Starting /dee2/code/volunteer_pipeline.sh SRR3208015 current disk space = 3051222134784 free memory = 1437324772 SRR3208015 SRAfilesize 7a6f2d1f0da770b45adeb748b1e4e184 SRR3208015.sra SRR3208015.sra file validated SRR3208015 is single end SRR3208015 is conventional basespace SRR3208015 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208015_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.83075 33.0 33.0 33.0 33.0 33.0 2 32.33475 33.0 33.0 33.0 33.0 33.0 3 32.42425 33.0 33.0 33.0 33.0 33.0 4 32.476 33.0 33.0 33.0 33.0 33.0 5 32.598 33.0 33.0 33.0 33.0 33.0 6 36.2465 37.0 37.0 37.0 37.0 37.0 7 36.34325 37.0 37.0 37.0 37.0 37.0 8 36.435 37.0 37.0 37.0 37.0 37.0 9 36.35975 37.0 37.0 37.0 37.0 37.0 10-11 36.363 37.0 37.0 37.0 37.0 37.0 12-13 36.349875 37.0 37.0 37.0 37.0 37.0 14-15 36.4025 37.0 37.0 37.0 37.0 37.0 16-17 36.348124999999996 37.0 37.0 37.0 37.0 37.0 18-19 36.39575 37.0 37.0 37.0 37.0 37.0 20-21 36.4025 37.0 37.0 37.0 37.0 37.0 22-23 36.35875 37.0 37.0 37.0 37.0 37.0 24-25 36.421 37.0 37.0 37.0 37.0 37.0 26-27 36.379000000000005 37.0 37.0 37.0 37.0 37.0 28-29 36.371125 37.0 37.0 37.0 37.0 37.0 30-31 36.448 37.0 37.0 37.0 37.0 37.0 32-33 36.393249999999995 37.0 37.0 37.0 37.0 37.0 34-35 36.395875000000004 37.0 37.0 37.0 37.0 37.0 36-37 36.386875 37.0 37.0 37.0 37.0 37.0 38-39 36.382999999999996 37.0 37.0 37.0 37.0 37.0 40-41 36.386125 37.0 37.0 37.0 37.0 37.0 42-43 36.417375 37.0 37.0 37.0 37.0 37.0 44-45 36.3775 37.0 37.0 37.0 37.0 37.0 46-47 36.3765 37.0 37.0 37.0 37.0 37.0 48-49 36.405375 37.0 37.0 37.0 37.0 37.0 50-51 36.402125 37.0 37.0 37.0 37.0 37.0 52-53 36.4645 37.0 37.0 37.0 37.0 37.0 54-55 36.355125 37.0 37.0 37.0 37.0 37.0 56-57 36.443124999999995 37.0 37.0 37.0 37.0 37.0 58-59 36.357875 37.0 37.0 37.0 37.0 37.0 60-61 36.331375 37.0 37.0 37.0 37.0 37.0 62-63 36.30875 37.0 37.0 37.0 37.0 37.0 64-65 36.30375 37.0 37.0 37.0 37.0 37.0 66-67 36.32275 37.0 37.0 37.0 37.0 37.0 68-69 36.25175 37.0 37.0 37.0 37.0 37.0 70-71 36.226375 37.0 37.0 37.0 37.0 37.0 72-73 36.227875 37.0 37.0 37.0 37.0 37.0 74-75 36.170249999999996 37.0 37.0 37.0 37.0 37.0 76-77 36.153125 37.0 37.0 37.0 37.0 37.0 78-79 36.13875 37.0 37.0 37.0 37.0 37.0 80-81 36.077875 37.0 37.0 37.0 37.0 37.0 82-83 36.127250000000004 37.0 37.0 37.0 37.0 37.0 84-85 36.098875 37.0 37.0 37.0 37.0 37.0 86-87 36.16725 37.0 37.0 37.0 37.0 37.0 88-89 36.135625000000005 37.0 37.0 37.0 37.0 37.0 90-91 36.12075 37.0 37.0 37.0 37.0 37.0 92-93 36.11475 37.0 37.0 37.0 37.0 37.0 94-95 36.06925 37.0 37.0 37.0 37.0 37.0 96-97 36.056375 37.0 37.0 37.0 37.0 37.0 98-99 36.043375 37.0 37.0 37.0 37.0 37.0 100-101 36.019999999999996 37.0 37.0 37.0 37.0 37.0 102-103 36.01075 37.0 37.0 37.0 37.0 37.0 104-105 35.98225 37.0 37.0 37.0 37.0 37.0 106-107 35.976124999999996 37.0 37.0 37.0 37.0 37.0 108-109 36.0025 37.0 37.0 37.0 37.0 37.0 110-111 35.907375 37.0 37.0 37.0 37.0 37.0 112-113 35.874125 37.0 37.0 37.0 37.0 37.0 114-115 35.8455 37.0 37.0 37.0 37.0 37.0 116-117 35.871875 37.0 37.0 37.0 37.0 37.0 118-119 35.8155 37.0 37.0 37.0 37.0 37.0 120-121 35.821625 37.0 37.0 37.0 37.0 37.0 122-123 35.713625 37.0 37.0 37.0 37.0 37.0 124-125 34.459375 37.0 37.0 37.0 32.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 2.0 13 2.0 14 1.0 15 4.0 16 2.0 17 1.0 18 2.0 19 3.0 20 1.0 21 0.0 22 11.0 23 9.0 24 1.0 25 7.0 26 7.0 27 11.0 28 7.0 29 16.0 30 24.0 31 35.0 32 43.0 33 76.0 34 100.0 35 199.0 36 3420.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.118170266836085 15.501905972045742 13.494282083862771 49.8856416772554 2 18.964223167375533 22.366775081310983 39.629722291718785 19.039279459594695 3 20.9 25.8 29.375 23.925 4 24.525 30.875000000000004 21.2 23.400000000000002 5 24.275 33.324999999999996 23.974999999999998 18.425 6 18.325 36.449999999999996 25.275 19.950000000000003 7 17.75 19.025 42.975 20.25 8 17.224999999999998 24.575 31.874999999999996 26.325 9 20.275000000000002 22.075 32.45 25.2 10-11 22.6125 33.5875 23.3375 20.4625 12-13 20.0 26.950000000000003 29.925 23.125 14-15 21.325 27.737499999999997 29.1125 21.825 16-17 22.5875 28.212500000000002 26.2125 22.9875 18-19 22.1375 28.249999999999996 26.8625 22.75 20-21 21.4875 28.375 27.575 22.5625 22-23 21.1125 28.499999999999996 28.299999999999997 22.0875 24-25 22.287499999999998 28.225 27.325 22.162499999999998 26-27 21.05 28.6125 28.875 21.462500000000002 28-29 22.3625 28.787499999999998 27.425 21.425 30-31 21.987499999999997 28.499999999999996 28.199999999999996 21.3125 32-33 21.525 28.849999999999998 27.1125 22.5125 34-35 21.637500000000003 28.0875 27.787499999999998 22.4875 36-37 21.475 28.6125 27.125 22.787499999999998 38-39 21.55 28.525 28.1 21.825 40-41 21.95 28.4375 27.487499999999997 22.125 42-43 21.675 28.462500000000002 28.3875 21.475 44-45 22.2125 28.0875 27.8625 21.837500000000002 46-47 22.037499999999998 28.1875 27.6875 22.0875 48-49 21.45 28.237499999999997 28.1625 22.15 50-51 21.425 27.625 28.962500000000002 21.987499999999997 52-53 22.175 28.6875 27.6875 21.45 54-55 21.3875 28.000000000000004 28.025 22.5875 56-57 22.1 27.775 28.5875 21.5375 58-59 21.45 27.35 27.8625 23.3375 60-61 21.4375 28.7375 28.037499999999998 21.7875 62-63 21.65270658832354 27.240905113139142 28.50356294536817 22.602825353169145 64-65 21.808178066775042 28.248093034888083 27.53532574715518 22.408403151181695 66-67 21.224999999999998 28.325 27.8125 22.6375 68-69 22.554415811858895 28.90918188641481 27.257943457593193 21.278458844133098 70-71 22.45 29.299999999999997 27.287499999999998 20.962500000000002 72-73 22.083281230461424 27.285231961985744 28.110541453044892 22.52094535450794 74-75 21.4 27.950000000000003 29.362500000000004 21.2875 76-77 22.308365637113916 28.160560210078778 27.672877328998375 21.858196823808928 78-79 21.946946946946948 26.926926926926924 28.69119119119119 22.434934934934937 80-81 22.32657150012522 28.549962434259957 27.510643626346106 21.61282243926872 82-83 21.710279203706023 27.97045198447477 28.371103042443973 21.948165769375237 84-85 21.734234234234233 28.516016016016017 27.45245245245245 22.2972972972973 86-87 21.6 29.1125 27.6125 21.675 88-89 22.125 28.6875 27.825 21.3625 90-91 21.93322495935976 29.235963486307366 26.985119419782418 21.845692134550458 92-93 22.112499999999997 28.6375 27.325 21.925 94-95 21.8625 29.012500000000003 28.000000000000004 21.125 96-97 21.4 28.199999999999996 27.787499999999998 22.6125 98-99 22.19582343378767 27.5728398149306 28.323121170438913 21.908215580842814 100-101 22.275 27.8625 28.1125 21.75 102-103 22.315289411176398 29.041130141267658 27.590948868608578 21.052631578947366 104-105 21.586785133274937 28.869978726066826 27.305718933800527 22.237517206857717 106-107 21.747840240390634 29.07224239389007 27.73256541880556 21.447351946913734 108-109 22.387686146915282 28.895006882743086 26.667500938555875 22.04980603178576 110-111 22.273636818409205 28.85192596298149 27.188594297148573 21.68584292146073 112-113 23.8375 28.025 27.450000000000003 20.6875 114-115 22.71021021021021 28.59109109109109 26.95195195195195 21.746746746746748 116-117 22.803504380475594 28.498122653316642 27.183979974968707 21.51439299123905 118-119 22.850707045426105 29.245401076210737 26.980352897009137 20.923538981354024 120-121 22.946104789295983 27.597849193447544 27.372764786795052 22.083281230461424 122-123 23.026891807379613 29.168230143839903 25.753595997498437 22.05128205128205 124-125 23.15973960941412 29.644466700050074 25.550826239359036 21.64496745117677 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 2.0 25 3.5 26 7.5 27 10.5 28 9.0 29 7.5 30 20.5 31 29.5 32 37.5 33 50.0 34 55.0 35 63.5 36 90.0 37 126.0 38 157.5 39 169.0 40 179.0 41 232.5 42 258.0 43 263.5 44 267.0 45 269.0 46 270.5 47 234.0 48 205.0 49 192.0 50 165.0 51 132.0 52 108.5 53 84.5 54 68.0 55 54.5 56 40.5 57 30.0 58 19.0 59 16.0 60 12.5 61 7.5 62 8.5 63 7.5 64 6.5 65 6.0 66 4.0 67 3.5 68 3.5 69 2.5 70 2.5 71 1.5 72 0.0 73 0.5 74 1.0 75 1.5 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.625 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0125 64-65 0.0375 66-67 0.0 68-69 0.075 70-71 0.0 72-73 0.0375 74-75 0.0 76-77 0.0375 78-79 0.1 80-81 0.17500000000000002 82-83 0.1625 84-85 0.1 86-87 0.0 88-89 0.0 90-91 0.0375 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0375 100-101 0.0 102-103 0.0125 104-105 0.11249999999999999 106-107 0.1625 108-109 0.11249999999999999 110-111 0.05 112-113 0.0 114-115 0.1 116-117 0.125 118-119 0.11249999999999999 120-121 0.0375 122-123 0.0625 124-125 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82438534872053 99.47500000000001 2 0.1254390366281987 0.25 3 0.0 0.0 4 0.0 0.0 5 0.025087807325639738 0.125 6 0.025087807325639738 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTAT 6 0.15 TruSeq Adapter, Index 13 (97% over 40bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTA 5 0.125 TruSeq Adapter, Index 13 (97% over 40bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10-11 0.125 0.0 0.0 0.0 0.0 12-13 0.125 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.125 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.1375 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.16249999999999998 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.5249999999999999 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.15 0.0 0.0 0.0 0.0 100-101 1.3875 0.0 0.0 0.0 0.0 102-103 1.675 0.0 0.0 0.0 0.0 104-105 2.125 0.0 0.0 0.0 0.0 106-107 2.7125000000000004 0.0 0.0 0.0 0.0 108-109 3.3 0.0 0.0 0.0 0.0 110-111 4.112500000000001 0.0 0.0 0.0 0.0 112-113 5.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCAAAT 15 0.0040846216 59.5 68-69 ACATCAT 15 0.0040846216 59.5 16-17 >>END_MODULE Read 868590 spots for SRR3208015.sra Written 868590 spots for SRR3208015.sra Read 868590 spots for SRR3208015.sra Written 868590 spots for SRR3208015.sra Read 868590 spots for SRR3208015.sra Written 868590 spots for SRR3208015.sra Read 868590 spots for SRR3208015.sra Written 868590 spots for SRR3208015.sra Read 868590 spots for SRR3208015.sra Written 868590 spots for SRR3208015.sra Read 868590 spots for SRR3208015.sra Written 868590 spots for SRR3208015.sra Read 868590 spots for SRR3208015.sra Written 868590 spots for SRR3208015.sra Read 868590 spots for SRR3208015.sra Written 868590 spots for SRR3208015.sra Read 868590 spots for SRR3208015.sra Written 868590 spots for SRR3208015.sra Read 868590 spots for SRR3208015.sra Written 868590 spots for SRR3208015.sra Read 868590 spots for SRR3208015.sra Written 868590 spots for SRR3208015.sra Read 868590 spots for SRR3208015.sra Written 868590 spots for SRR3208015.sra Read 868595 spots for SRR3208015.sra Written 868595 spots for SRR3208015.sra Read 868590 spots for SRR3208015.sra Written 868590 spots for SRR3208015.sra Read 868590 spots for SRR3208015.sra Written 868590 spots for SRR3208015.sra Read 868590 spots for SRR3208015.sra Written 868590 spots for SRR3208015.sra Read 868590 spots for SRR3208015.sra Written 868590 spots for SRR3208015.sra Read 868590 spots for SRR3208015.sra Written 868590 spots for SRR3208015.sra Read 868590 spots for SRR3208015.sra Written 868590 spots for SRR3208015.sra Read 868590 spots for SRR3208015.sra Written 868590 spots for SRR3208015.sra SRR ids: ['SRR3208015.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kxpg28jz SRR3208015.sra spots: 17371805 blocks: [[1, 868590], [868591, 1737180], [1737181, 2605770], [2605771, 3474360], [3474361, 4342950], [4342951, 5211540], [5211541, 6080130], [6080131, 6948720], [6948721, 7817310], [7817311, 8685900], [8685901, 9554490], [9554491, 10423080], [10423081, 11291670], [11291671, 12160260], [12160261, 13028850], [13028851, 13897440], [13897441, 14766030], [14766031, 15634620], [15634621, 16503210], [16503211, 17371805]] SRR3208015 file size 5561948 SRR3208015 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208015 SRR3208015_1.fastq Input file: SRR3208015_1.fastq trimmed: SRR3208015-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 01:05:07 2025 >> started Wed Feb 12 01:05:17 2025 >> done (9.257s) 17371805 reads processed; of these: 13526 ( 0.08%) short reads filtered out after trimming by size control 62733 ( 0.36%) empty reads filtered out after trimming by size control 17295546 (99.56%) reads available; of these: 1735980 (10.04%) trimmed reads available after processing 15559566 (89.96%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 535 0.00% 19 592 0.00% 20 687 0.00% 21 564 0.00% 22 681 0.00% 23 742 0.00% 24 820 0.00% 25 970 0.01% 26 1037 0.01% 27 882 0.01% 28 961 0.01% 29 958 0.01% 30 1254 0.01% 31 1056 0.01% 32 899 0.01% 33 835 0.00% 34 848 0.00% 35 865 0.01% 36 847 0.00% 37 906 0.01% 38 863 0.00% 39 898 0.01% 40 907 0.01% 41 904 0.01% 42 946 0.01% 43 922 0.01% 44 949 0.01% 45 908 0.01% 46 929 0.01% 47 899 0.01% 48 1001 0.01% 49 1083 0.01% 50 1059 0.01% 51 1054 0.01% 52 1028 0.01% 53 1071 0.01% 54 1102 0.01% 55 1134 0.01% 56 1161 0.01% 57 1207 0.01% 58 1252 0.01% 59 1299 0.01% 60 1384 0.01% 61 1509 0.01% 62 1898 0.01% 63 1501 0.01% 64 1769 0.01% 65 1741 0.01% 66 1745 0.01% 67 1973 0.01% 68 1776 0.01% 69 1918 0.01% 70 2043 0.01% 71 2083 0.01% 72 2177 0.01% 73 2270 0.01% 74 2519 0.01% 75 2856 0.02% 76 3008 0.02% 77 3024 0.02% 78 3175 0.02% 79 3324 0.02% 80 3700 0.02% 81 4142 0.02% 82 4540 0.03% 83 5045 0.03% 84 5561 0.03% 85 5787 0.03% 86 6312 0.04% 87 6970 0.04% 88 7721 0.04% 89 8793 0.05% 90 10157 0.06% 91 11784 0.07% 92 13610 0.08% 93 15047 0.09% 94 2268 0.01% 95 2425 0.01% 96 2525 0.01% 97 3032 0.02% 98 2793 0.02% 99 2909 0.02% 100 3268 0.02% 101 3235 0.02% 102 3763 0.02% 103 5403 0.03% 104 3856 0.02% 105 3796 0.02% 106 4167 0.02% 107 4503 0.03% 108 4852 0.03% 109 5547 0.03% 110 5862 0.03% 111 6789 0.04% 112 7586 0.04% 113 8419 0.05% 114 9720 0.06% 115 11463 0.07% 116 14356 0.08% 117 15744 0.09% 118 19919 0.12% 119 25840 0.15% 120 35246 0.20% 121 50264 0.29% 122 82987 0.48% 123 180042 1.04% 124 1011024 5.85% 125 15559566 89.96% 17295546 reads passed initial QC criterion=sequence-density sequence-density=4.26 sequence-density-rank=1 fanout-score=48.60 fanout-score-rank=1 prefix-density=5.83 prefix-fanout=35.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=4.26 sequence-density-rank=1 fanout-score=48.60 fanout-score-rank=1 prefix-density=5.83 prefix-fanout=35.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAAA -o SRR3208015 - Input file: STDIN trimmed: SRR3208015-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 01:06:22 2025 >> started Wed Feb 12 01:06:33 2025 >> done (11.061s) 10377328 reads processed; of these: 224 ( 0.00%) short reads filtered out after trimming by size control 1220 ( 0.01%) empty reads filtered out after trimming by size control 10375884 (99.99%) reads available; of these: 1371241 (13.22%) trimmed reads available after processing 9004643 (86.78%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 325 0.00% 19 362 0.00% 20 434 0.00% 21 355 0.00% 22 400 0.00% 23 447 0.00% 24 507 0.00% 25 575 0.01% 26 701 0.01% 27 525 0.01% 28 590 0.01% 29 578 0.01% 30 761 0.01% 31 611 0.01% 32 553 0.01% 33 493 0.00% 34 512 0.00% 35 516 0.00% 36 520 0.01% 37 545 0.01% 38 516 0.00% 39 547 0.01% 40 578 0.01% 41 511 0.00% 42 568 0.01% 43 552 0.01% 44 578 0.01% 45 541 0.01% 46 559 0.01% 47 533 0.01% 48 587 0.01% 49 626 0.01% 50 652 0.01% 51 663 0.01% 52 614 0.01% 53 625 0.01% 54 655 0.01% 55 698 0.01% 56 699 0.01% 57 731 0.01% 58 782 0.01% 59 802 0.01% 60 833 0.01% 61 899 0.01% 62 1156 0.01% 63 926 0.01% 64 1048 0.01% 65 949 0.01% 66 1032 0.01% 67 1203 0.01% 68 1057 0.01% 69 1146 0.01% 70 1261 0.01% 71 1270 0.01% 72 1316 0.01% 73 1306 0.01% 74 1384 0.01% 75 1491 0.01% 76 1549 0.01% 77 1732 0.02% 78 1897 0.02% 79 2013 0.02% 80 2289 0.02% 81 2499 0.02% 82 2735 0.03% 83 3029 0.03% 84 3376 0.03% 85 3525 0.03% 86 3860 0.04% 87 4163 0.04% 88 4689 0.05% 89 5319 0.05% 90 6114 0.06% 91 6940 0.07% 92 8216 0.08% 93 9025 0.09% 94 10393 0.10% 95 11166 0.11% 96 11768 0.11% 97 13118 0.13% 98 14326 0.14% 99 16325 0.16% 100 18353 0.18% 101 20972 0.20% 102 24096 0.23% 103 27520 0.27% 104 28967 0.28% 105 30888 0.30% 106 32201 0.31% 107 34137 0.33% 108 36361 0.35% 109 39592 0.38% 110 43159 0.42% 111 47374 0.46% 112 53058 0.51% 113 57606 0.56% 114 62087 0.60% 115 65531 0.63% 116 68822 0.66% 117 70148 0.68% 118 73976 0.71% 119 81956 0.79% 120 101738 0.98% 121 151093 1.46% 122 317099 3.06% 123 97442 0.94% 124 548401 5.29% 125 8051037 77.59% criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=57.46 fanout-score-rank=13 prefix-density=0.25 prefix-fanout=14.7 sequence=CACCACCACCATGGGCTCCCCAGCCACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=410.49 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=16.3 sequence=CAGCAGCAAGACAAACCGAATTATTCATAAGTACCAATAAAATAAGCATTGCGCAAAAGGGATAGGATAAATCACTCTTAAGCTTGAGGCTTCTCCCATTTGAGGGGCTTGACAACTTCCCAGGTGAAGTCTGGGTCATCCCTTCCAAAATGTCCGTATGCAGCTGTCTTCAAGAACCTATTACCCCCCCTCTTGAGATCCAGGTTGATGGTCATCATTCCAGGCCTAAAGTCAAAGCTCTCCTTCACAATCTTAAGGATCTCCTTGTCAGGAATTTTTCCAGTGCCATAGGTGTCCACAAAGACTGACAAAGGCTCAGGTACACCAATAGCATAGGA Started job on | Feb 12 01:07:00 Started mapping on | Feb 12 01:07:00 Finished on | Feb 12 01:07:24 Mapping speed, Million of reads per hour | 2594.12 Number of input reads | 17294102 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 16387915 Uniquely mapped reads % | 94.76% Average mapped length | 122.59 Number of splices: Total | 6128759 Number of splices: Annotated (sjdb) | 6008300 Number of splices: GT/AG | 6032113 Number of splices: GC/AG | 78778 Number of splices: AT/AC | 6391 Number of splices: Non-canonical | 11477 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.18 Insertion rate per base | 0.02% Insertion average length | 1.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 350756 % of reads mapped to multiple loci | 2.03% Number of reads mapped to too many loci | 206375 % of reads mapped to too many loci | 1.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.01% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 555431 555431 555431 N_multimapping 350756 350756 350756 N_noFeature 701322 8479271 8500845 N_ambiguous 168469 29717 29958 UnstrandedReadsAssigned:15518124 PositiveStrandReadsAssigned:7878927 NegativeStrandReadsAssigned:7857112 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208015 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208015-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,294,102 reads, 15,991,775 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52401 SRR3208015.ke.tsv 34699 SRR3208015.se.tsv 87100 total ==> SRR3208015.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 567 25.4977 Potri.005G024800.1.v4.1 1035 936 215 19.8224 Potri.004G059700.1.v4.1 961 862 19 1.90213 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 255.375 7.74893 Potri.016G087400.1.v4.1 270 171 735 370.923 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 66 3.40237 Potri.012G127500.1.v4.1 977 878 3441 338.207 ==> SRR3208015.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1710 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 309 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 24 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 22 SRR3208015 completed mapping pipeline successfully