 37.0 37.0 37.0 37.0 8 36.48875 37.0 37.0 37.0 37.0 37.0 9 36.4325 37.0 37.0 37.0 37.0 37.0 10-11 36.441500000000005 37.0 37.0 37.0 37.0 37.0 12-13 36.448 37.0 37.0 37.0 37.0 37.0 14-15 36.44825 37.0 37.0 37.0 37.0 37.0 16-17 36.438625 37.0 37.0 37.0 37.0 37.0 18-19 36.461875 37.0 37.0 37.0 37.0 37.0 20-21 36.42075 37.0 37.0 37.0 37.0 37.0 22-23 36.45425 37.0 37.0 37.0 37.0 37.0 24-25 36.518625 37.0 37.0 37.0 37.0 37.0 26-27 36.3955 37.0 37.0 37.0 37.0 37.0 28-29 36.45425 37.0 37.0 37.0 37.0 37.0 30-31 36.424875 37.0 37.0 37.0 37.0 37.0 32-33 36.4805 37.0 37.0 37.0 37.0 37.0 34-35 36.417500000000004 37.0 37.0 37.0 37.0 37.0 36-37 36.461 37.0 37.0 37.0 37.0 37.0 38-39 36.463125000000005 37.0 37.0 37.0 37.0 37.0 40-41 36.467625 37.0 37.0 37.0 37.0 37.0 42-43 36.40875 37.0 37.0 37.0 37.0 37.0 44-45 36.421625 37.0 37.0 37.0 37.0 37.0 46-47 36.495000000000005 37.0 37.0 37.0 37.0 37.0 48-49 36.433 37.0 37.0 37.0 37.0 37.0 50-51 36.415875 37.0 37.0 37.0 37.0 37.0 52-53 36.463499999999996 37.0 37.0 37.0 37.0 37.0 54-55 36.458375000000004 37.0 37.0 37.0 37.0 37.0 56-57 36.473375000000004 37.0 37.0 37.0 37.0 37.0 58-59 36.446625 37.0 37.0 37.0 37.0 37.0 60-61 36.3725 37.0 37.0 37.0 37.0 37.0 62-63 36.406375 37.0 37.0 37.0 37.0 37.0 64-65 36.371750000000006 37.0 37.0 37.0 37.0 37.0 66-67 36.370374999999996 37.0 37.0 37.0 37.0 37.0 68-69 36.41575 37.0 37.0 37.0 37.0 37.0 70-71 36.45725 37.0 37.0 37.0 37.0 37.0 72-73 36.3925 37.0 37.0 37.0 37.0 37.0 74-75 36.289625 37.0 37.0 37.0 37.0 37.0 76-77 36.32925 37.0 37.0 37.0 37.0 37.0 78-79 36.306250000000006 37.0 37.0 37.0 37.0 37.0 80-81 36.343125 37.0 37.0 37.0 37.0 37.0 82-83 36.332125000000005 37.0 37.0 37.0 37.0 37.0 84-85 36.30575 37.0 37.0 37.0 37.0 37.0 86-87 36.3615 37.0 37.0 37.0 37.0 37.0 88-89 36.362875 37.0 37.0 37.0 37.0 37.0 90-91 36.306375 37.0 37.0 37.0 37.0 37.0 92-93 36.285624999999996 37.0 37.0 37.0 37.0 37.0 94-95 36.260875 37.0 37.0 37.0 37.0 37.0 96-97 36.260375 37.0 37.0 37.0 37.0 37.0 98-99 36.261624999999995 37.0 37.0 37.0 37.0 37.0 100-101 36.241125 37.0 37.0 37.0 37.0 37.0 102-103 36.22625 37.0 37.0 37.0 37.0 37.0 104-105 36.16875 37.0 37.0 37.0 37.0 37.0 106-107 36.20375 37.0 37.0 37.0 37.0 37.0 108-109 36.19225 37.0 37.0 37.0 37.0 37.0 110-111 36.132374999999996 37.0 37.0 37.0 37.0 37.0 112-113 36.045125 37.0 37.0 37.0 37.0 37.0 114-115 36.077875 37.0 37.0 37.0 37.0 37.0 116-117 36.053625 37.0 37.0 37.0 37.0 37.0 118-119 36.041624999999996 37.0 37.0 37.0 37.0 37.0 120-121 35.900999999999996 37.0 37.0 37.0 37.0 37.0 122-123 35.81625 37.0 37.0 37.0 37.0 37.0 124-125 34.615 37.0 37.0 37.0 32.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 2.0 10 0.0 11 0.0 12 2.0 13 1.0 14 1.0 15 0.0 16 1.0 17 0.0 18 2.0 19 0.0 20 2.0 21 4.0 22 3.0 23 3.0 24 1.0 25 2.0 26 9.0 27 8.0 28 12.0 29 19.0 30 28.0 31 35.0 32 42.0 33 68.0 34 88.0 35 219.0 36 3438.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 19.558599695585997 15.119228817858954 11.56773211567732 53.754439370877726 2 15.978994748687173 19.32983245811453 45.61140285071268 19.079769942485623 3 20.8 24.375 29.299999999999997 25.525 4 24.15 30.2 21.3 24.349999999999998 5 25.95 32.800000000000004 24.2 17.05 6 20.5 36.0 23.9 19.6 7 17.1 18.7 43.05 21.15 8 17.1 22.875 33.125 26.900000000000002 9 20.05 24.15 31.5 24.3 10-11 22.275 32.4125 24.0125 21.3 12-13 20.0875 26.6 29.7 23.6125 14-15 21.6125 26.3125 29.2375 22.8375 16-17 22.45 28.1875 27.575 21.7875 18-19 21.349999999999998 28.199999999999996 28.1625 22.287499999999998 20-21 21.675 28.237499999999997 27.175 22.912499999999998 22-23 21.0375 28.6625 28.212500000000002 22.0875 24-25 21.375 27.975 27.700000000000003 22.95 26-27 21.9 27.8625 28.4 21.837500000000002 28-29 21.925 28.075 27.8875 22.112499999999997 30-31 21.05 28.6375 27.8875 22.425 32-33 21.25 28.425 28.262500000000003 22.0625 34-35 22.5125 27.750000000000004 27.650000000000002 22.0875 36-37 20.95 28.375 27.950000000000003 22.725 38-39 21.512500000000003 28.512500000000003 27.950000000000003 22.025 40-41 21.025 27.3875 28.799999999999997 22.787499999999998 42-43 21.6875 28.499999999999996 27.55 22.2625 44-45 20.6375 28.212500000000002 28.5875 22.5625 46-47 21.099999999999998 28.125 28.1625 22.6125 48-49 21.8625 27.6625 27.950000000000003 22.525000000000002 50-51 21.2 27.987499999999997 29.049999999999997 21.762500000000003 52-53 21.625 27.9375 28.075 22.3625 54-55 21.837500000000002 27.8375 28.8375 21.4875 56-57 21.3 27.775 28.325 22.6 58-59 21.5625 27.474999999999998 28.237499999999997 22.725 60-61 21.7375 28.287499999999998 27.425 22.55 62-63 22.0625 27.400000000000002 28.8625 21.675 64-65 21.965245655706962 27.61595199399925 29.453681710213775 20.96512064008001 66-67 22.2125 27.85 28.1875 21.75 68-69 22.211105552776388 28.05152576288144 27.913956978489246 21.823411705852926 70-71 21.2375 28.462500000000002 27.987499999999997 22.3125 72-73 21.395523321245467 28.198074277854197 28.23558834562961 22.170814055270725 74-75 22.625 27.35 28.812500000000004 21.212500000000002 76-77 21.867966991747938 27.60690172543136 28.369592398099524 22.155538884721178 78-79 21.62872154115587 26.82011508631474 29.034275706780083 22.516887665749312 80-81 22.012263796771368 28.069077712426484 28.231760730822174 21.686897759979978 82-83 21.90511953936663 27.062210539491797 29.06496432594818 21.96770559519339 84-85 22.031777805579882 27.911922932565997 28.374827974477668 21.681471287376457 86-87 21.5 27.462500000000002 28.799999999999997 22.237499999999997 88-89 22.125 27.575 28.375 21.925 90-91 21.277659707463435 27.853481685210653 28.753594199274907 22.115264408051004 92-93 23.25 27.787499999999998 26.7625 22.2 94-95 21.775 28.712500000000002 27.8625 21.65 96-97 21.8625 28.3625 28.712500000000002 21.0625 98-99 22.7 28.1 27.8625 21.337500000000002 100-101 22.5875 27.650000000000002 28.325 21.4375 102-103 21.8125 28.625 27.675 21.8875 104-105 22.316737553164874 28.33375031273455 28.533900425318986 20.815611708781585 106-107 22.835335335335337 28.003003003003002 28.22822822822823 20.933433433433432 108-109 22.138836772983115 28.405253283302063 27.892432770481552 21.56347717323327 110-111 22.420907840440165 28.010503938977116 27.5728398149306 21.99574840565212 112-113 22.95 28.8375 27.287499999999998 20.925 114-115 22.59194395796848 29.422066549912433 26.444833625218916 21.541155866900176 116-117 22.51001001001001 28.72872872872873 27.677677677677675 21.083583583583586 118-119 22.945076942324533 29.087951957963217 27.27386463155261 20.693106468159638 120-121 23.730932733183295 29.057264316079017 25.906476619154787 21.305326331582897 122-123 23.59929964982491 29.689844922461226 25.3751875937969 21.335667833916958 124-125 23.103879849812266 28.02252816020025 27.246558197747184 21.6270337922403 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 2.0 25 4.5 26 6.0 27 7.5 28 9.0 29 13.5 30 21.5 31 27.5 32 29.0 33 39.0 34 54.0 35 71.5 36 93.0 37 119.0 38 142.0 39 173.5 40 216.5 41 215.0 42 227.5 43 258.0 44 250.0 45 268.5 46 295.0 47 266.0 48 206.0 49 175.0 50 166.0 51 146.5 52 121.0 53 92.5 54 69.5 55 58.5 56 43.0 57 25.0 58 17.0 59 15.0 60 13.0 61 5.5 62 4.0 63 4.5 64 4.5 65 4.5 66 3.0 67 1.5 68 1.0 69 1.5 70 1.0 71 1.5 72 1.5 73 1.5 74 1.5 75 1.5 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4500000000000002 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0125 66-67 0.0 68-69 0.05 70-71 0.0 72-73 0.0375 74-75 0.0 76-77 0.025 78-79 0.075 80-81 0.11249999999999999 82-83 0.13749999999999998 84-85 0.08750000000000001 86-87 0.0 88-89 0.0 90-91 0.0125 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.075 106-107 0.1 108-109 0.0625 110-111 0.0375 112-113 0.0 114-115 0.075 116-117 0.1 118-119 0.08750000000000001 120-121 0.025 122-123 0.05 124-125 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7743795437453 99.5 2 0.2005515166708448 0.4 3 0.0 0.0 4 0.0250689395838556 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0125 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.0625 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 1.15 0.0 0.0 0.0 0.0 100-101 1.375 0.0 0.0 0.0 0.0 102-103 1.6 0.0 0.0 0.0 0.0 104-105 2.0625 0.0125 0.0 0.0 0.0 106-107 2.6 0.025 0.0 0.0 0.0 108-109 3.1375 0.025 0.0 0.0 0.0 110-111 3.9000000000000004 0.025 0.0 0.0 0.0 112-113 4.8125 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 846009 spots for SRR3208013.sra Written 846009 spots for SRR3208013.sra Read 846009 spots for SRR3208013.sra Written 846009 spots for SRR3208013.sra Read 846009 spots for SRR3208013.sra Written 846009 spots for SRR3208013.sra Read 846009 spots for SRR3208013.sra Written 846009 spots for SRR3208013.sra Read 846009 spots for SRR3208013.sra Written 846009 spots for SRR3208013.sra Read 846009 spots for SRR3208013.sra Written 846009 spots for SRR3208013.sra Read 846009 spots for SRR3208013.sra Written 846009 spots for SRR3208013.sra Read 846009 spots for SRR3208013.sra Written 846009 spots for SRR3208013.sra Read 846009 spots for SRR3208013.sra Written 846009 spots for SRR3208013.sra Read 846009 spots for SRR3208013.sra Written 846009 spots for SRR3208013.sra Read 846009 spots for SRR3208013.sra Written 846009 spots for SRR3208013.sra Read 846009 spots for SRR3208013.sra Written 846009 spots for SRR3208013.sra Read 846009 spots for SRR3208013.sra Written 846009 spots for SRR3208013.sra Read 846009 spots for SRR3208013.sra Written 846009 spots for SRR3208013.sra Read 846009 spots for SRR3208013.sra Written 846009 spots for SRR3208013.sra Read 846009 spots for SRR3208013.sra Written 846009 spots for SRR3208013.sra Read 846009 spots for SRR3208013.sra Written 846009 spots for SRR3208013.sra Read 846015 spots for SRR3208013.sra Written 846015 spots for SRR3208013.sra Read 846009 spots for SRR3208013.sra Written 846009 spots for SRR3208013.sra Read 846009 spots for SRR3208013.sra Written 846009 spots for SRR3208013.sra SRR ids: ['SRR3208013.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hp5q6djq SRR3208013.sra spots: 16920186 blocks: [[1, 846009], [846010, 1692018], [1692019, 2538027], [2538028, 3384036], [3384037, 4230045], [4230046, 5076054], [5076055, 5922063], [5922064, 6768072], [6768073, 7614081], [7614082, 8460090], [8460091, 9306099], [9306100, 10152108], [10152109, 10998117], [10998118, 11844126], [11844127, 12690135], [12690136, 13536144], [13536145, 14382153], [14382154, 15228162], [15228163, 16074171], [16074172, 16920186]] SRR3208013 file size 5417075 SRR3208013 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208013 SRR3208013_1.fastq Input file: SRR3208013_1.fastq trimmed: SRR3208013-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 00:52:47 2025 >> started Wed Feb 12 00:52:56 2025 >> done (9.237s) 16920186 reads processed; of these: 12284 ( 0.07%) short reads filtered out after trimming by size control 45788 ( 0.27%) empty reads filtered out after trimming by size control 16862114 (99.66%) reads available; of these: 1700515 (10.08%) trimmed reads available after processing 15161599 (89.92%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 492 0.00% 19 478 0.00% 20 519 0.00% 21 566 0.00% 22 660 0.00% 23 698 0.00% 24 765 0.00% 25 934 0.01% 26 905 0.01% 27 827 0.00% 28 885 0.01% 29 960 0.01% 30 1322 0.01% 31 1154 0.01% 32 868 0.01% 33 804 0.00% 34 843 0.00% 35 841 0.00% 36 850 0.01% 37 835 0.00% 38 829 0.00% 39 814 0.00% 40 932 0.01% 41 845 0.01% 42 842 0.00% 43 886 0.01% 44 894 0.01% 45 891 0.01% 46 878 0.01% 47 958 0.01% 48 972 0.01% 49 990 0.01% 50 996 0.01% 51 1074 0.01% 52 997 0.01% 53 1014 0.01% 54 1053 0.01% 55 1132 0.01% 56 1118 0.01% 57 1208 0.01% 58 1276 0.01% 59 1332 0.01% 60 1317 0.01% 61 1419 0.01% 62 1897 0.01% 63 1488 0.01% 64 1685 0.01% 65 1463 0.01% 66 1478 0.01% 67 1772 0.01% 68 1628 0.01% 69 1716 0.01% 70 1857 0.01% 71 1823 0.01% 72 2073 0.01% 73 2361 0.01% 74 2438 0.01% 75 2366 0.01% 76 2359 0.01% 77 2551 0.02% 78 2728 0.02% 79 3053 0.02% 80 3258 0.02% 81 3765 0.02% 82 4056 0.02% 83 4600 0.03% 84 4784 0.03% 85 5198 0.03% 86 5540 0.03% 87 6136 0.04% 88 6905 0.04% 89 7845 0.05% 90 8974 0.05% 91 10046 0.06% 92 11646 0.07% 93 13118 0.08% 94 2216 0.01% 95 2350 0.01% 96 2419 0.01% 97 2982 0.02% 98 2655 0.02% 99 2880 0.02% 100 3210 0.02% 101 3264 0.02% 102 3730 0.02% 103 5077 0.03% 104 3802 0.02% 105 3867 0.02% 106 4022 0.02% 107 4386 0.03% 108 4834 0.03% 109 5361 0.03% 110 5909 0.04% 111 6523 0.04% 112 7459 0.04% 113 8457 0.05% 114 9743 0.06% 115 11427 0.07% 116 14125 0.08% 117 15886 0.09% 118 19721 0.12% 119 25692 0.15% 120 35319 0.21% 121 49587 0.29% 122 82315 0.49% 123 178310 1.06% 124 999507 5.93% 125 15161599 89.92% 16862114 reads passed initial QC criterion=sequence-density sequence-density=3.93 sequence-density-rank=1 fanout-score=42.77 fanout-score-rank=1 prefix-density=5.42 prefix-fanout=31.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=3.93 sequence-density-rank=1 fanout-score=42.77 fanout-score-rank=1 prefix-density=5.42 prefix-fanout=31.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGAAAAAAA -o SRR3208013 - Input file: STDIN trimmed: SRR3208013-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 00:54:00 2025 >> started Wed Feb 12 00:54:09 2025 >> done (8.786s) 8431057 reads processed; of these: 149 ( 0.00%) short reads filtered out after trimming by size control 578 ( 0.01%) empty reads filtered out after trimming by size control 8430330 (99.99%) reads available; of these: 1078966 (12.80%) trimmed reads available after processing 7351364 (87.20%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 246 0.00% 19 244 0.00% 20 256 0.00% 21 270 0.00% 22 342 0.00% 23 381 0.00% 24 393 0.00% 25 468 0.01% 26 445 0.01% 27 394 0.00% 28 427 0.01% 29 489 0.01% 30 693 0.01% 31 585 0.01% 32 427 0.01% 33 391 0.00% 34 445 0.01% 35 424 0.01% 36 438 0.01% 37 441 0.01% 38 405 0.00% 39 399 0.00% 40 465 0.01% 41 444 0.01% 42 449 0.01% 43 447 0.01% 44 480 0.01% 45 461 0.01% 46 420 0.00% 47 474 0.01% 48 496 0.01% 49 483 0.01% 50 508 0.01% 51 541 0.01% 52 503 0.01% 53 506 0.01% 54 525 0.01% 55 594 0.01% 56 584 0.01% 57 631 0.01% 58 647 0.01% 59 667 0.01% 60 652 0.01% 61 695 0.01% 62 966 0.01% 63 714 0.01% 64 827 0.01% 65 749 0.01% 66 745 0.01% 67 918 0.01% 68 782 0.01% 69 858 0.01% 70 888 0.01% 71 935 0.01% 72 973 0.01% 73 1033 0.01% 74 1070 0.01% 75 1100 0.01% 76 1189 0.01% 77 1267 0.02% 78 1381 0.02% 79 1519 0.02% 80 1623 0.02% 81 1860 0.02% 82 2027 0.02% 83 2278 0.03% 84 2447 0.03% 85 2635 0.03% 86 2808 0.03% 87 3110 0.04% 88 3540 0.04% 89 3979 0.05% 90 4487 0.05% 91 5015 0.06% 92 5763 0.07% 93 6626 0.08% 94 7350 0.09% 95 8168 0.10% 96 8754 0.10% 97 9821 0.12% 98 10691 0.13% 99 12016 0.14% 100 13981 0.17% 101 15406 0.18% 102 17632 0.21% 103 20242 0.24% 104 21790 0.26% 105 22821 0.27% 106 24486 0.29% 107 26221 0.31% 108 27892 0.33% 109 30343 0.36% 110 33830 0.40% 111 37067 0.44% 112 41170 0.49% 113 44572 0.53% 114 48644 0.58% 115 51622 0.61% 116 53982 0.64% 117 56224 0.67% 118 60010 0.71% 119 66379 0.79% 120 83195 0.99% 121 123744 1.47% 122 262336 3.11% 123 80807 0.96% 124 451812 5.36% 125 6570535 77.94% criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=2.58 fanout-score-rank=39 prefix-density=0.07 prefix-fanout=2.3 sequence=ACCTTGATGAGAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=11 fanout-score=224.60 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=26.5 sequence=AAGAAGAAGAAA Started job on | Feb 12 00:54:37 Started mapping on | Feb 12 00:54:37 Finished on | Feb 12 00:55:01 Mapping speed, Million of reads per hour | 2529.21 Number of input reads | 16861387 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 15895033 Uniquely mapped reads % | 94.27% Average mapped length | 122.72 Number of splices: Total | 5981709 Number of splices: Annotated (sjdb) | 5869636 Number of splices: GT/AG | 5890628 Number of splices: GC/AG | 73799 Number of splices: AT/AC | 6143 Number of splices: Non-canonical | 11139 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.13 Insertion rate per base | 0.02% Insertion average length | 1.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 328871 % of reads mapped to multiple loci | 1.95% Number of reads mapped to too many loci | 221869 % of reads mapped to too many loci | 1.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.46% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 637483 637483 637483 N_multimapping 328871 328871 328871 N_noFeature 627982 8201509 8211753 N_ambiguous 164122 27024 27662 UnstrandedReadsAssigned:15102929 PositiveStrandReadsAssigned:7666500 NegativeStrandReadsAssigned:7655618 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208013 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208013-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,861,387 reads, 15,586,946 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,243 rounds 52401 SRR3208013.ke.tsv 34699 SRR3208013.se.tsv 87100 total ==> SRR3208013.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 410 19.5891 Potri.005G024800.1.v4.1 1035 936 60 5.87736 Potri.004G059700.1.v4.1 961 862 8 0.850921 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 229.109 7.38618 Potri.016G087400.1.v4.1 270 171 853 457.362 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 46 2.51947 Potri.012G127500.1.v4.1 977 878 2408 251.46 ==> SRR3208013.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1924 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 338 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR3208013 completed mapping pipeline successfully