Starting /dee2/code/volunteer_pipeline.sh SRR3208018 current disk space = 3051228688384 free memory = 1472569156 SRR3208018 SRAfilesize 4b85de6bedc382bff83750244034f6b5 SRR3208018.sra SRR3208018.sra file validated SRR3208018 is single end SRR3208018 is conventional basespace SRR3208018 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208018_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.92625 33.0 33.0 33.0 33.0 33.0 2 32.348 33.0 33.0 33.0 33.0 33.0 3 32.36475 33.0 33.0 33.0 33.0 33.0 4 32.4035 33.0 33.0 33.0 33.0 33.0 5 32.48 33.0 33.0 33.0 33.0 33.0 6 36.17375 37.0 37.0 37.0 37.0 37.0 7 36.36525 37.0 37.0 37.0 37.0 37.0 8 36.35325 37.0 37.0 37.0 37.0 37.0 9 36.327 37.0 37.0 37.0 37.0 37.0 10-11 36.366875 37.0 37.0 37.0 37.0 37.0 12-13 36.36725 37.0 37.0 37.0 37.0 37.0 14-15 36.407125 37.0 37.0 37.0 37.0 37.0 16-17 36.361374999999995 37.0 37.0 37.0 37.0 37.0 18-19 36.37025 37.0 37.0 37.0 37.0 37.0 20-21 36.334 37.0 37.0 37.0 37.0 37.0 22-23 36.311125000000004 37.0 37.0 37.0 37.0 37.0 24-25 36.351625 37.0 37.0 37.0 37.0 37.0 26-27 36.25675 37.0 37.0 37.0 37.0 37.0 28-29 36.403999999999996 37.0 37.0 37.0 37.0 37.0 30-31 36.379875 37.0 37.0 37.0 37.0 37.0 32-33 36.364875 37.0 37.0 37.0 37.0 37.0 34-35 36.319500000000005 37.0 37.0 37.0 37.0 37.0 36-37 36.33725 37.0 37.0 37.0 37.0 37.0 38-39 36.40625 37.0 37.0 37.0 37.0 37.0 40-41 36.318875 37.0 37.0 37.0 37.0 37.0 42-43 36.331875 37.0 37.0 37.0 37.0 37.0 44-45 36.37375 37.0 37.0 37.0 37.0 37.0 46-47 36.38375 37.0 37.0 37.0 37.0 37.0 48-49 36.396874999999994 37.0 37.0 37.0 37.0 37.0 50-51 36.37425 37.0 37.0 37.0 37.0 37.0 52-53 36.3775 37.0 37.0 37.0 37.0 37.0 54-55 36.398 37.0 37.0 37.0 37.0 37.0 56-57 36.423625 37.0 37.0 37.0 37.0 37.0 58-59 36.361875 37.0 37.0 37.0 37.0 37.0 60-61 36.332875 37.0 37.0 37.0 37.0 37.0 62-63 36.333375000000004 37.0 37.0 37.0 37.0 37.0 64-65 36.281125 37.0 37.0 37.0 37.0 37.0 66-67 36.25 37.0 37.0 37.0 37.0 37.0 68-69 36.270375 37.0 37.0 37.0 37.0 37.0 70-71 36.310500000000005 37.0 37.0 37.0 37.0 37.0 72-73 36.279625 37.0 37.0 37.0 37.0 37.0 74-75 36.205875000000006 37.0 37.0 37.0 37.0 37.0 76-77 36.176375 37.0 37.0 37.0 37.0 37.0 78-79 36.172124999999994 37.0 37.0 37.0 37.0 37.0 80-81 36.149 37.0 37.0 37.0 37.0 37.0 82-83 36.19175 37.0 37.0 37.0 37.0 37.0 84-85 36.156 37.0 37.0 37.0 37.0 37.0 86-87 36.180875 37.0 37.0 37.0 37.0 37.0 88-89 36.231375 37.0 37.0 37.0 37.0 37.0 90-91 36.215625 37.0 37.0 37.0 37.0 37.0 92-93 36.123625000000004 37.0 37.0 37.0 37.0 37.0 94-95 36.1285 37.0 37.0 37.0 37.0 37.0 96-97 36.094625 37.0 37.0 37.0 37.0 37.0 98-99 36.085625 37.0 37.0 37.0 37.0 37.0 100-101 36.09375 37.0 37.0 37.0 37.0 37.0 102-103 36.096000000000004 37.0 37.0 37.0 37.0 37.0 104-105 36.018125 37.0 37.0 37.0 37.0 37.0 106-107 36.03675 37.0 37.0 37.0 37.0 37.0 108-109 35.998125 37.0 37.0 37.0 37.0 37.0 110-111 35.878125 37.0 37.0 37.0 37.0 37.0 112-113 35.827625 37.0 37.0 37.0 37.0 37.0 114-115 35.925625 37.0 37.0 37.0 37.0 37.0 116-117 35.878875 37.0 37.0 37.0 37.0 37.0 118-119 35.813 37.0 37.0 37.0 37.0 37.0 120-121 35.817875 37.0 37.0 37.0 37.0 37.0 122-123 35.797124999999994 37.0 37.0 37.0 37.0 37.0 124-125 34.57625 37.0 37.0 37.0 32.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 2.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 2.0 17 3.0 18 2.0 19 1.0 20 1.0 21 3.0 22 4.0 23 5.0 24 4.0 25 5.0 26 14.0 27 9.0 28 10.0 29 22.0 30 21.0 31 39.0 32 46.0 33 80.0 34 104.0 35 219.0 36 3387.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.402432843385707 15.737455651292448 11.733400912316268 50.126710593005576 2 17.97949487371843 22.330582645661416 40.63515878969742 19.05476369092273 3 20.95 25.525 27.525 26.0 4 24.125 31.65 21.075 23.150000000000002 5 25.6 34.475 22.075 17.849999999999998 6 20.375 35.525 23.974999999999998 20.125 7 17.299999999999997 18.375 43.9 20.424999999999997 8 19.975 22.925 29.725 27.375 9 20.974999999999998 23.7 32.725 22.6 10-11 22.5125 32.925 23.225 21.337500000000002 12-13 20.7375 26.275 30.099999999999998 22.8875 14-15 21.2375 27.474999999999998 28.449999999999996 22.8375 16-17 21.675 27.5625 27.500000000000004 23.2625 18-19 21.6875 28.6375 26.4125 23.2625 20-21 21.375 28.8625 26.974999999999998 22.787499999999998 22-23 21.0625 28.449999999999996 27.775 22.7125 24-25 22.3625 27.575 27.0 23.0625 26-27 22.4625 27.5125 27.9375 22.0875 28-29 21.6 29.7 27.025 21.675 30-31 21.5375 27.750000000000004 28.1625 22.55 32-33 21.675 27.950000000000003 27.150000000000002 23.225 34-35 22.3375 27.775 27.237499999999997 22.650000000000002 36-37 21.987499999999997 27.3375 28.050000000000004 22.625 38-39 21.6 28.787499999999998 27.1375 22.475 40-41 22.6875 27.85 27.200000000000003 22.2625 42-43 22.3 28.3625 27.425 21.912499999999998 44-45 21.5375 27.750000000000004 28.050000000000004 22.662499999999998 46-47 22.4875 27.650000000000002 27.625 22.237499999999997 48-49 22.5625 27.474999999999998 27.3125 22.650000000000002 50-51 22.037499999999998 28.825 27.525 21.6125 52-53 22.6125 27.675 27.675 22.037499999999998 54-55 22.175 28.525 27.8625 21.4375 56-57 21.9375 27.925 28.025 22.112499999999997 58-59 22.5625 28.15 28.3625 20.925 60-61 23.200000000000003 27.0125 27.3 22.4875 62-63 21.4375 28.287499999999998 28.1625 22.112499999999997 64-65 22.118029507376843 28.619654913728432 27.46936734183546 21.792948237059264 66-67 22.325 27.6125 27.750000000000004 22.3125 68-69 22.6072813711998 27.886901038408606 27.186288002001753 22.31952958838984 70-71 21.9625 28.512500000000003 27.025 22.5 72-73 22.063789868667918 28.2801751094434 27.204502814258912 22.451532207629768 74-75 21.725 28.050000000000004 28.175 22.05 76-77 22.37088908340628 28.03551331749406 26.997624109040892 22.59597349005877 78-79 21.92587027297771 27.222639619333833 28.92561983471074 21.92587027297771 80-81 23.178061607813675 27.535687453042822 27.498121712997747 21.788129226145756 82-83 22.26953907815631 28.369238476953907 27.304609218436877 22.056613226452907 84-85 22.108162243365047 27.491236855282924 28.492739108662995 21.907861792689033 86-87 22.0 28.212500000000002 27.474999999999998 22.3125 88-89 22.112499999999997 28.212500000000002 27.900000000000002 21.775 90-91 22.843210802700675 27.33183295823956 27.081770442610654 22.74318579644911 92-93 21.9375 28.4375 27.425 22.2 94-95 22.75 27.3875 27.425 22.4375 96-97 22.2 28.487499999999997 27.6375 21.675 98-99 23.252906613326665 27.47843480435054 27.428428553569194 21.840230028753595 100-101 22.225 28.275 27.737499999999997 21.762500000000003 102-103 23.025000000000002 28.3125 27.224999999999998 21.4375 104-105 22.602053593789133 28.600050087653393 27.02228900576008 21.775607312797398 106-107 23.478587528174305 28.061607813673927 27.18507387928876 21.27473077886301 108-109 21.987235640095108 27.968965085721436 27.293204855462395 22.75059441872106 110-111 22.09433254097335 28.950331540097586 27.79932440885775 21.156011510071313 112-113 23.125 28.499999999999996 26.637499999999996 21.7375 114-115 23.052842474330077 28.224392687202602 27.059854745805158 21.66291009266216 116-117 22.721582373560338 28.980971457185777 26.877816725087634 21.41962944416625 118-119 23.08847453385058 28.306845200850955 26.75509948692279 21.84958077837567 120-121 22.38339377266475 28.373139927472803 27.072652244591723 22.170814055270725 122-123 24.33379206805955 28.70011259852371 25.409733516827227 21.55636181658952 124-125 24.06363522485281 29.136915946386072 25.47914317925592 21.320305649505197 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 3.0 24 3.0 25 4.0 26 5.0 27 6.0 28 9.5 29 18.0 30 23.5 31 28.0 32 35.0 33 43.0 34 57.0 35 71.5 36 96.0 37 120.0 38 138.0 39 157.0 40 180.0 41 201.0 42 225.0 43 244.5 44 256.5 45 261.0 46 247.0 47 242.5 48 223.0 49 185.0 50 160.5 51 144.0 52 117.0 53 91.5 54 78.0 55 56.0 56 41.5 57 38.5 58 33.5 59 27.0 60 21.0 61 17.5 62 13.5 63 11.0 64 9.5 65 5.5 66 5.0 67 6.5 68 5.0 69 4.0 70 2.5 71 1.5 72 2.5 73 5.5 74 4.5 75 3.0 76 3.0 77 1.5 78 2.5 79 2.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.35 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.025 66-67 0.0 68-69 0.08750000000000001 70-71 0.0 72-73 0.0625 74-75 0.0 76-77 0.0375 78-79 0.17500000000000002 80-81 0.17500000000000002 82-83 0.2 84-85 0.15 86-87 0.0 88-89 0.0 90-91 0.025 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0125 100-101 0.0 102-103 0.0 104-105 0.17500000000000002 106-107 0.17500000000000002 108-109 0.11249999999999999 110-111 0.08750000000000001 112-113 0.0 114-115 0.17500000000000002 116-117 0.15 118-119 0.11249999999999999 120-121 0.0375 122-123 0.08750000000000001 124-125 0.21250000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37059415911381 98.675 2 0.5538771399798591 1.0999999999999999 3 0.0755287009063444 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.9375 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.525 0.0 0.0 0.0 0.0 102-103 1.85 0.0 0.0 0.0 0.0 104-105 2.225 0.0 0.0 0.0 0.0 106-107 2.8125 0.0 0.0 0.0 0.0 108-109 3.375 0.0 0.0 0.0 0.0 110-111 3.9125 0.0 0.0 0.0 0.0 112-113 4.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 649036 spots for SRR3208018.sra Written 649036 spots for SRR3208018.sra Read 649036 spots for SRR3208018.sra Written 649036 spots for SRR3208018.sra Read 649036 spots for SRR3208018.sra Written 649036 spots for SRR3208018.sra Read 649036 spots for SRR3208018.sra Written 649036 spots for SRR3208018.sra Read 649036 spots for SRR3208018.sra Written 649036 spots for SRR3208018.sra Read 649036 spots for SRR3208018.sra Written 649036 spots for SRR3208018.sra Read 649036 spots for SRR3208018.sra Written 649036 spots for SRR3208018.sra Read 649036 spots for SRR3208018.sra Written 649036 spots for SRR3208018.sra Read 649036 spots for SRR3208018.sra Written 649036 spots for SRR3208018.sra Read 649036 spots for SRR3208018.sra Written 649036 spots for SRR3208018.sra Read 649036 spots for SRR3208018.sra Written 649036 spots for SRR3208018.sra Read 649036 spots for SRR3208018.sra Written 649036 spots for SRR3208018.sra Read 649036 spots for SRR3208018.sra Written 649036 spots for SRR3208018.sra Read 649036 spots for SRR3208018.sra Written 649036 spots for SRR3208018.sra Read 649036 spots for SRR3208018.sra Written 649036 spots for SRR3208018.sra Read 649036 spots for SRR3208018.sra Written 649036 spots for SRR3208018.sra Read 649036 spots for SRR3208018.sra Written 649036 spots for SRR3208018.sra Read 649039 spots for SRR3208018.sra Written 649039 spots for SRR3208018.sra Read 649036 spots for SRR3208018.sra Written 649036 spots for SRR3208018.sra Read 649036 spots for SRR3208018.sra Written 649036 spots for SRR3208018.sra SRR ids: ['SRR3208018.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zbwqn5ef SRR3208018.sra spots: 12980723 blocks: [[1, 649036], [649037, 1298072], [1298073, 1947108], [1947109, 2596144], [2596145, 3245180], [3245181, 3894216], [3894217, 4543252], [4543253, 5192288], [5192289, 5841324], [5841325, 6490360], [6490361, 7139396], [7139397, 7788432], [7788433, 8437468], [8437469, 9086504], [9086505, 9735540], [9735541, 10384576], [10384577, 11033612], [11033613, 11682648], [11682649, 12331684], [12331685, 12980723]] SRR3208018 file size 4153316 SRR3208018 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208018 SRR3208018_1.fastq Input file: SRR3208018_1.fastq trimmed: SRR3208018-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 01:00:37 2025 >> started Wed Feb 12 01:00:44 2025 >> done (6.617s) 12980723 reads processed; of these: 9497 ( 0.07%) short reads filtered out after trimming by size control 35085 ( 0.27%) empty reads filtered out after trimming by size control 12936141 (99.66%) reads available; of these: 1345118 (10.40%) trimmed reads available after processing 11591023 (89.60%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 356 0.00% 19 325 0.00% 20 545 0.00% 21 435 0.00% 22 473 0.00% 23 547 0.00% 24 648 0.01% 25 748 0.01% 26 692 0.01% 27 640 0.00% 28 683 0.01% 29 822 0.01% 30 1254 0.01% 31 1310 0.01% 32 693 0.01% 33 639 0.00% 34 590 0.00% 35 607 0.00% 36 611 0.00% 37 642 0.00% 38 658 0.01% 39 660 0.01% 40 623 0.00% 41 672 0.01% 42 697 0.01% 43 675 0.01% 44 619 0.00% 45 652 0.01% 46 706 0.01% 47 702 0.01% 48 716 0.01% 49 721 0.01% 50 721 0.01% 51 785 0.01% 52 783 0.01% 53 738 0.01% 54 804 0.01% 55 871 0.01% 56 820 0.01% 57 919 0.01% 58 943 0.01% 59 940 0.01% 60 1042 0.01% 61 1025 0.01% 62 1368 0.01% 63 1026 0.01% 64 1190 0.01% 65 1079 0.01% 66 1083 0.01% 67 1284 0.01% 68 1164 0.01% 69 1308 0.01% 70 1301 0.01% 71 1489 0.01% 72 1502 0.01% 73 1644 0.01% 74 1749 0.01% 75 2030 0.02% 76 1978 0.02% 77 2020 0.02% 78 2144 0.02% 79 2295 0.02% 80 2598 0.02% 81 2865 0.02% 82 3158 0.02% 83 3672 0.03% 84 3831 0.03% 85 4153 0.03% 86 4508 0.03% 87 4995 0.04% 88 5558 0.04% 89 6450 0.05% 90 7283 0.06% 91 8514 0.07% 92 9703 0.08% 93 10831 0.08% 94 1767 0.01% 95 1783 0.01% 96 2051 0.02% 97 2386 0.02% 98 2163 0.02% 99 2091 0.02% 100 2374 0.02% 101 2486 0.02% 102 2893 0.02% 103 3995 0.03% 104 3024 0.02% 105 2953 0.02% 106 3214 0.02% 107 3394 0.03% 108 3782 0.03% 109 4199 0.03% 110 4700 0.04% 111 5211 0.04% 112 5742 0.04% 113 6655 0.05% 114 7675 0.06% 115 9131 0.07% 116 11179 0.09% 117 12708 0.10% 118 15563 0.12% 119 20547 0.16% 120 27799 0.21% 121 39664 0.31% 122 66618 0.51% 123 142526 1.10% 124 787320 6.09% 125 11591023 89.60% 12936141 reads passed initial QC criterion=sequence-density sequence-density=4.22 sequence-density-rank=1 fanout-score=48.94 fanout-score-rank=1 prefix-density=5.86 prefix-fanout=35.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA criterion=fanout-score sequence-density=4.22 sequence-density-rank=1 fanout-score=48.94 fanout-score-rank=1 prefix-density=5.86 prefix-fanout=35.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA -o SRR3208018 - Input file: STDIN trimmed: SRR3208018-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 01:01:20 2025 >> started Wed Feb 12 01:01:29 2025 >> done (9.124s) 7761685 reads processed; of these: 77 ( 0.00%) short reads filtered out after trimming by size control 497 ( 0.01%) empty reads filtered out after trimming by size control 7761111 (99.99%) reads available; of these: 1021296 (13.16%) trimmed reads available after processing 6739815 (86.84%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 218 0.00% 19 194 0.00% 20 580 0.01% 21 285 0.00% 22 300 0.00% 23 336 0.00% 24 401 0.01% 25 457 0.01% 26 407 0.01% 27 390 0.01% 28 420 0.01% 29 508 0.01% 30 762 0.01% 31 799 0.01% 32 423 0.01% 33 399 0.01% 34 360 0.00% 35 331 0.00% 36 391 0.01% 37 371 0.00% 38 411 0.01% 39 406 0.01% 40 376 0.00% 41 391 0.01% 42 374 0.00% 43 394 0.01% 44 380 0.00% 45 406 0.01% 46 416 0.01% 47 402 0.01% 48 430 0.01% 49 444 0.01% 50 436 0.01% 51 469 0.01% 52 456 0.01% 53 460 0.01% 54 503 0.01% 55 505 0.01% 56 479 0.01% 57 578 0.01% 58 573 0.01% 59 585 0.01% 60 623 0.01% 61 643 0.01% 62 812 0.01% 63 616 0.01% 64 716 0.01% 65 637 0.01% 66 656 0.01% 67 772 0.01% 68 704 0.01% 69 795 0.01% 70 784 0.01% 71 923 0.01% 72 873 0.01% 73 931 0.01% 74 986 0.01% 75 1080 0.01% 76 1055 0.01% 77 1169 0.02% 78 1300 0.02% 79 1396 0.02% 80 1603 0.02% 81 1689 0.02% 82 1918 0.02% 83 2231 0.03% 84 2326 0.03% 85 2471 0.03% 86 2787 0.04% 87 3032 0.04% 88 3394 0.04% 89 3931 0.05% 90 4452 0.06% 91 5023 0.06% 92 5782 0.07% 93 6556 0.08% 94 7167 0.09% 95 8268 0.11% 96 9003 0.12% 97 9967 0.13% 98 10798 0.14% 99 11949 0.15% 100 13703 0.18% 101 15617 0.20% 102 18139 0.23% 103 20739 0.27% 104 21522 0.28% 105 22957 0.30% 106 24051 0.31% 107 25901 0.33% 108 27001 0.35% 109 29145 0.38% 110 32239 0.42% 111 35827 0.46% 112 39251 0.51% 113 43018 0.55% 114 47002 0.61% 115 50041 0.64% 116 52638 0.68% 117 53597 0.69% 118 56127 0.72% 119 62563 0.81% 120 77135 0.99% 121 112548 1.45% 122 235813 3.04% 123 77291 1.00% 124 426953 5.50% 125 6000269 77.31% criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.68 fanout-score-rank=30 prefix-density=0.18 prefix-fanout=2.3 sequence=TTCAACCAAGCGCG criterion=fanout-score sequence-density=0.04 sequence-density-rank=21 fanout-score=334.32 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=29.9 sequence=TTCTTCTTCTTC Started job on | Feb 12 01:01:57 Started mapping on | Feb 12 01:01:58 Finished on | Feb 12 01:02:20 Mapping speed, Million of reads per hour | 2116.73 Number of input reads | 12935567 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 11382831 Uniquely mapped reads % | 88.00% Average mapped length | 122.62 Number of splices: Total | 4269374 Number of splices: Annotated (sjdb) | 4184950 Number of splices: GT/AG | 4201394 Number of splices: GC/AG | 55236 Number of splices: AT/AC | 4410 Number of splices: Non-canonical | 8334 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.25 Insertion rate per base | 0.02% Insertion average length | 1.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 284148 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 951543 % of reads mapped to too many loci | 7.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.43% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1268588 1268588 1268588 N_multimapping 284148 284148 284148 N_noFeature 525184 5904189 5928050 N_ambiguous 123961 24133 24260 UnstrandedReadsAssigned:10733686 PositiveStrandReadsAssigned:5454509 NegativeStrandReadsAssigned:5430521 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208018 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208018-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,935,567 reads, 11,818,477 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,124 rounds 52401 SRR3208018.ke.tsv 34699 SRR3208018.se.tsv 87100 total ==> SRR3208018.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 472 28.286 Potri.005G024800.1.v4.1 1035 936 884 108.613 Potri.004G059700.1.v4.1 961 862 11 1.46754 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 177.069 7.16005 Potri.016G087400.1.v4.1 270 171 388 260.939 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 73 5.01501 Potri.012G127500.1.v4.1 977 878 1523 199.485 ==> SRR3208018.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1163 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 194 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 30 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR3208018 completed mapping pipeline successfully