Starting /dee2/code/volunteer_pipeline.sh SRR3208014 current disk space = 3051238858752 free memory = 1183898012 SRR3208014 SRAfilesize 9c575dba387e56537c475e84332968a5 SRR3208014.sra SRR3208014.sra file validated SRR3208014 is single end SRR3208014 is conventional basespace SRR3208014 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208014_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.79425 33.0 33.0 33.0 33.0 33.0 2 32.30675 33.0 33.0 33.0 33.0 33.0 3 32.42475 33.0 33.0 33.0 33.0 33.0 4 32.55925 33.0 33.0 33.0 33.0 33.0 5 32.57475 33.0 33.0 33.0 33.0 33.0 6 36.19875 37.0 37.0 37.0 37.0 37.0 7 36.33975 37.0 37.0 37.0 37.0 37.0 8 36.3345 37.0 37.0 37.0 37.0 37.0 9 36.3565 37.0 37.0 37.0 37.0 37.0 10-11 36.371125000000006 37.0 37.0 37.0 37.0 37.0 12-13 36.408125 37.0 37.0 37.0 37.0 37.0 14-15 36.441625 37.0 37.0 37.0 37.0 37.0 16-17 36.377624999999995 37.0 37.0 37.0 37.0 37.0 18-19 36.39125 37.0 37.0 37.0 37.0 37.0 20-21 36.399 37.0 37.0 37.0 37.0 37.0 22-23 36.3925 37.0 37.0 37.0 37.0 37.0 24-25 36.413 37.0 37.0 37.0 37.0 37.0 26-27 36.280875 37.0 37.0 37.0 37.0 37.0 28-29 36.328625 37.0 37.0 37.0 37.0 37.0 30-31 36.368125 37.0 37.0 37.0 37.0 37.0 32-33 36.32425 37.0 37.0 37.0 37.0 37.0 34-35 36.32175 37.0 37.0 37.0 37.0 37.0 36-37 36.381 37.0 37.0 37.0 37.0 37.0 38-39 36.319625 37.0 37.0 37.0 37.0 37.0 40-41 36.360625 37.0 37.0 37.0 37.0 37.0 42-43 36.364125 37.0 37.0 37.0 37.0 37.0 44-45 36.390375 37.0 37.0 37.0 37.0 37.0 46-47 36.399874999999994 37.0 37.0 37.0 37.0 37.0 48-49 36.407375 37.0 37.0 37.0 37.0 37.0 50-51 36.382625 37.0 37.0 37.0 37.0 37.0 52-53 36.39575 37.0 37.0 37.0 37.0 37.0 54-55 36.43625 37.0 37.0 37.0 37.0 37.0 56-57 36.474625 37.0 37.0 37.0 37.0 37.0 58-59 36.344625 37.0 37.0 37.0 37.0 37.0 60-61 36.353125000000006 37.0 37.0 37.0 37.0 37.0 62-63 36.356625 37.0 37.0 37.0 37.0 37.0 64-65 36.375 37.0 37.0 37.0 37.0 37.0 66-67 36.39025 37.0 37.0 37.0 37.0 37.0 68-69 36.39925 37.0 37.0 37.0 37.0 37.0 70-71 36.36275 37.0 37.0 37.0 37.0 37.0 72-73 36.3215 37.0 37.0 37.0 37.0 37.0 74-75 36.247249999999994 37.0 37.0 37.0 37.0 37.0 76-77 36.256625 37.0 37.0 37.0 37.0 37.0 78-79 36.182625 37.0 37.0 37.0 37.0 37.0 80-81 36.227875 37.0 37.0 37.0 37.0 37.0 82-83 36.235 37.0 37.0 37.0 37.0 37.0 84-85 36.15375 37.0 37.0 37.0 37.0 37.0 86-87 36.23925 37.0 37.0 37.0 37.0 37.0 88-89 36.286500000000004 37.0 37.0 37.0 37.0 37.0 90-91 36.246875 37.0 37.0 37.0 37.0 37.0 92-93 36.24575 37.0 37.0 37.0 37.0 37.0 94-95 36.2205 37.0 37.0 37.0 37.0 37.0 96-97 36.254875 37.0 37.0 37.0 37.0 37.0 98-99 36.1575 37.0 37.0 37.0 37.0 37.0 100-101 36.135374999999996 37.0 37.0 37.0 37.0 37.0 102-103 36.199124999999995 37.0 37.0 37.0 37.0 37.0 104-105 36.175749999999994 37.0 37.0 37.0 37.0 37.0 106-107 36.107875 37.0 37.0 37.0 37.0 37.0 108-109 36.16775 37.0 37.0 37.0 37.0 37.0 110-111 36.04675 37.0 37.0 37.0 37.0 37.0 112-113 36.069625 37.0 37.0 37.0 37.0 37.0 114-115 36.000125 37.0 37.0 37.0 37.0 37.0 116-117 36.013625 37.0 37.0 37.0 37.0 37.0 118-119 36.033875 37.0 37.0 37.0 37.0 37.0 120-121 35.96275 37.0 37.0 37.0 37.0 37.0 122-123 35.812875000000005 37.0 37.0 37.0 37.0 37.0 124-125 34.541250000000005 37.0 37.0 37.0 32.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 1.0 4 1.0 5 1.0 6 2.0 7 0.0 8 1.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 3.0 17 1.0 18 1.0 19 3.0 20 0.0 21 2.0 22 4.0 23 0.0 24 5.0 25 3.0 26 6.0 27 7.0 28 18.0 29 19.0 30 20.0 31 32.0 32 42.0 33 71.0 34 88.0 35 210.0 36 3443.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.323634507401735 15.135273098519653 12.965798876978049 47.57529351710056 2 19.225 21.575 40.0 19.2 3 20.05 26.700000000000003 28.175 25.074999999999996 4 22.775000000000002 31.1 21.325 24.8 5 25.6 34.9 23.125 16.375 6 19.45 36.449999999999996 22.95 21.15 7 16.025 19.7 42.975 21.3 8 18.075 23.45 30.375000000000004 28.1 9 19.925 23.200000000000003 32.65 24.224999999999998 10-11 21.6625 32.175 23.849999999999998 22.3125 12-13 19.9625 27.3125 30.075000000000003 22.650000000000002 14-15 20.9375 27.737499999999997 28.449999999999996 22.875 16-17 22.3875 27.925 27.9375 21.75 18-19 22.537499999999998 28.050000000000004 28.15 21.2625 20-21 21.7375 28.199999999999996 27.762500000000003 22.3 22-23 21.4875 29.212500000000002 27.6625 21.637500000000003 24-25 21.925 28.712500000000002 27.35 22.0125 26-27 21.975 28.537499999999998 27.5125 21.975 28-29 21.5375 28.775000000000002 27.725 21.9625 30-31 21.85 28.3125 27.5875 22.25 32-33 22.5 28.287499999999998 27.224999999999998 21.987499999999997 34-35 21.4875 28.425 28.675 21.4125 36-37 21.7875 27.487499999999997 28.1625 22.5625 38-39 21.625 29.049999999999997 28.012500000000003 21.3125 40-41 21.1125 27.962500000000002 27.8875 23.0375 42-43 21.375 28.5625 27.3875 22.675 44-45 21.8 27.55 28.775000000000002 21.875 46-47 22.225 28.549999999999997 27.237499999999997 21.987499999999997 48-49 21.2625 28.1875 28.125 22.425 50-51 21.325 28.5625 27.6 22.5125 52-53 21.2875 28.625 27.275 22.8125 54-55 21.5375 28.475 27.9125 22.075 56-57 21.6625 28.1 28.4125 21.825 58-59 21.775 28.225 28.037499999999998 21.9625 60-61 21.587500000000002 27.200000000000003 27.787499999999998 23.425 62-63 22.025 28.262500000000003 27.6875 22.025 64-65 22.59032379047381 28.20352544068008 26.96587073384173 22.240280035004375 66-67 21.9 28.1125 27.9125 22.075 68-69 21.867966991747938 27.019254813703427 28.719679919979995 22.393098274568644 70-71 22.400000000000002 28.6375 27.4125 21.55 72-73 22.22777847230904 28.01600200025003 27.803475434429302 21.952744093011624 74-75 22.25 28.8375 27.85 21.0625 76-77 22.115264408051004 27.590948868608578 28.22852856607076 22.06525815726966 78-79 22.315394242803503 27.271589486858574 27.722152690863577 22.690863579474343 80-81 22.503128911138923 27.784730913642054 28.17271589486858 21.53942428035044 82-83 22.290362953692114 27.396745932415516 28.122653316645806 22.19023779724656 84-85 21.40890890890891 27.87787787787788 28.803803803803802 21.90940940940941 86-87 21.762500000000003 28.4375 28.012500000000003 21.7875 88-89 21.1375 28.199999999999996 28.299999999999997 22.3625 90-91 22.315289411176398 27.240905113139142 27.84098012251531 22.602825353169145 92-93 21.6125 28.575 27.787499999999998 22.025 94-95 21.349999999999998 28.212500000000002 28.6875 21.75 96-97 21.6125 27.450000000000003 28.749999999999996 22.1875 98-99 21.9777472184023 27.728466058257283 27.55344418052256 22.740342542817853 100-101 22.9625 28.3125 27.175 21.55 102-103 22.125 28.925 28.199999999999996 20.75 104-105 22.612939557001628 27.318233012138656 27.956451007383304 22.11237642347641 106-107 22.27784730913642 28.247809762202753 27.88485607008761 21.589486858573217 108-109 22.70452839629722 27.47060295221416 27.383037277958465 22.441831373530146 110-111 21.773386693346673 28.47673836918459 27.851425712856425 21.898449224612307 112-113 22.1 28.725 27.3875 21.7875 114-115 22.540675844806007 28.623279098873596 27.359198998748436 21.476846057571965 116-117 23.129847385539154 28.383787840880657 26.682511883912934 21.80385288966725 118-119 23.517638228671505 28.446334751063297 26.51988991743808 21.51613710282712 120-121 23.51543942992874 28.84110513814227 25.640705088136016 22.00275034379297 122-123 22.83927454659162 29.218261413383367 26.01626016260163 21.92620387742339 124-125 22.812069613121324 29.209966195066983 25.065731814198074 22.912232377613623 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.5 22 3.5 23 3.0 24 2.5 25 5.0 26 6.5 27 8.0 28 12.5 29 14.5 30 16.5 31 21.5 32 29.5 33 41.5 34 55.5 35 83.0 36 95.5 37 95.5 38 131.5 39 174.0 40 202.5 41 235.0 42 255.0 43 259.0 44 257.0 45 256.5 46 249.5 47 241.0 48 240.5 49 213.0 50 166.5 51 121.5 52 95.0 53 88.0 54 76.5 55 57.5 56 40.5 57 31.0 58 24.0 59 16.0 60 9.0 61 7.0 62 7.0 63 7.5 64 6.5 65 6.5 66 4.5 67 2.0 68 3.0 69 2.5 70 3.0 71 2.5 72 1.5 73 3.5 74 3.0 75 1.5 76 1.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0500000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0125 66-67 0.0 68-69 0.025 70-71 0.0 72-73 0.0125 74-75 0.0 76-77 0.0125 78-79 0.125 80-81 0.125 82-83 0.125 84-85 0.1 86-87 0.0 88-89 0.0 90-91 0.0125 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0125 100-101 0.0 102-103 0.0 104-105 0.11249999999999999 106-107 0.125 108-109 0.075 110-111 0.05 112-113 0.0 114-115 0.125 116-117 0.075 118-119 0.075 120-121 0.0125 122-123 0.0625 124-125 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.95 0.0 0.0 0.0 0.0 96-97 1.15 0.0 0.0 0.0 0.0 98-99 1.4375 0.0 0.0 0.0 0.0 100-101 1.7375 0.0 0.0 0.0 0.0 102-103 1.9875 0.0 0.0 0.0 0.0 104-105 2.6125 0.0 0.0 0.0 0.0 106-107 3.3375 0.0 0.0 0.0 0.0 108-109 4.074999999999999 0.0 0.0 0.0 0.0 110-111 4.9125 0.0 0.0 0.0 0.0 112-113 5.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1182271 spots for SRR3208014.sra Written 1182271 spots for SRR3208014.sra Read 1182271 spots for SRR3208014.sra Written 1182271 spots for SRR3208014.sra Read 1182271 spots for SRR3208014.sra Written 1182271 spots for SRR3208014.sra Read 1182271 spots for SRR3208014.sra Written 1182271 spots for SRR3208014.sra Read 1182271 spots for SRR3208014.sra Written 1182271 spots for SRR3208014.sra Read 1182271 spots for SRR3208014.sra Written 1182271 spots for SRR3208014.sra Read 1182271 spots for SRR3208014.sra Written 1182271 spots for SRR3208014.sra Read 1182271 spots for SRR3208014.sra Written 1182271 spots for SRR3208014.sra Read 1182284 spots for SRR3208014.sra Written 1182284 spots for SRR3208014.sra Read 1182271 spots for SRR3208014.sra Written 1182271 spots for SRR3208014.sra Read 1182271 spots for SRR3208014.sra Written 1182271 spots for SRR3208014.sra Read 1182271 spots for SRR3208014.sra Written 1182271 spots for SRR3208014.sra Read 1182271 spots for SRR3208014.sra Written 1182271 spots for SRR3208014.sra Read 1182271 spots for SRR3208014.sra Written 1182271 spots for SRR3208014.sra Read 1182271 spots for SRR3208014.sra Written 1182271 spots for SRR3208014.sra Read 1182271 spots for SRR3208014.sra Written 1182271 spots for SRR3208014.sra Read 1182271 spots for SRR3208014.sra Written 1182271 spots for SRR3208014.sra Read 1182271 spots for SRR3208014.sra Written 1182271 spots for SRR3208014.sra Read 1182271 spots for SRR3208014.sra Written 1182271 spots for SRR3208014.sra Read 1182271 spots for SRR3208014.sra Written 1182271 spots for SRR3208014.sra SRR ids: ['SRR3208014.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_an82upa5 SRR3208014.sra spots: 23645433 blocks: [[1, 1182271], [1182272, 2364542], [2364543, 3546813], [3546814, 4729084], [4729085, 5911355], [5911356, 7093626], [7093627, 8275897], [8275898, 9458168], [9458169, 10640439], [10640440, 11822710], [11822711, 13004981], [13004982, 14187252], [14187253, 15369523], [15369524, 16551794], [16551795, 17734065], [17734066, 18916336], [18916337, 20098607], [20098608, 21280878], [21280879, 22463149], [22463150, 23645433]] SRR3208014 file size 7574509 SRR3208014 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208014 SRR3208014_1.fastq Input file: SRR3208014_1.fastq trimmed: SRR3208014-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 00:53:38 2025 >> started Wed Feb 12 00:53:54 2025 >> done (15.820s) 23645433 reads processed; of these: 17546 ( 0.07%) short reads filtered out after trimming by size control 62013 ( 0.26%) empty reads filtered out after trimming by size control 23565874 (99.66%) reads available; of these: 2427397 (10.30%) trimmed reads available after processing 21138477 (89.70%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 608 0.00% 19 638 0.00% 20 715 0.00% 21 771 0.00% 22 869 0.00% 23 918 0.00% 24 1102 0.00% 25 1331 0.01% 26 1278 0.01% 27 1174 0.00% 28 1148 0.00% 29 1295 0.01% 30 1772 0.01% 31 1693 0.01% 32 1218 0.01% 33 1079 0.00% 34 1164 0.00% 35 1224 0.01% 36 1179 0.01% 37 1218 0.01% 38 1259 0.01% 39 1175 0.00% 40 1203 0.01% 41 1239 0.01% 42 1291 0.01% 43 1268 0.01% 44 1337 0.01% 45 1259 0.01% 46 1363 0.01% 47 1355 0.01% 48 1350 0.01% 49 1457 0.01% 50 1426 0.01% 51 1478 0.01% 52 1410 0.01% 53 1434 0.01% 54 1561 0.01% 55 1658 0.01% 56 1716 0.01% 57 1745 0.01% 58 1882 0.01% 59 1969 0.01% 60 1983 0.01% 61 1995 0.01% 62 2757 0.01% 63 2056 0.01% 64 2370 0.01% 65 2233 0.01% 66 2158 0.01% 67 2624 0.01% 68 2481 0.01% 69 2705 0.01% 70 2904 0.01% 71 3034 0.01% 72 3178 0.01% 73 3424 0.01% 74 3614 0.02% 75 3706 0.02% 76 3764 0.02% 77 4057 0.02% 78 4612 0.02% 79 5143 0.02% 80 5715 0.02% 81 6345 0.03% 82 7176 0.03% 83 7930 0.03% 84 8534 0.04% 85 9271 0.04% 86 10074 0.04% 87 11123 0.05% 88 12553 0.05% 89 14145 0.06% 90 16184 0.07% 91 18895 0.08% 92 21384 0.09% 93 23944 0.10% 94 3184 0.01% 95 3349 0.01% 96 3538 0.02% 97 4259 0.02% 98 4007 0.02% 99 4060 0.02% 100 4422 0.02% 101 4503 0.02% 102 5402 0.02% 103 7252 0.03% 104 5504 0.02% 105 5366 0.02% 106 5700 0.02% 107 6088 0.03% 108 6779 0.03% 109 7657 0.03% 110 8270 0.04% 111 9132 0.04% 112 10392 0.04% 113 11810 0.05% 114 13739 0.06% 115 16061 0.07% 116 19944 0.08% 117 22422 0.10% 118 27604 0.12% 119 36147 0.15% 120 49175 0.21% 121 69266 0.29% 122 115279 0.49% 123 249846 1.06% 124 1398940 5.94% 125 21138477 89.70% 23565874 reads passed initial QC criterion=sequence-density sequence-density=5.04 sequence-density-rank=1 fanout-score=51.07 fanout-score-rank=1 prefix-density=6.84 prefix-fanout=37.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTGAAAAA criterion=fanout-score sequence-density=5.04 sequence-density-rank=1 fanout-score=51.07 fanout-score-rank=1 prefix-density=6.84 prefix-fanout=37.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTGAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTGAAAAA -o SRR3208014 - Input file: STDIN trimmed: SRR3208014-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 00:54:56 2025 >> started Wed Feb 12 00:55:16 2025 >> done (20.341s) 15710583 reads processed; of these: 159 ( 0.00%) short reads filtered out after trimming by size control 489 ( 0.00%) empty reads filtered out after trimming by size control 15709935 (100.00%) reads available; of these: 2336495 (14.87%) trimmed reads available after processing 13373440 (85.13%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 391 0.00% 19 444 0.00% 20 478 0.00% 21 537 0.00% 22 573 0.00% 23 596 0.00% 24 764 0.00% 25 878 0.01% 26 841 0.01% 27 789 0.01% 28 785 0.00% 29 872 0.01% 30 1197 0.01% 31 1102 0.01% 32 811 0.01% 33 687 0.00% 34 797 0.01% 35 831 0.01% 36 796 0.01% 37 799 0.01% 38 829 0.01% 39 812 0.01% 40 770 0.00% 41 833 0.01% 42 857 0.01% 43 863 0.01% 44 895 0.01% 45 892 0.01% 46 912 0.01% 47 922 0.01% 48 898 0.01% 49 974 0.01% 50 940 0.01% 51 996 0.01% 52 914 0.01% 53 970 0.01% 54 1039 0.01% 55 1087 0.01% 56 1162 0.01% 57 1160 0.01% 58 1276 0.01% 59 1355 0.01% 60 1314 0.01% 61 1332 0.01% 62 1801 0.01% 63 1384 0.01% 64 1579 0.01% 65 1493 0.01% 66 1440 0.01% 67 1779 0.01% 68 1653 0.01% 69 1845 0.01% 70 1927 0.01% 71 2022 0.01% 72 2056 0.01% 73 2188 0.01% 74 2253 0.01% 75 2435 0.02% 76 2495 0.02% 77 2769 0.02% 78 3087 0.02% 79 3444 0.02% 80 3859 0.02% 81 4264 0.03% 82 4822 0.03% 83 5329 0.03% 84 5754 0.04% 85 6284 0.04% 86 6793 0.04% 87 7451 0.05% 88 8556 0.05% 89 9583 0.06% 90 10918 0.07% 91 12328 0.08% 92 14149 0.09% 93 16091 0.10% 94 18156 0.12% 95 20040 0.13% 96 21516 0.14% 97 24037 0.15% 98 25719 0.16% 99 29047 0.18% 100 33041 0.21% 101 37569 0.24% 102 42859 0.27% 103 48601 0.31% 104 51987 0.33% 105 54944 0.35% 106 57283 0.36% 107 60787 0.39% 108 64556 0.41% 109 69768 0.44% 110 76526 0.49% 111 83531 0.53% 112 92214 0.59% 113 100087 0.64% 114 107327 0.68% 115 112867 0.72% 116 117545 0.75% 117 121081 0.77% 118 126003 0.80% 119 137640 0.88% 120 167989 1.07% 121 240000 1.53% 122 490277 3.12% 123 147547 0.94% 124 825443 5.25% 125 11911147 75.82% criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=40 prefix-density=0.07 prefix-fanout=1.9 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=11 fanout-score=308.16 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=30.0 sequence=TTCTTCTTCTTT Started job on | Feb 12 00:55:50 Started mapping on | Feb 12 00:55:50 Finished on | Feb 12 00:56:31 Mapping speed, Million of reads per hour | 2069.14 Number of input reads | 23565226 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 21820297 Uniquely mapped reads % | 92.60% Average mapped length | 122.30 Number of splices: Total | 8294316 Number of splices: Annotated (sjdb) | 8143833 Number of splices: GT/AG | 8166966 Number of splices: GC/AG | 104077 Number of splices: AT/AC | 8216 Number of splices: Non-canonical | 15057 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.13 Insertion rate per base | 0.02% Insertion average length | 1.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 461142 % of reads mapped to multiple loci | 1.96% Number of reads mapped to too many loci | 444446 % of reads mapped to too many loci | 1.89% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.55% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1283787 1283787 1283787 N_multimapping 461142 461142 461142 N_noFeature 863289 11254165 11285102 N_ambiguous 219378 37538 37882 UnstrandedReadsAssigned:20737630 PositiveStrandReadsAssigned:10528594 NegativeStrandReadsAssigned:10497313 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208014 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208014-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,565,226 reads, 21,528,174 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,254 rounds 52401 SRR3208014.ke.tsv 34699 SRR3208014.se.tsv 87100 total ==> SRR3208014.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 565 19.2767 Potri.005G024800.1.v4.1 1035 936 78 5.45604 Potri.004G059700.1.v4.1 961 862 30 2.27862 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 370.302 8.52481 Potri.016G087400.1.v4.1 270 171 1034 395.898 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 66 2.58135 Potri.012G127500.1.v4.1 977 878 3832 285.752 ==> SRR3208014.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2095 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 396 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 51 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR3208014 completed mapping pipeline successfully