Starting /dee2/code/volunteer_pipeline.sh SRR3208017 current disk space = 3050701742080 free memory = 1579968072 SRR3208017 SRAfilesize dcd1a07fdc0664962b749dd080ea0acd SRR3208017.sra SRR3208017.sra file validated SRR3208017 is single end SRR3208017 is conventional basespace SRR3208017 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208017_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.03125 33.0 33.0 33.0 33.0 33.0 2 32.4005 33.0 33.0 33.0 33.0 33.0 3 32.47325 33.0 33.0 33.0 33.0 33.0 4 32.50625 33.0 33.0 33.0 33.0 33.0 5 32.5685 33.0 33.0 33.0 33.0 33.0 6 36.1875 37.0 37.0 37.0 37.0 37.0 7 36.30225 37.0 37.0 37.0 37.0 37.0 8 36.359 37.0 37.0 37.0 37.0 37.0 9 36.3315 37.0 37.0 37.0 37.0 37.0 10-11 36.345625 37.0 37.0 37.0 37.0 37.0 12-13 36.388 37.0 37.0 37.0 37.0 37.0 14-15 36.416375 37.0 37.0 37.0 37.0 37.0 16-17 36.357124999999996 37.0 37.0 37.0 37.0 37.0 18-19 36.3715 37.0 37.0 37.0 37.0 37.0 20-21 36.419875000000005 37.0 37.0 37.0 37.0 37.0 22-23 36.39725 37.0 37.0 37.0 37.0 37.0 24-25 36.400875 37.0 37.0 37.0 37.0 37.0 26-27 36.344875 37.0 37.0 37.0 37.0 37.0 28-29 36.392875000000004 37.0 37.0 37.0 37.0 37.0 30-31 36.348 37.0 37.0 37.0 37.0 37.0 32-33 36.383125 37.0 37.0 37.0 37.0 37.0 34-35 36.39425 37.0 37.0 37.0 37.0 37.0 36-37 36.38525 37.0 37.0 37.0 37.0 37.0 38-39 36.38975 37.0 37.0 37.0 37.0 37.0 40-41 36.381 37.0 37.0 37.0 37.0 37.0 42-43 36.417375 37.0 37.0 37.0 37.0 37.0 44-45 36.358374999999995 37.0 37.0 37.0 37.0 37.0 46-47 36.43675 37.0 37.0 37.0 37.0 37.0 48-49 36.375 37.0 37.0 37.0 37.0 37.0 50-51 36.419250000000005 37.0 37.0 37.0 37.0 37.0 52-53 36.40775 37.0 37.0 37.0 37.0 37.0 54-55 36.40325 37.0 37.0 37.0 37.0 37.0 56-57 36.393249999999995 37.0 37.0 37.0 37.0 37.0 58-59 36.337875 37.0 37.0 37.0 37.0 37.0 60-61 36.331125 37.0 37.0 37.0 37.0 37.0 62-63 36.317375 37.0 37.0 37.0 37.0 37.0 64-65 36.313625 37.0 37.0 37.0 37.0 37.0 66-67 36.26375 37.0 37.0 37.0 37.0 37.0 68-69 36.16875 37.0 37.0 37.0 37.0 37.0 70-71 36.112875 37.0 37.0 37.0 37.0 37.0 72-73 36.127250000000004 37.0 37.0 37.0 37.0 37.0 74-75 36.107375000000005 37.0 37.0 37.0 37.0 37.0 76-77 35.486625000000004 37.0 37.0 37.0 37.0 37.0 78-79 35.45025 37.0 37.0 37.0 37.0 37.0 80-81 35.435375 37.0 37.0 37.0 37.0 37.0 82-83 35.465375 37.0 37.0 37.0 37.0 37.0 84-85 35.37375 37.0 37.0 37.0 37.0 37.0 86-87 35.480875 37.0 37.0 37.0 37.0 37.0 88-89 35.50175 37.0 37.0 37.0 37.0 37.0 90-91 35.4625 37.0 37.0 37.0 37.0 37.0 92-93 35.416125 37.0 37.0 37.0 37.0 37.0 94-95 35.395624999999995 37.0 37.0 37.0 37.0 37.0 96-97 35.419125 37.0 37.0 37.0 37.0 37.0 98-99 35.429125 37.0 37.0 37.0 37.0 37.0 100-101 35.460125000000005 37.0 37.0 37.0 37.0 37.0 102-103 35.36987499999999 37.0 37.0 37.0 37.0 37.0 104-105 35.27975 37.0 37.0 37.0 37.0 37.0 106-107 35.246375 37.0 37.0 37.0 37.0 37.0 108-109 35.262874999999994 37.0 37.0 37.0 37.0 37.0 110-111 35.187875 37.0 37.0 37.0 37.0 37.0 112-113 35.2425 37.0 37.0 37.0 37.0 37.0 114-115 35.2235 37.0 37.0 37.0 37.0 37.0 116-117 35.139375 37.0 37.0 37.0 37.0 37.0 118-119 35.082125000000005 37.0 37.0 37.0 37.0 37.0 120-121 35.09925 37.0 37.0 37.0 37.0 37.0 122-123 34.984875 37.0 37.0 37.0 37.0 37.0 124-125 33.872749999999996 37.0 37.0 37.0 29.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 2.0 4 0.0 5 0.0 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 2.0 13 1.0 14 0.0 15 3.0 16 0.0 17 1.0 18 2.0 19 3.0 20 7.0 21 10.0 22 65.0 23 13.0 24 4.0 25 8.0 26 12.0 27 6.0 28 16.0 29 24.0 30 27.0 31 22.0 32 41.0 33 73.0 34 98.0 35 191.0 36 3354.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.07598784194529 15.780141843971633 13.728470111448834 45.415400202634245 2 19.279819954988746 23.755938984746187 38.05951487871968 18.904726181545385 3 21.075 24.675 29.549999999999997 24.7 4 23.5 30.4 20.7 25.4 5 25.924999999999997 33.525 22.15 18.4 6 21.5 35.975 23.0 19.525000000000002 7 16.375 22.05 41.375 20.200000000000003 8 17.325 26.075 29.225 27.375 9 21.9 23.625 30.7 23.775 10-11 23.799999999999997 33.225 22.3 20.674999999999997 12-13 20.4875 27.375 28.462500000000002 23.674999999999997 14-15 21.625 28.050000000000004 27.1375 23.1875 16-17 22.625 27.175 27.4125 22.787499999999998 18-19 21.15 28.775000000000002 28.075 22.0 20-21 22.0625 27.6625 28.175 22.1 22-23 21.2625 30.65 26.875 21.212500000000002 24-25 20.575 28.000000000000004 27.750000000000004 23.674999999999997 26-27 21.175 27.537499999999998 27.025 24.2625 28-29 22.650000000000002 29.1125 26.400000000000002 21.837500000000002 30-31 21.1875 26.8125 28.599999999999998 23.400000000000002 32-33 21.175 29.5875 26.474999999999998 22.7625 34-35 21.1625 28.075 28.6625 22.1 36-37 21.349999999999998 28.199999999999996 28.9375 21.512500000000003 38-39 21.4875 28.4 27.400000000000002 22.7125 40-41 23.1875 29.599999999999998 26.5125 20.7 42-43 21.0125 28.7 29.362500000000004 20.925 44-45 21.325 27.875 28.199999999999996 22.6 46-47 22.05 27.05 27.3375 23.5625 48-49 21.1125 28.499999999999996 28.599999999999998 21.7875 50-51 22.425 27.750000000000004 28.325 21.5 52-53 22.325 27.224999999999998 26.337500000000002 24.1125 54-55 22.4625 26.887499999999996 29.175 21.475 56-57 21.6125 27.537499999999998 27.775 23.075000000000003 58-59 21.25 27.05 28.199999999999996 23.5 60-61 21.825 28.287499999999998 28.8875 21.0 62-63 21.125 26.437500000000004 28.775000000000002 23.6625 64-65 21.7375 27.250000000000004 29.225 21.7875 66-67 22.0 29.525000000000002 26.75 21.725 68-69 21.380345086271568 30.095023755938982 27.094273568392097 21.43035758939735 70-71 21.587500000000002 29.9375 26.375 22.1 72-73 21.61520190023753 29.7662207775972 26.115764470558823 22.502812851606453 74-75 21.075 30.412499999999998 27.55 20.962500000000002 76-77 22.352794099262407 29.603700462557818 26.153269158644832 21.890236279534943 78-79 21.962207483418847 29.73345013139782 26.604930546865223 21.69941183831811 80-81 22.058087130696045 28.793189784677015 27.41612418627942 21.732598898347522 82-83 22.1707561342013 28.079619429143715 27.566349524286434 22.183274912368553 84-85 21.894157387714248 28.487426498185915 27.44901789065432 22.169398223445516 86-87 22.925 27.4125 27.5125 22.15 88-89 22.4375 29.349999999999998 27.0875 21.125 90-91 22.365295661957745 27.378422302787847 27.55344418052256 22.702837854731843 92-93 22.075 27.224999999999998 27.8375 22.8625 94-95 22.8625 28.812500000000004 26.8125 21.512500000000003 96-97 22.162499999999998 28.050000000000004 26.987499999999997 22.8 98-99 22.5875 29.3375 26.35 21.725 100-101 21.025 29.975 27.250000000000004 21.75 102-103 22.55 28.1 28.425 20.925 104-105 22.763108497059193 28.444500062570395 26.905268426980356 21.887123013390063 106-107 22.76595744680851 29.111389236545683 27.672090112640802 20.450563204005007 108-109 22.604453340005005 28.04603452589442 27.72079059294471 21.62872154115587 110-111 22.683506314868076 28.660747780417655 27.46029761160435 21.195448293109916 112-113 22.8 28.675 26.0375 22.4875 114-115 22.828535669586984 29.173967459324157 26.458072590738425 21.53942428035044 116-117 22.8978978978979 28.27827827827828 26.676676676676674 22.147147147147148 118-119 22.644814212435882 27.886901038408606 27.186288002001753 22.28199674715376 120-121 23.590448806100763 28.9536192024003 25.95324415551944 21.502687835979497 122-123 23.55222013758599 28.655409631019385 25.465916197623518 22.326454033771107 124-125 23.42263395092639 29.031046569854784 25.450676014021035 22.0956434651978 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 0.5 24 3.5 25 4.5 26 5.0 27 9.0 28 13.0 29 16.5 30 20.5 31 28.0 32 39.5 33 51.5 34 61.5 35 73.5 36 89.0 37 117.0 38 142.5 39 146.0 40 171.5 41 205.0 42 241.0 43 279.0 44 274.0 45 252.0 46 250.0 47 239.5 48 206.5 49 186.5 50 167.0 51 133.0 52 111.5 53 96.5 54 72.5 55 60.5 56 45.5 57 32.5 58 30.0 59 19.5 60 15.0 61 16.0 62 15.5 63 13.0 64 7.5 65 5.5 66 4.0 67 4.5 68 6.0 69 3.5 70 0.5 71 0.5 72 0.5 73 3.5 74 4.0 75 1.0 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.3 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.025 70-71 0.0 72-73 0.0125 74-75 0.0 76-77 0.0125 78-79 0.11249999999999999 80-81 0.15 82-83 0.15 84-85 0.08750000000000001 86-87 0.0 88-89 0.0 90-91 0.0125 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.11249999999999999 106-107 0.125 108-109 0.075 110-111 0.0375 112-113 0.0 114-115 0.125 116-117 0.1 118-119 0.08750000000000001 120-121 0.0125 122-123 0.0625 124-125 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4836044410018 96.325 2 0.4389362251484637 0.8500000000000001 3 0.0 0.0 4 0.02581977794990963 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02581977794990963 0.44999999999999996 >50 0.02581977794990963 2.275 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTAT 91 2.275 TruSeq Adapter, Index 15 (97% over 40bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTA 18 0.44999999999999996 TruSeq Adapter, Index 15 (97% over 40bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.45 0.0 0.0 0.0 0.0 2 0.45 0.0 0.0 0.0 0.0 3 0.45 0.0 0.0 0.0 0.0 4 0.45 0.0 0.0 0.0 0.0 5 0.45 0.0 0.0 0.0 0.0 6 0.45 0.0 0.0 0.0 0.0 7 0.45 0.0 0.0 0.0 0.0 8 0.45 0.0 0.0 0.0 0.0 9 0.45 0.0 0.0 0.0 0.0 10-11 0.45 0.0 0.0 0.0 0.0 12-13 0.45 0.0 0.0 0.0 0.0 14-15 0.45 0.0 0.0 0.0 0.0 16-17 0.45 0.0 0.0 0.0 0.0 18-19 0.475 0.0 0.0 0.0 0.0 20-21 0.4875 0.0 0.0 0.0 0.0 22-23 0.5 0.0 0.0 0.0 0.0 24-25 0.5 0.0 0.0 0.0 0.0 26-27 0.5 0.0 0.0 0.0 0.0 28-29 0.5 0.0 0.0 0.0 0.0 30-31 0.5 0.0 0.0 0.0 0.0 32-33 0.5 0.0 0.0 0.0 0.0 34-35 0.5 0.0 0.0 0.0 0.0 36-37 0.5 0.0 0.0 0.0 0.0 38-39 0.5 0.0 0.0 0.0 0.0 40-41 0.5 0.0 0.0 0.0 0.0 42-43 0.5 0.0 0.0 0.0 0.0 44-45 0.5 0.0 0.0 0.0 0.0 46-47 0.525 0.0 0.0 0.0 0.0 48-49 0.525 0.0 0.0 0.0 0.0 50-51 0.525 0.0 0.0 0.0 0.0 52-53 0.525 0.0 0.0 0.0 0.0 54-55 0.525 0.0 0.0 0.0 0.0 56-57 0.525 0.0 0.0 0.0 0.0 58-59 0.525 0.0 0.0 0.0 0.0 60-61 0.525 0.0 0.0 0.0 0.0 62-63 0.525 0.0 0.0 0.0 0.0 64-65 0.5874999999999999 0.0 0.0 0.0 0.0 66-67 0.65 0.0 0.0 0.0 0.0 68-69 0.65 0.0 0.0 0.0 0.0 70-71 0.65 0.0 0.0 0.0 0.0 72-73 0.6625000000000001 0.0 0.0 0.0 0.0 74-75 0.7 0.0 0.0 0.0 0.0 76-77 0.7 0.0 0.0 0.0 0.0 78-79 0.7625 0.0 0.0 0.0 0.0 80-81 0.8125 0.0 0.0 0.0 0.0 82-83 0.825 0.0 0.0 0.0 0.0 84-85 0.8625 0.0 0.0 0.0 0.0 86-87 0.9 0.0 0.0 0.0 0.0 88-89 1.15 0.0 0.0 0.0 0.0 90-91 1.3375 0.0 0.0 0.0 0.0 92-93 1.575 0.0 0.0 0.0 0.0 94-95 1.675 0.0 0.0 0.0 0.0 96-97 1.8875000000000002 0.0 0.0 0.0 0.0 98-99 2.1875 0.0 0.0 0.0 0.0 100-101 2.4625 0.0 0.0 0.0 0.0 102-103 2.9375 0.0 0.0 0.0 0.0 104-105 3.7125 0.0 0.0 0.0 0.0 106-107 4.625 0.0 0.0 0.0 0.0 108-109 5.3125 0.0 0.0 0.0 0.0 110-111 6.1125 0.0 0.0 0.0 0.0 112-113 7.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCTTCT 25 6.8044446E-6 59.49375 54-55 ATCTCGT 30 2.0038466E-5 49.57813 42-43 ACATGTC 30 2.0038466E-5 49.57813 32-33 TGCCGTC 30 2.0038466E-5 49.57813 50-51 TATGCCG 30 2.0038466E-5 49.57813 48-49 TCTGCTT 30 2.0038466E-5 49.57813 58-59 CGTATGC 30 2.0038466E-5 49.57813 46-47 GAATCTC 30 2.0038466E-5 49.57813 40-41 ATGTCAG 30 2.0038466E-5 49.57813 34-35 TCACATG 30 2.0038466E-5 49.57813 30-31 GTCAGAA 30 2.0038466E-5 49.57813 36-37 AGTCACA 30 2.0038466E-5 49.57813 28-29 CTTCTGC 30 2.0038466E-5 49.57813 56-57 TGAAAAA 30 2.0038466E-5 49.57813 64-65 AGAGCAC 50 4.7195115E-4 47.595 8 GAAGAGC 55 7.551131E-4 43.26818 6 GAGCACA 55 7.551131E-4 43.26818 9 CCAGTCA 35 4.983457E-5 42.495537 26-27 CTCCAGT 35 4.983457E-5 42.495537 24-25 CCGTCTT 35 4.983457E-5 42.495537 52-53 >>END_MODULE Read 515706 spots for SRR3208017.sra Written 515706 spots for SRR3208017.sra Read 515706 spots for SRR3208017.sra Written 515706 spots for SRR3208017.sra Read 515706 spots for SRR3208017.sra Written 515706 spots for SRR3208017.sra Read 515706 spots for SRR3208017.sra Written 515706 spots for SRR3208017.sra Read 515706 spots for SRR3208017.sra Written 515706 spots for SRR3208017.sra Read 515706 spots for SRR3208017.sra Written 515706 spots for SRR3208017.sra Read 515706 spots for SRR3208017.sra Written 515706 spots for SRR3208017.sra Read 515706 spots for SRR3208017.sra Written 515706 spots for SRR3208017.sra Read 515706 spots for SRR3208017.sra Written 515706 spots for SRR3208017.sra Read 515706 spots for SRR3208017.sra Written 515706 spots for SRR3208017.sra Read 515706 spots for SRR3208017.sra Written 515706 spots for SRR3208017.sra Read 515706 spots for SRR3208017.sra Written 515706 spots for SRR3208017.sra Read 515706 spots for SRR3208017.sra Written 515706 spots for SRR3208017.sra Read 515706 spots for SRR3208017.sra Written 515706 spots for SRR3208017.sra Read 515706 spots for SRR3208017.sra Written 515706 spots for SRR3208017.sra Read 515706 spots for SRR3208017.sra Written 515706 spots for SRR3208017.sra Read 515714 spots for SRR3208017.sra Written 515714 spots for SRR3208017.sra Read 515706 spots for SRR3208017.sra Written 515706 spots for SRR3208017.sra Read 515706 spots for SRR3208017.sra Written 515706 spots for SRR3208017.sra Read 515706 spots for SRR3208017.sra Written 515706 spots for SRR3208017.sra SRR ids: ['SRR3208017.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r7hwjyv0 SRR3208017.sra spots: 10314128 blocks: [[1, 515706], [515707, 1031412], [1031413, 1547118], [1547119, 2062824], [2062825, 2578530], [2578531, 3094236], [3094237, 3609942], [3609943, 4125648], [4125649, 4641354], [4641355, 5157060], [5157061, 5672766], [5672767, 6188472], [6188473, 6704178], [6704179, 7219884], [7219885, 7735590], [7735591, 8251296], [8251297, 8767002], [8767003, 9282708], [9282709, 9798414], [9798415, 10314128]] SRR3208017 file size 3297880 SRR3208017 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208017 SRR3208017_1.fastq Input file: SRR3208017_1.fastq trimmed: SRR3208017-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 01:54:04 2025 >> started Wed Feb 12 01:54:10 2025 >> done (5.392s) 10314128 reads processed; of these: 13669 ( 0.13%) short reads filtered out after trimming by size control 320019 ( 3.10%) empty reads filtered out after trimming by size control 9980440 (96.76%) reads available; of these: 1090504 (10.93%) trimmed reads available after processing 8889936 (89.07%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 516 0.01% 19 411 0.00% 20 555 0.01% 21 469 0.00% 22 514 0.01% 23 562 0.01% 24 617 0.01% 25 695 0.01% 26 674 0.01% 27 644 0.01% 28 674 0.01% 29 726 0.01% 30 1087 0.01% 31 895 0.01% 32 1257 0.01% 33 1095 0.01% 34 680 0.01% 35 656 0.01% 36 667 0.01% 37 647 0.01% 38 667 0.01% 39 695 0.01% 40 1145 0.01% 41 709 0.01% 42 706 0.01% 43 719 0.01% 44 761 0.01% 45 706 0.01% 46 698 0.01% 47 724 0.01% 48 720 0.01% 49 717 0.01% 50 796 0.01% 51 789 0.01% 52 844 0.01% 53 821 0.01% 54 891 0.01% 55 881 0.01% 56 865 0.01% 57 1001 0.01% 58 1046 0.01% 59 1109 0.01% 60 1209 0.01% 61 1180 0.01% 62 1495 0.01% 63 1320 0.01% 64 2060 0.02% 65 10927 0.11% 66 2526 0.03% 67 1775 0.02% 68 1622 0.02% 69 1866 0.02% 70 1860 0.02% 71 1965 0.02% 72 2028 0.02% 73 2300 0.02% 74 3385 0.03% 75 5286 0.05% 76 7469 0.07% 77 3904 0.04% 78 3060 0.03% 79 3171 0.03% 80 3472 0.03% 81 3904 0.04% 82 4375 0.04% 83 4724 0.05% 84 5121 0.05% 85 5513 0.06% 86 6032 0.06% 87 6435 0.06% 88 7270 0.07% 89 8285 0.08% 90 9583 0.10% 91 11660 0.12% 92 12297 0.12% 93 13343 0.13% 94 1508 0.02% 95 1540 0.02% 96 1635 0.02% 97 1928 0.02% 98 1794 0.02% 99 1875 0.02% 100 2138 0.02% 101 2053 0.02% 102 2349 0.02% 103 3315 0.03% 104 2601 0.03% 105 2487 0.02% 106 2706 0.03% 107 2937 0.03% 108 3149 0.03% 109 3500 0.04% 110 3882 0.04% 111 4079 0.04% 112 4641 0.05% 113 5277 0.05% 114 6047 0.06% 115 7104 0.07% 116 8799 0.09% 117 9936 0.10% 118 12204 0.12% 119 15908 0.16% 120 21178 0.21% 121 29435 0.29% 122 48347 0.48% 123 104116 1.04% 124 577563 5.79% 125 8889936 89.07% 9980440 reads passed initial QC criterion=sequence-density sequence-density=5.91 sequence-density-rank=1 fanout-score=52.94 fanout-score-rank=1 prefix-density=7.83 prefix-fanout=40.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=5.91 sequence-density-rank=1 fanout-score=52.94 fanout-score-rank=1 prefix-density=7.83 prefix-fanout=40.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR3208017 - Input file: STDIN trimmed: SRR3208017-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 01:54:40 2025 >> started Wed Feb 12 01:54:47 2025 >> done (6.893s) 6653627 reads processed; of these: 435 ( 0.01%) short reads filtered out after trimming by size control 18209 ( 0.27%) empty reads filtered out after trimming by size control 6634983 (99.72%) reads available; of these: 1056758 (15.93%) trimmed reads available after processing 5578225 (84.07%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 346 0.01% 19 311 0.00% 20 383 0.01% 21 311 0.00% 22 366 0.01% 23 382 0.01% 24 396 0.01% 25 481 0.01% 26 431 0.01% 27 431 0.01% 28 417 0.01% 29 490 0.01% 30 745 0.01% 31 609 0.01% 32 863 0.01% 33 942 0.01% 34 473 0.01% 35 420 0.01% 36 444 0.01% 37 415 0.01% 38 431 0.01% 39 460 0.01% 40 979 0.01% 41 501 0.01% 42 475 0.01% 43 491 0.01% 44 530 0.01% 45 494 0.01% 46 468 0.01% 47 470 0.01% 48 506 0.01% 49 504 0.01% 50 543 0.01% 51 526 0.01% 52 578 0.01% 53 568 0.01% 54 587 0.01% 55 600 0.01% 56 593 0.01% 57 650 0.01% 58 696 0.01% 59 733 0.01% 60 804 0.01% 61 751 0.01% 62 962 0.01% 63 825 0.01% 64 906 0.01% 65 855 0.01% 66 1018 0.02% 67 1050 0.02% 68 1024 0.02% 69 1233 0.02% 70 1160 0.02% 71 1254 0.02% 72 1285 0.02% 73 1352 0.02% 74 1431 0.02% 75 1405 0.02% 76 1524 0.02% 77 1674 0.03% 78 1899 0.03% 79 2107 0.03% 80 2341 0.04% 81 2603 0.04% 82 2870 0.04% 83 3159 0.05% 84 3424 0.05% 85 3678 0.06% 86 4032 0.06% 87 4335 0.07% 88 4825 0.07% 89 5504 0.08% 90 6323 0.10% 91 7144 0.11% 92 8163 0.12% 93 9103 0.14% 94 10127 0.15% 95 11060 0.17% 96 11689 0.18% 97 12833 0.19% 98 13776 0.21% 99 15409 0.23% 100 17019 0.26% 101 18905 0.28% 102 21488 0.32% 103 24291 0.37% 104 25618 0.39% 105 26991 0.41% 106 27841 0.42% 107 29093 0.44% 108 30713 0.46% 109 32485 0.49% 110 35504 0.54% 111 38577 0.58% 112 42042 0.63% 113 45165 0.68% 114 48005 0.72% 115 50272 0.76% 116 51846 0.78% 117 52775 0.80% 118 55357 0.83% 119 59769 0.90% 120 71276 1.07% 121 100371 1.51% 122 202201 3.05% 123 60610 0.91% 124 336166 5.07% 125 4941647 74.48% criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=31 prefix-density=0.11 prefix-fanout=2.0 sequence=CCTCTACTGTGGCCTAACCCTATGGCTCAACACCATTTCCCTAAGTTCAGCTGGATCAATCTCTGCTACATAATTAGCAGGCCTGTAATACCCAGTAACTGGATCAGGAGCCCATGCAGAGTAGGCCTCAGAATCTTCTTTGGCCACCGCCCCATCTTCCATTTTCCCTGTCATAGCACTGGTCCTTGACCCACCCCTACCGAAGCTCGCTGTTACAGCAGCACTGATCGGTGCAGCAGCCGCGTAACCTCTCCGGAAAACAGAGAGGGAAAGACCATCAGCAAGAGAAGCGACAAGAAGCTTAGCGTTTGGGAGAGAGCGAGCCATTTTATTTATGGTTTTCGTGTATATATATAGCTGCAGATGATACCGCAAATTCTTCTTGGAGTGGATTCTCAAGAAGAACAGCG criterion=fanout-score sequence-density=0.05 sequence-density-rank=12 fanout-score=248.70 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=27.7 sequence=AAGAAGAAGAAA Started job on | Feb 12 01:55:11 Started mapping on | Feb 12 01:55:11 Finished on | Feb 12 01:55:29 Mapping speed, Million of reads per hour | 1992.36 Number of input reads | 9961796 Average input read length | 122 UNIQUE READS: Uniquely mapped reads number | 9144114 Uniquely mapped reads % | 91.79% Average mapped length | 121.91 Number of splices: Total | 3320150 Number of splices: Annotated (sjdb) | 3243791 Number of splices: GT/AG | 3264276 Number of splices: GC/AG | 45032 Number of splices: AT/AC | 3899 Number of splices: Non-canonical | 6943 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 1.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 226368 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 300682 % of reads mapped to too many loci | 3.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.91% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 591314 591314 591314 N_multimapping 226368 226368 226368 N_noFeature 462901 4771001 4775000 N_ambiguous 102167 20886 20444 UnstrandedReadsAssigned:8579046 PositiveStrandReadsAssigned:4352227 NegativeStrandReadsAssigned:4348670 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=123 echo kmer=119 SRR3208017 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208017-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,961,796 reads, 9,029,326 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,147 rounds 52401 SRR3208017.ke.tsv 34699 SRR3208017.se.tsv 87100 total ==> SRR3208017.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 786 60.8989 Potri.005G024800.1.v4.1 1035 936 2562 406.972 Potri.004G059700.1.v4.1 961 862 3 0.517459 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 217 11.3447 Potri.016G087400.1.v4.1 270 171 248 215.634 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 117.187 10.4084 Potri.012G127500.1.v4.1 977 878 3204 542.575 ==> SRR3208017.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 540 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 157 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 14 SRR3208017 completed mapping pipeline successfully