Starting /dee2/code/volunteer_pipeline.sh SRR3208016 current disk space = 3051266678784 free memory = 1083726164 SRR3208016 SRAfilesize b215ed03330dc7d31eebd1290baba02d SRR3208016.sra SRR3208016.sra file validated SRR3208016 is single end SRR3208016 is conventional basespace SRR3208016 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208016_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.794 33.0 33.0 33.0 33.0 33.0 2 32.3505 33.0 33.0 33.0 33.0 33.0 3 32.4245 33.0 33.0 33.0 33.0 33.0 4 32.4455 33.0 33.0 33.0 33.0 33.0 5 32.50925 33.0 33.0 33.0 33.0 33.0 6 36.21675 37.0 37.0 37.0 37.0 37.0 7 36.367 37.0 37.0 37.0 37.0 37.0 8 36.36575 37.0 37.0 37.0 37.0 37.0 9 36.332 37.0 37.0 37.0 37.0 37.0 10-11 36.379125 37.0 37.0 37.0 37.0 37.0 12-13 36.385999999999996 37.0 37.0 37.0 37.0 37.0 14-15 36.3765 37.0 37.0 37.0 37.0 37.0 16-17 36.374624999999995 37.0 37.0 37.0 37.0 37.0 18-19 36.396125 37.0 37.0 37.0 37.0 37.0 20-21 36.38612500000001 37.0 37.0 37.0 37.0 37.0 22-23 36.357124999999996 37.0 37.0 37.0 37.0 37.0 24-25 36.34225 37.0 37.0 37.0 37.0 37.0 26-27 36.3005 37.0 37.0 37.0 37.0 37.0 28-29 36.33825 37.0 37.0 37.0 37.0 37.0 30-31 36.37625 37.0 37.0 37.0 37.0 37.0 32-33 36.366875 37.0 37.0 37.0 37.0 37.0 34-35 36.285375 37.0 37.0 37.0 37.0 37.0 36-37 36.29475 37.0 37.0 37.0 37.0 37.0 38-39 36.354875 37.0 37.0 37.0 37.0 37.0 40-41 36.320499999999996 37.0 37.0 37.0 37.0 37.0 42-43 36.326499999999996 37.0 37.0 37.0 37.0 37.0 44-45 36.370125 37.0 37.0 37.0 37.0 37.0 46-47 36.387874999999994 37.0 37.0 37.0 37.0 37.0 48-49 36.31075 37.0 37.0 37.0 37.0 37.0 50-51 36.31925 37.0 37.0 37.0 37.0 37.0 52-53 36.3285 37.0 37.0 37.0 37.0 37.0 54-55 36.384874999999994 37.0 37.0 37.0 37.0 37.0 56-57 36.322625 37.0 37.0 37.0 37.0 37.0 58-59 36.319500000000005 37.0 37.0 37.0 37.0 37.0 60-61 36.282 37.0 37.0 37.0 37.0 37.0 62-63 36.304375 37.0 37.0 37.0 37.0 37.0 64-65 36.297875000000005 37.0 37.0 37.0 37.0 37.0 66-67 36.327625 37.0 37.0 37.0 37.0 37.0 68-69 36.29375 37.0 37.0 37.0 37.0 37.0 70-71 36.27575 37.0 37.0 37.0 37.0 37.0 72-73 36.280375 37.0 37.0 37.0 37.0 37.0 74-75 36.246625 37.0 37.0 37.0 37.0 37.0 76-77 36.215 37.0 37.0 37.0 37.0 37.0 78-79 36.247 37.0 37.0 37.0 37.0 37.0 80-81 36.21925 37.0 37.0 37.0 37.0 37.0 82-83 36.194625 37.0 37.0 37.0 37.0 37.0 84-85 36.178 37.0 37.0 37.0 37.0 37.0 86-87 36.19775 37.0 37.0 37.0 37.0 37.0 88-89 36.2085 37.0 37.0 37.0 37.0 37.0 90-91 36.096625 37.0 37.0 37.0 37.0 37.0 92-93 36.088750000000005 37.0 37.0 37.0 37.0 37.0 94-95 36.15075 37.0 37.0 37.0 37.0 37.0 96-97 36.07525 37.0 37.0 37.0 37.0 37.0 98-99 36.016375 37.0 37.0 37.0 37.0 37.0 100-101 36.082625 37.0 37.0 37.0 37.0 37.0 102-103 36.1055 37.0 37.0 37.0 37.0 37.0 104-105 36.140875 37.0 37.0 37.0 37.0 37.0 106-107 36.094125 37.0 37.0 37.0 37.0 37.0 108-109 36.045375 37.0 37.0 37.0 37.0 37.0 110-111 35.983375 37.0 37.0 37.0 37.0 37.0 112-113 35.964875000000006 37.0 37.0 37.0 37.0 37.0 114-115 35.96 37.0 37.0 37.0 37.0 37.0 116-117 35.94775 37.0 37.0 37.0 37.0 37.0 118-119 35.9045 37.0 37.0 37.0 37.0 37.0 120-121 35.858999999999995 37.0 37.0 37.0 37.0 37.0 122-123 35.766625000000005 37.0 37.0 37.0 37.0 37.0 124-125 34.500375 37.0 37.0 37.0 32.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 0.0 4 0.0 5 0.0 6 2.0 7 2.0 8 0.0 9 1.0 10 1.0 11 1.0 12 1.0 13 1.0 14 2.0 15 0.0 16 0.0 17 1.0 18 1.0 19 2.0 20 1.0 21 1.0 22 5.0 23 6.0 24 5.0 25 4.0 26 6.0 27 9.0 28 9.0 29 17.0 30 27.0 31 32.0 32 41.0 33 66.0 34 111.0 35 212.0 36 3416.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.278738555442523 16.251271617497455 12.309257375381485 49.160732451678534 2 17.825 22.125 40.65 19.400000000000002 3 21.275 25.324999999999996 29.025000000000002 24.375 4 23.45 30.575000000000003 20.549999999999997 25.424999999999997 5 24.224999999999998 34.975 23.474999999999998 17.325 6 19.900000000000002 37.35 23.875 18.875 7 16.475 19.1 42.525 21.9 8 17.7 25.025 30.525000000000002 26.75 9 18.975 24.125 31.95 24.95 10-11 22.1375 31.924999999999997 23.6125 22.325 12-13 20.525 26.5 29.2875 23.6875 14-15 21.7875 27.3375 28.475 22.400000000000002 16-17 21.9625 27.762500000000003 28.050000000000004 22.225 18-19 21.85 27.3625 27.8625 22.925 20-21 22.3875 28.512500000000003 27.1375 21.9625 22-23 22.4375 28.1875 27.3375 22.037499999999998 24-25 20.9375 28.4125 28.4 22.25 26-27 21.462500000000002 28.1625 27.625 22.75 28-29 22.5 27.6125 27.8375 22.05 30-31 22.3625 27.2625 27.85 22.525000000000002 32-33 21.8 28.199999999999996 27.762500000000003 22.237499999999997 34-35 21.5 28.012500000000003 27.700000000000003 22.787499999999998 36-37 22.475 28.625 27.0 21.9 38-39 21.875 28.512500000000003 27.9125 21.7 40-41 21.95 27.525 28.15 22.375 42-43 22.625 27.537499999999998 27.775 22.0625 44-45 21.775 28.3375 27.762500000000003 22.125 46-47 22.0 28.199999999999996 28.0625 21.7375 48-49 21.912499999999998 28.037499999999998 27.925 22.125 50-51 21.712500000000002 28.1 27.787499999999998 22.400000000000002 52-53 22.0 28.050000000000004 27.2625 22.6875 54-55 21.075 28.65 28.462500000000002 21.8125 56-57 21.5 27.575 28.4375 22.4875 58-59 22.225 28.050000000000004 28.349999999999998 21.375 60-61 21.337500000000002 28.449999999999996 27.6625 22.55 62-63 21.8125 28.575 27.787499999999998 21.825 64-65 21.517879469867466 27.769442360590148 27.619404851212803 23.093273318329583 66-67 22.45 28.000000000000004 27.762500000000003 21.7875 68-69 22.39869934967484 27.963981990995496 28.176588294147077 21.46073036518259 70-71 21.65 28.199999999999996 27.224999999999998 22.925 72-73 21.905476369092273 28.294573643410853 27.694423605901473 22.1055263815954 74-75 22.3125 28.725 27.875 21.087500000000002 76-77 21.9679919979995 27.406851712928233 28.619654913728432 22.005501375343837 78-79 22.423711855927962 28.4392196098049 27.55127563781891 21.585792896448226 80-81 21.928946710032523 27.995996997748314 28.408806604953718 21.66624968726545 82-83 22.31952958838984 27.073689478293506 28.24971850369073 22.357062429625923 84-85 21.91095547773887 27.75137568784392 27.738869434717362 22.59879939969985 86-87 21.775 27.787499999999998 27.375 23.0625 88-89 21.45 27.6875 28.749999999999996 22.112499999999997 90-91 22.155538884721178 27.719429857464366 28.032008002000502 22.093023255813954 92-93 22.725 28.4125 27.625 21.2375 94-95 21.912499999999998 28.1 27.3375 22.650000000000002 96-97 22.625 27.8625 27.175 22.3375 98-99 21.9777472184023 28.078509813726715 27.590948868608578 22.352794099262407 100-101 22.4625 28.449999999999996 27.1625 21.925 102-103 22.25 27.775 28.15 21.825 104-105 22.873936968484244 27.5887943971986 27.651325662831418 21.885942971485743 106-107 22.54190642982237 27.933450087565674 27.583187390542907 21.94145609206905 108-109 21.748374187093546 28.139069534767387 27.37618809404702 22.736368184092047 110-111 23.143285821455365 27.644411102775695 27.206801700425103 22.005501375343837 112-113 22.05 29.062500000000004 26.275 22.6125 114-115 23.28664332166083 28.16408204102051 26.375687843921963 22.173586793396698 116-117 23.076923076923077 28.855534709193247 27.166979362101312 20.900562851782365 118-119 22.191643732799598 29.597197898423815 26.044533400050035 22.166624968726545 120-121 23.143285821455365 28.89472368092023 26.056514128532132 21.905476369092273 122-123 23.593398349587396 28.94473618404601 26.081520380095025 21.380345086271568 124-125 23.695733767046164 28.625046916051545 26.298010759414485 21.381208557487803 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 2.0 22 2.5 23 2.5 24 4.5 25 4.0 26 2.0 27 7.0 28 13.0 29 18.5 30 21.0 31 30.5 32 41.0 33 49.0 34 72.5 35 83.5 36 93.5 37 120.5 38 136.0 39 160.5 40 188.5 41 206.5 42 234.0 43 246.5 44 246.0 45 239.5 46 235.5 47 239.0 48 224.5 49 186.5 50 156.0 51 149.0 52 116.0 53 81.0 54 65.0 55 51.0 56 46.0 57 41.5 58 32.5 59 26.5 60 26.5 61 18.0 62 14.0 63 15.0 64 8.5 65 3.5 66 5.0 67 5.0 68 4.5 69 4.5 70 4.0 71 2.5 72 1.0 73 1.5 74 1.0 75 3.0 76 3.0 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7000000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.025 66-67 0.0 68-69 0.05 70-71 0.0 72-73 0.025 74-75 0.0 76-77 0.025 78-79 0.05 80-81 0.075 82-83 0.08750000000000001 84-85 0.05 86-87 0.0 88-89 0.0 90-91 0.025 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0125 100-101 0.0 102-103 0.0 104-105 0.05 106-107 0.075 108-109 0.05 110-111 0.025 112-113 0.0 114-115 0.05 116-117 0.0625 118-119 0.075 120-121 0.025 122-123 0.025 124-125 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54728370221329 98.95 2 0.4024144869215292 0.8 3 0.0 0.0 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.025150905432595575 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTAT 6 0.15 TruSeq Adapter, Index 14 (97% over 44bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.0625 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 1.075 0.0 0.0 0.0 0.0 98-99 1.3375 0.0 0.0 0.0 0.0 100-101 1.6625 0.0 0.0 0.0 0.0 102-103 2.1125 0.0 0.0 0.0 0.0 104-105 2.8 0.0 0.0 0.0 0.0 106-107 3.3375000000000004 0.0 0.0 0.0 0.0 108-109 3.975 0.0 0.0 0.0 0.0 110-111 4.875 0.0 0.0 0.0 0.0 112-113 5.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 892094 spots for SRR3208016.sra Written 892094 spots for SRR3208016.sra Read 892094 spots for SRR3208016.sra Written 892094 spots for SRR3208016.sra Read 892094 spots for SRR3208016.sra Written 892094 spots for SRR3208016.sra Read 892094 spots for SRR3208016.sra Written 892094 spots for SRR3208016.sra Read 892094 spots for SRR3208016.sra Written 892094 spots for SRR3208016.sra Read 892094 spots for SRR3208016.sra Written 892094 spots for SRR3208016.sra Read 892094 spots for SRR3208016.sra Written 892094 spots for SRR3208016.sra Read 892094 spots for SRR3208016.sra Written 892094 spots for SRR3208016.sra Read 892094 spots for SRR3208016.sra Written 892094 spots for SRR3208016.sra Read 892094 spots for SRR3208016.sra Written 892094 spots for SRR3208016.sra Read 892094 spots for SRR3208016.sra Written 892094 spots for SRR3208016.sra Read 892094 spots for SRR3208016.sra Written 892094 spots for SRR3208016.sra Read 892094 spots for SRR3208016.sra Written 892094 spots for SRR3208016.sra Read 892094 spots for SRR3208016.sra Written 892094 spots for SRR3208016.sra Read 892094 spots for SRR3208016.sra Written 892094 spots for SRR3208016.sra Read 892094 spots for SRR3208016.sra Written 892094 spots for SRR3208016.sra Read 892110 spots for SRR3208016.sra Written 892110 spots for SRR3208016.sra Read 892094 spots for SRR3208016.sra Written 892094 spots for SRR3208016.sra Read 892094 spots for SRR3208016.sra Written 892094 spots for SRR3208016.sra Read 892094 spots for SRR3208016.sra Written 892094 spots for SRR3208016.sra SRR ids: ['SRR3208016.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_whvenp0x SRR3208016.sra spots: 17841896 blocks: [[1, 892094], [892095, 1784188], [1784189, 2676282], [2676283, 3568376], [3568377, 4460470], [4460471, 5352564], [5352565, 6244658], [6244659, 7136752], [7136753, 8028846], [8028847, 8920940], [8920941, 9813034], [9813035, 10705128], [10705129, 11597222], [11597223, 12489316], [12489317, 13381410], [13381411, 14273504], [14273505, 15165598], [15165599, 16057692], [16057693, 16949786], [16949787, 17841896]] SRR3208016 file size 5712761 SRR3208016 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208016 SRR3208016_1.fastq Input file: SRR3208016_1.fastq trimmed: SRR3208016-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 00:54:24 2025 >> started Wed Feb 12 00:54:35 2025 >> done (10.421s) 17841896 reads processed; of these: 13784 ( 0.08%) short reads filtered out after trimming by size control 61154 ( 0.34%) empty reads filtered out after trimming by size control 17766958 (99.58%) reads available; of these: 1871348 (10.53%) trimmed reads available after processing 15895610 (89.47%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 584 0.00% 19 573 0.00% 20 887 0.00% 21 613 0.00% 22 670 0.00% 23 731 0.00% 24 920 0.01% 25 971 0.01% 26 981 0.01% 27 924 0.01% 28 990 0.01% 29 1128 0.01% 30 1490 0.01% 31 1484 0.01% 32 954 0.01% 33 911 0.01% 34 930 0.01% 35 867 0.00% 36 935 0.01% 37 960 0.01% 38 946 0.01% 39 971 0.01% 40 957 0.01% 41 966 0.01% 42 1006 0.01% 43 988 0.01% 44 1047 0.01% 45 1044 0.01% 46 1052 0.01% 47 1067 0.01% 48 1106 0.01% 49 1158 0.01% 50 1147 0.01% 51 1190 0.01% 52 1202 0.01% 53 1182 0.01% 54 1155 0.01% 55 1266 0.01% 56 1380 0.01% 57 1353 0.01% 58 1451 0.01% 59 1474 0.01% 60 1549 0.01% 61 1531 0.01% 62 2129 0.01% 63 1586 0.01% 64 1842 0.01% 65 1809 0.01% 66 1786 0.01% 67 2165 0.01% 68 1972 0.01% 69 2192 0.01% 70 2298 0.01% 71 2454 0.01% 72 2568 0.01% 73 2660 0.01% 74 2883 0.02% 75 3203 0.02% 76 3539 0.02% 77 3447 0.02% 78 3736 0.02% 79 4173 0.02% 80 4598 0.03% 81 5158 0.03% 82 5850 0.03% 83 6243 0.04% 84 6846 0.04% 85 7453 0.04% 86 8145 0.05% 87 9038 0.05% 88 9880 0.06% 89 11358 0.06% 90 13275 0.07% 91 15083 0.08% 92 17240 0.10% 93 18964 0.11% 94 2380 0.01% 95 2512 0.01% 96 2601 0.01% 97 3137 0.02% 98 2925 0.02% 99 3100 0.02% 100 3401 0.02% 101 3363 0.02% 102 3918 0.02% 103 5472 0.03% 104 4067 0.02% 105 4089 0.02% 106 4286 0.02% 107 4610 0.03% 108 5276 0.03% 109 5771 0.03% 110 6382 0.04% 111 6996 0.04% 112 8075 0.05% 113 8808 0.05% 114 10500 0.06% 115 12275 0.07% 116 15017 0.08% 117 17055 0.10% 118 21244 0.12% 119 27874 0.16% 120 38014 0.21% 121 53813 0.30% 122 89082 0.50% 123 191118 1.08% 124 1071923 6.03% 125 15895610 89.47% 17766958 reads passed initial QC criterion=sequence-density sequence-density=5.24 sequence-density-rank=1 fanout-score=48.85 fanout-score-rank=1 prefix-density=7.08 prefix-fanout=36.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA criterion=fanout-score sequence-density=5.24 sequence-density-rank=1 fanout-score=48.85 fanout-score-rank=1 prefix-density=7.08 prefix-fanout=36.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA -o SRR3208016 - Input file: STDIN trimmed: SRR3208016-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 00:55:20 2025 >> started Wed Feb 12 00:55:34 2025 >> done (13.830s) 11844639 reads processed; of these: 156 ( 0.00%) short reads filtered out after trimming by size control 881 ( 0.01%) empty reads filtered out after trimming by size control 11843602 (99.99%) reads available; of these: 1778706 (15.02%) trimmed reads available after processing 10064896 (84.98%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 398 0.00% 19 379 0.00% 20 695 0.01% 21 417 0.00% 22 445 0.00% 23 498 0.00% 24 594 0.01% 25 683 0.01% 26 655 0.01% 27 600 0.01% 28 674 0.01% 29 757 0.01% 30 1005 0.01% 31 972 0.01% 32 594 0.01% 33 608 0.01% 34 624 0.01% 35 587 0.00% 36 641 0.01% 37 642 0.01% 38 618 0.01% 39 641 0.01% 40 643 0.01% 41 668 0.01% 42 671 0.01% 43 677 0.01% 44 696 0.01% 45 684 0.01% 46 694 0.01% 47 733 0.01% 48 762 0.01% 49 767 0.01% 50 733 0.01% 51 791 0.01% 52 788 0.01% 53 801 0.01% 54 770 0.01% 55 848 0.01% 56 936 0.01% 57 873 0.01% 58 981 0.01% 59 979 0.01% 60 1051 0.01% 61 1038 0.01% 62 1401 0.01% 63 1072 0.01% 64 1213 0.01% 65 1129 0.01% 66 1242 0.01% 67 1449 0.01% 68 1353 0.01% 69 1462 0.01% 70 1501 0.01% 71 1651 0.01% 72 1725 0.01% 73 1754 0.01% 74 1851 0.02% 75 1969 0.02% 76 2060 0.02% 77 2241 0.02% 78 2489 0.02% 79 2764 0.02% 80 3035 0.03% 81 3466 0.03% 82 3896 0.03% 83 4187 0.04% 84 4633 0.04% 85 5105 0.04% 86 5504 0.05% 87 5999 0.05% 88 6658 0.06% 89 7607 0.06% 90 8767 0.07% 91 9875 0.08% 92 11312 0.10% 93 12875 0.11% 94 14442 0.12% 95 15910 0.13% 96 17264 0.15% 97 19099 0.16% 98 20595 0.17% 99 23092 0.19% 100 26374 0.22% 101 29475 0.25% 102 33785 0.29% 103 38112 0.32% 104 40040 0.34% 105 42500 0.36% 106 44486 0.38% 107 47111 0.40% 108 50264 0.42% 109 54048 0.46% 110 58892 0.50% 111 64789 0.55% 112 71172 0.60% 113 76087 0.64% 114 81992 0.69% 115 86760 0.73% 116 89848 0.76% 117 91295 0.77% 118 95434 0.81% 119 103948 0.88% 120 126387 1.07% 121 179265 1.51% 122 362921 3.06% 123 112155 0.95% 124 628908 5.31% 125 8942596 75.51% criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=3.06 fanout-score-rank=23 prefix-density=0.16 prefix-fanout=2.6 sequence=TTCAACCAAGCGCG criterion=fanout-score sequence-density=0.05 sequence-density-rank=17 fanout-score=228.95 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=23.3 sequence=AAGAAGAAGAAA Started job on | Feb 12 00:56:01 Started mapping on | Feb 12 00:56:01 Finished on | Feb 12 00:56:33 Mapping speed, Million of reads per hour | 1998.67 Number of input reads | 17765921 Average input read length | 122 UNIQUE READS: Uniquely mapped reads number | 15677845 Uniquely mapped reads % | 88.25% Average mapped length | 122.31 Number of splices: Total | 5625273 Number of splices: Annotated (sjdb) | 5498733 Number of splices: GT/AG | 5530939 Number of splices: GC/AG | 76080 Number of splices: AT/AC | 6769 Number of splices: Non-canonical | 11485 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.53 Insertion rate per base | 0.02% Insertion average length | 1.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 394914 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 1033764 % of reads mapped to too many loci | 5.82% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.70% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1693162 1693162 1693162 N_multimapping 394914 394914 394914 N_noFeature 798360 8178109 8199716 N_ambiguous 168252 35233 34980 UnstrandedReadsAssigned:14711233 PositiveStrandReadsAssigned:7464503 NegativeStrandReadsAssigned:7443149 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208016 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208016-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,765,921 reads, 15,935,960 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,173 rounds 52401 SRR3208016.ke.tsv 34699 SRR3208016.se.tsv 87100 total ==> SRR3208016.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1181 49.9375 Potri.005G024800.1.v4.1 1035 936 2783 241.262 Potri.004G059700.1.v4.1 961 862 6 0.564801 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 352.383 10.054 Potri.016G087400.1.v4.1 270 171 456 216.382 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 115 5.57435 Potri.012G127500.1.v4.1 977 878 2561 236.683 ==> SRR3208016.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1128 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 270 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 18 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 29 SRR3208016 completed mapping pipeline successfully