Starting /dee2/code/volunteer_pipeline.sh SRR3208019 current disk space = 3050884554752 free memory = 1536646136 SRR3208019 SRAfilesize 2ebfd6bbea18f2d5d51315ff3ed6eba5 SRR3208019.sra SRR3208019.sra file validated SRR3208019 is single end SRR3208019 is conventional basespace SRR3208019 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208019_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.94225 33.0 33.0 33.0 33.0 33.0 2 32.26125 33.0 33.0 33.0 33.0 33.0 3 32.384 33.0 33.0 33.0 33.0 33.0 4 32.4185 33.0 33.0 33.0 33.0 33.0 5 32.42125 33.0 33.0 33.0 33.0 33.0 6 36.12925 37.0 37.0 37.0 37.0 37.0 7 36.20875 37.0 37.0 37.0 37.0 37.0 8 36.27225 37.0 37.0 37.0 37.0 37.0 9 36.296 37.0 37.0 37.0 37.0 37.0 10-11 36.328625 37.0 37.0 37.0 37.0 37.0 12-13 36.359125000000006 37.0 37.0 37.0 37.0 37.0 14-15 36.364000000000004 37.0 37.0 37.0 37.0 37.0 16-17 36.26625 37.0 37.0 37.0 37.0 37.0 18-19 36.374375 37.0 37.0 37.0 37.0 37.0 20-21 36.337875 37.0 37.0 37.0 37.0 37.0 22-23 36.309124999999995 37.0 37.0 37.0 37.0 37.0 24-25 36.334625 37.0 37.0 37.0 37.0 37.0 26-27 36.222750000000005 37.0 37.0 37.0 37.0 37.0 28-29 36.304500000000004 37.0 37.0 37.0 37.0 37.0 30-31 36.321124999999995 37.0 37.0 37.0 37.0 37.0 32-33 36.271625 37.0 37.0 37.0 37.0 37.0 34-35 36.32575 37.0 37.0 37.0 37.0 37.0 36-37 36.291375 37.0 37.0 37.0 37.0 37.0 38-39 36.241375 37.0 37.0 37.0 37.0 37.0 40-41 36.33 37.0 37.0 37.0 37.0 37.0 42-43 36.290375 37.0 37.0 37.0 37.0 37.0 44-45 36.30475 37.0 37.0 37.0 37.0 37.0 46-47 36.261250000000004 37.0 37.0 37.0 37.0 37.0 48-49 36.31375 37.0 37.0 37.0 37.0 37.0 50-51 36.292500000000004 37.0 37.0 37.0 37.0 37.0 52-53 36.311 37.0 37.0 37.0 37.0 37.0 54-55 36.332625 37.0 37.0 37.0 37.0 37.0 56-57 36.374125 37.0 37.0 37.0 37.0 37.0 58-59 36.322625 37.0 37.0 37.0 37.0 37.0 60-61 36.335 37.0 37.0 37.0 37.0 37.0 62-63 36.268 37.0 37.0 37.0 37.0 37.0 64-65 36.258875 37.0 37.0 37.0 37.0 37.0 66-67 36.261624999999995 37.0 37.0 37.0 37.0 37.0 68-69 36.228875 37.0 37.0 37.0 37.0 37.0 70-71 36.173125 37.0 37.0 37.0 37.0 37.0 72-73 36.212375 37.0 37.0 37.0 37.0 37.0 74-75 36.182625 37.0 37.0 37.0 37.0 37.0 76-77 35.955 37.0 37.0 37.0 37.0 37.0 78-79 35.92625 37.0 37.0 37.0 37.0 37.0 80-81 35.888875 37.0 37.0 37.0 37.0 37.0 82-83 35.843 37.0 37.0 37.0 37.0 37.0 84-85 35.782875000000004 37.0 37.0 37.0 37.0 37.0 86-87 35.761375 37.0 37.0 37.0 37.0 37.0 88-89 35.794624999999996 37.0 37.0 37.0 37.0 37.0 90-91 35.82575 37.0 37.0 37.0 37.0 37.0 92-93 35.783500000000004 37.0 37.0 37.0 37.0 37.0 94-95 35.76412500000001 37.0 37.0 37.0 37.0 37.0 96-97 35.745125 37.0 37.0 37.0 37.0 37.0 98-99 35.72075 37.0 37.0 37.0 37.0 37.0 100-101 35.766875 37.0 37.0 37.0 37.0 37.0 102-103 35.718875 37.0 37.0 37.0 37.0 37.0 104-105 35.753 37.0 37.0 37.0 37.0 37.0 106-107 35.709500000000006 37.0 37.0 37.0 37.0 37.0 108-109 35.7095 37.0 37.0 37.0 37.0 37.0 110-111 35.622875 37.0 37.0 37.0 37.0 37.0 112-113 35.591499999999996 37.0 37.0 37.0 37.0 37.0 114-115 35.56725 37.0 37.0 37.0 37.0 37.0 116-117 35.577124999999995 37.0 37.0 37.0 37.0 37.0 118-119 35.449124999999995 37.0 37.0 37.0 37.0 37.0 120-121 35.446749999999994 37.0 37.0 37.0 37.0 37.0 122-123 35.404875000000004 37.0 37.0 37.0 37.0 37.0 124-125 34.034499999999994 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 1.0 4 1.0 5 1.0 6 0.0 7 0.0 8 3.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 1.0 17 1.0 18 2.0 19 3.0 20 5.0 21 5.0 22 31.0 23 12.0 24 8.0 25 7.0 26 11.0 27 10.0 28 8.0 29 14.0 30 27.0 31 32.0 32 49.0 33 63.0 34 98.0 35 202.0 36 3385.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 20.982029865856745 15.945330296127564 12.40192356365477 50.67071627436091 2 18.21366024518389 21.165874405804352 41.7312984738554 18.88916687515637 3 20.75 25.1 28.999999999999996 25.15 4 23.225 29.9 21.875 25.0 5 26.674999999999997 33.300000000000004 23.45 16.575 6 20.275000000000002 36.7 23.575 19.45 7 17.525 21.15 41.325 20.0 8 19.075 24.45 31.1 25.374999999999996 9 20.549999999999997 23.799999999999997 31.35 24.3 10-11 22.15 33.5125 23.5625 20.775 12-13 20.175 27.1 29.65 23.075000000000003 14-15 21.2 27.4125 28.0625 23.325000000000003 16-17 21.8625 27.975 28.212500000000002 21.95 18-19 21.1125 28.6125 27.450000000000003 22.825 20-21 22.4375 27.537499999999998 28.475 21.55 22-23 21.75 28.925 27.437499999999996 21.8875 24-25 20.6375 28.4375 29.025000000000002 21.9 26-27 22.3125 28.000000000000004 27.787499999999998 21.9 28-29 21.675 28.9875 27.375 21.9625 30-31 21.7 28.000000000000004 27.737499999999997 22.5625 32-33 22.075 28.625 27.287499999999998 22.0125 34-35 22.0125 28.512500000000003 27.950000000000003 21.525 36-37 22.2 28.15 27.35 22.3 38-39 21.8125 28.012500000000003 27.287499999999998 22.8875 40-41 21.7875 28.549999999999997 27.6375 22.025 42-43 21.3625 29.075 28.1625 21.4 44-45 22.400000000000002 27.175 28.3375 22.0875 46-47 22.3375 27.787499999999998 27.6 22.275 48-49 22.0625 28.487499999999997 28.575 20.875 50-51 22.1 27.975 27.5875 22.3375 52-53 21.462500000000002 27.55 27.700000000000003 23.2875 54-55 22.25 27.737499999999997 28.000000000000004 22.0125 56-57 22.2625 27.3 28.375 22.0625 58-59 22.6 28.462500000000002 27.0125 21.925 60-61 20.8875 28.462500000000002 28.65 22.0 62-63 21.590198774846854 27.19089886235779 28.703587948493563 22.515314414301788 64-65 21.840230028753595 28.003500437554695 28.041005125640705 22.115264408051004 66-67 22.025 28.625 27.6125 21.7375 68-69 21.9679919979995 28.744686171542888 28.60715178794699 20.68017004251063 70-71 23.0375 28.262500000000003 26.937499999999996 21.762500000000003 72-73 22.152769096137018 28.9536192024003 27.390923865483185 21.502687835979497 74-75 22.1375 28.4125 28.3625 21.087500000000002 76-77 21.280320080020005 28.419604901225306 28.207051762940733 22.093023255813954 78-79 22.329246935201404 28.283712784588445 27.47060295221416 21.916437327995997 80-81 22.158237356034054 27.979469203805706 27.72909364046069 22.13319979969955 82-83 21.813173052842476 27.64838467317806 28.850488354620584 21.68795391935888 84-85 22.097097097097095 28.303303303303302 28.741241241241237 20.85835835835836 86-87 21.625 28.1875 28.425 21.762500000000003 88-89 22.6 28.6375 27.5625 21.2 90-91 22.86535816977122 28.128516064508062 27.25340667583448 21.752719089886234 92-93 21.712500000000002 28.6875 27.9125 21.6875 94-95 23.325000000000003 27.0125 27.650000000000002 22.0125 96-97 22.1 27.975 27.712500000000002 22.2125 98-99 22.702837854731843 27.69096137017127 27.82847855981998 21.77772221527691 100-101 22.537499999999998 28.199999999999996 27.800000000000004 21.462500000000002 102-103 22.75284410551319 28.753594199274907 26.653331666458307 21.840230028753595 104-105 22.807456524458903 28.474915551107216 27.323908419867383 21.393719504566498 106-107 22.871807711567353 28.85578367551327 26.527290936404608 21.745117676514774 108-109 22.15688727636682 28.60002502189416 27.223820843237835 22.019266858501187 110-111 22.868217054263564 27.84446111527882 27.156789197299325 22.13053263315829 112-113 23.665458182272783 27.86598324790599 26.828353544193025 21.640205025628205 114-115 23.417563172379285 29.83487615711784 25.156367275456592 21.591193395046286 116-117 22.982609783560616 27.524083573126486 27.64919304391342 21.844113599399474 118-119 22.82567888874984 28.819922412714305 26.73007133024653 21.624327368289325 120-121 24.103012876609576 28.166020752594072 26.465808226028255 21.265158144768094 122-123 22.54190642982237 28.20865649236928 26.970227670753065 22.27920940705529 124-125 24.008011015145826 29.06496432594818 25.547627988484166 21.37939667042183 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.5 21 1.0 22 1.5 23 2.5 24 3.5 25 8.0 26 8.5 27 13.5 28 17.0 29 17.0 30 22.5 31 31.5 32 44.0 33 52.0 34 63.0 35 79.5 36 106.0 37 128.5 38 149.5 39 158.5 40 187.5 41 221.5 42 229.5 43 236.0 44 251.0 45 263.0 46 245.0 47 220.5 48 198.5 49 181.5 50 153.5 51 130.0 52 105.5 53 81.0 54 71.5 55 60.0 56 44.0 57 33.5 58 28.0 59 21.5 60 23.0 61 18.0 62 13.5 63 15.0 64 9.0 65 3.0 66 2.5 67 4.5 68 6.5 69 5.5 70 3.0 71 1.5 72 3.5 73 4.5 74 3.0 75 3.0 76 1.5 77 2.5 78 2.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.225 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0125 64-65 0.0125 66-67 0.0 68-69 0.025 70-71 0.0 72-73 0.0125 74-75 0.0 76-77 0.025 78-79 0.075 80-81 0.15 82-83 0.17500000000000002 84-85 0.1 86-87 0.0 88-89 0.0 90-91 0.0125 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0125 100-101 0.0 102-103 0.0125 104-105 0.08750000000000001 106-107 0.15 108-109 0.08750000000000001 110-111 0.025 112-113 0.0125 114-115 0.075 116-117 0.08750000000000001 118-119 0.11249999999999999 120-121 0.0125 122-123 0.075 124-125 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59514170040485 98.4 2 0.354251012145749 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025303643724696356 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025303643724696356 0.75 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTAT 30 0.75 TruSeq Adapter, Index 18 (97% over 40bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTA 6 0.15 TruSeq Adapter, Index 18 (97% over 40bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.175 0.0 0.0 0.0 0.0 2 0.175 0.0 0.0 0.0 0.0 3 0.175 0.0 0.0 0.0 0.0 4 0.175 0.0 0.0 0.0 0.0 5 0.175 0.0 0.0 0.0 0.0 6 0.175 0.0 0.0 0.0 0.0 7 0.175 0.0 0.0 0.0 0.0 8 0.175 0.0 0.0 0.0 0.0 9 0.175 0.0 0.0 0.0 0.0 10-11 0.175 0.0 0.0 0.0 0.0 12-13 0.175 0.0 0.0 0.0 0.0 14-15 0.175 0.0 0.0 0.0 0.0 16-17 0.175 0.0 0.0 0.0 0.0 18-19 0.175 0.0 0.0 0.0 0.0 20-21 0.175 0.0 0.0 0.0 0.0 22-23 0.175 0.0 0.0 0.0 0.0 24-25 0.175 0.0 0.0 0.0 0.0 26-27 0.175 0.0 0.0 0.0 0.0 28-29 0.175 0.0 0.0 0.0 0.0 30-31 0.175 0.0 0.0 0.0 0.0 32-33 0.175 0.0 0.0 0.0 0.0 34-35 0.175 0.0 0.0 0.0 0.0 36-37 0.175 0.0 0.0 0.0 0.0 38-39 0.175 0.0 0.0 0.0 0.0 40-41 0.175 0.0 0.0 0.0 0.0 42-43 0.175 0.0 0.0 0.0 0.0 44-45 0.175 0.0 0.0 0.0 0.0 46-47 0.175 0.0 0.0 0.0 0.0 48-49 0.175 0.0 0.0 0.0 0.0 50-51 0.175 0.0 0.0 0.0 0.0 52-53 0.175 0.0 0.0 0.0 0.0 54-55 0.175 0.0 0.0 0.0 0.0 56-57 0.175 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.1875 0.0 0.0 0.0 0.0 64-65 0.21250000000000002 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6000000000000001 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 0.9125 0.0 0.0 0.0 0.0 96-97 1.175 0.0 0.0 0.0 0.0 98-99 1.45 0.0 0.0 0.0 0.0 100-101 1.775 0.0 0.0 0.0 0.0 102-103 2.275 0.0 0.0 0.0 0.0 104-105 2.8625 0.0 0.0 0.0 0.0 106-107 3.475 0.0 0.0 0.0 0.0 108-109 4.2 0.0 0.0 0.0 0.0 110-111 4.949999999999999 0.0 0.0 0.0 0.0 112-113 5.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 768822 spots for SRR3208019.sra Written 768822 spots for SRR3208019.sra Read 768822 spots for SRR3208019.sra Written 768822 spots for SRR3208019.sra Read 768822 spots for SRR3208019.sra Written 768822 spots for SRR3208019.sra Read 768822 spots for SRR3208019.sra Written 768822 spots for SRR3208019.sra Read 768822 spots for SRR3208019.sra Written 768822 spots for SRR3208019.sra Read 768822 spots for SRR3208019.sra Written 768822 spots for SRR3208019.sra Read 768822 spots for SRR3208019.sra Written 768822 spots for SRR3208019.sra Read 768822 spots for SRR3208019.sra Written 768822 spots for SRR3208019.sra Read 768822 spots for SRR3208019.sra Written 768822 spots for SRR3208019.sra Read 768822 spots for SRR3208019.sra Written 768822 spots for SRR3208019.sra Read 768822 spots for SRR3208019.sra Written 768822 spots for SRR3208019.sra Read 768822 spots for SRR3208019.sra Written 768822 spots for SRR3208019.sra Read 768822 spots for SRR3208019.sra Written 768822 spots for SRR3208019.sra Read 768822 spots for SRR3208019.sra Written 768822 spots for SRR3208019.sra Read 768822 spots for SRR3208019.sra Written 768822 spots for SRR3208019.sra Read 768822 spots for SRR3208019.sra Written 768822 spots for SRR3208019.sra Read 768822 spots for SRR3208019.sra Written 768822 spots for SRR3208019.sra Read 768827 spots for SRR3208019.sra Written 768827 spots for SRR3208019.sra Read 768822 spots for SRR3208019.sra Written 768822 spots for SRR3208019.sra Read 768822 spots for SRR3208019.sra Written 768822 spots for SRR3208019.sra SRR ids: ['SRR3208019.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4uhsn8uu SRR3208019.sra spots: 15376445 blocks: [[1, 768822], [768823, 1537644], [1537645, 2306466], [2306467, 3075288], [3075289, 3844110], [3844111, 4612932], [4612933, 5381754], [5381755, 6150576], [6150577, 6919398], [6919399, 7688220], [7688221, 8457042], [8457043, 9225864], [9225865, 9994686], [9994687, 10763508], [10763509, 11532330], [11532331, 12301152], [12301153, 13069974], [13069975, 13838796], [13838797, 14607618], [14607619, 15376445]] SRR3208019 file size 4921852 SRR3208019 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208019 SRR3208019_1.fastq Input file: SRR3208019_1.fastq trimmed: SRR3208019-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 01:47:16 2025 >> started Wed Feb 12 01:47:28 2025 >> done (11.915s) 15376445 reads processed; of these: 12782 ( 0.08%) short reads filtered out after trimming by size control 202056 ( 1.31%) empty reads filtered out after trimming by size control 15161607 (98.60%) reads available; of these: 1624282 (10.71%) trimmed reads available after processing 13537325 (89.29%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 464 0.00% 19 488 0.00% 20 505 0.00% 21 508 0.00% 22 588 0.00% 23 648 0.00% 24 729 0.00% 25 909 0.01% 26 913 0.01% 27 867 0.01% 28 864 0.01% 29 910 0.01% 30 1354 0.01% 31 1170 0.01% 32 869 0.01% 33 804 0.01% 34 772 0.01% 35 826 0.01% 36 906 0.01% 37 849 0.01% 38 850 0.01% 39 859 0.01% 40 825 0.01% 41 904 0.01% 42 873 0.01% 43 891 0.01% 44 921 0.01% 45 923 0.01% 46 889 0.01% 47 911 0.01% 48 903 0.01% 49 985 0.01% 50 991 0.01% 51 1058 0.01% 52 1049 0.01% 53 1066 0.01% 54 1083 0.01% 55 1181 0.01% 56 1187 0.01% 57 1267 0.01% 58 1264 0.01% 59 1392 0.01% 60 1420 0.01% 61 1421 0.01% 62 1950 0.01% 63 1587 0.01% 64 2230 0.01% 65 3530 0.02% 66 2026 0.01% 67 2032 0.01% 68 1846 0.01% 69 1946 0.01% 70 2095 0.01% 71 2341 0.02% 72 2290 0.02% 73 2683 0.02% 74 3444 0.02% 75 4739 0.03% 76 5006 0.03% 77 3832 0.03% 78 3318 0.02% 79 3660 0.02% 80 4091 0.03% 81 4494 0.03% 82 5167 0.03% 83 5615 0.04% 84 5953 0.04% 85 6581 0.04% 86 7186 0.05% 87 7853 0.05% 88 8832 0.06% 89 10085 0.07% 90 11463 0.08% 91 13310 0.09% 92 15028 0.10% 93 16878 0.11% 94 2195 0.01% 95 2163 0.01% 96 2285 0.02% 97 2789 0.02% 98 2495 0.02% 99 2630 0.02% 100 2849 0.02% 101 2960 0.02% 102 3470 0.02% 103 4812 0.03% 104 3529 0.02% 105 3552 0.02% 106 3658 0.02% 107 4230 0.03% 108 4583 0.03% 109 5119 0.03% 110 5673 0.04% 111 6189 0.04% 112 6808 0.04% 113 7773 0.05% 114 9017 0.06% 115 10662 0.07% 116 13104 0.09% 117 14757 0.10% 118 18548 0.12% 119 23887 0.16% 120 32335 0.21% 121 45883 0.30% 122 77022 0.51% 123 165103 1.09% 124 920055 6.07% 125 13537325 89.29% 15161607 reads passed initial QC criterion=sequence-density sequence-density=5.42 sequence-density-rank=1 fanout-score=46.23 fanout-score-rank=1 prefix-density=7.36 prefix-fanout=34.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA criterion=fanout-score sequence-density=5.42 sequence-density-rank=1 fanout-score=46.23 fanout-score-rank=1 prefix-density=7.36 prefix-fanout=34.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA -o SRR3208019 - Input file: STDIN trimmed: SRR3208019-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 01:48:06 2025 >> started Wed Feb 12 01:48:18 2025 >> done (12.406s) 10107738 reads processed; of these: 202 ( 0.00%) short reads filtered out after trimming by size control 7289 ( 0.07%) empty reads filtered out after trimming by size control 10100247 (99.93%) reads available; of these: 1579239 (15.64%) trimmed reads available after processing 8521008 (84.36%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 314 0.00% 19 353 0.00% 20 332 0.00% 21 325 0.00% 22 399 0.00% 23 429 0.00% 24 498 0.00% 25 618 0.01% 26 618 0.01% 27 593 0.01% 28 566 0.01% 29 607 0.01% 30 911 0.01% 31 788 0.01% 32 590 0.01% 33 549 0.01% 34 524 0.01% 35 568 0.01% 36 629 0.01% 37 564 0.01% 38 563 0.01% 39 609 0.01% 40 584 0.01% 41 595 0.01% 42 593 0.01% 43 605 0.01% 44 599 0.01% 45 631 0.01% 46 576 0.01% 47 599 0.01% 48 608 0.01% 49 662 0.01% 50 669 0.01% 51 700 0.01% 52 692 0.01% 53 721 0.01% 54 708 0.01% 55 817 0.01% 56 789 0.01% 57 833 0.01% 58 822 0.01% 59 938 0.01% 60 933 0.01% 61 908 0.01% 62 1253 0.01% 63 1019 0.01% 64 1173 0.01% 65 985 0.01% 66 1122 0.01% 67 1317 0.01% 68 1178 0.01% 69 1204 0.01% 70 1293 0.01% 71 1473 0.01% 72 1462 0.01% 73 1590 0.02% 74 1640 0.02% 75 1752 0.02% 76 1901 0.02% 77 2013 0.02% 78 2176 0.02% 79 2511 0.02% 80 2755 0.03% 81 2978 0.03% 82 3424 0.03% 83 3782 0.04% 84 3977 0.04% 85 4393 0.04% 86 4738 0.05% 87 5285 0.05% 88 5874 0.06% 89 6785 0.07% 90 7743 0.08% 91 8675 0.09% 92 9865 0.10% 93 11417 0.11% 94 12697 0.13% 95 13853 0.14% 96 14988 0.15% 97 16923 0.17% 98 18098 0.18% 99 20348 0.20% 100 23084 0.23% 101 26025 0.26% 102 29951 0.30% 103 33444 0.33% 104 35444 0.35% 105 37608 0.37% 106 39112 0.39% 107 41946 0.42% 108 44918 0.44% 109 47849 0.47% 110 52465 0.52% 111 57720 0.57% 112 63229 0.63% 113 68425 0.68% 114 73143 0.72% 115 77076 0.76% 116 81203 0.80% 117 82301 0.81% 118 85878 0.85% 119 93263 0.92% 120 112114 1.11% 121 156784 1.55% 122 315194 3.12% 123 96981 0.96% 124 541695 5.36% 125 7550206 74.75% criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=16 prefix-density=0.17 prefix-fanout=2.6 sequence=TTCAACCAAGCGCG criterion=fanout-score sequence-density=0.06 sequence-density-rank=15 fanout-score=64.19 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=13.5 sequence=AAAAAGAAAAAAGATACACACGGCCATACATAATACACGGACCTCAATTCACCAGATTTTCAAGGCAGCACATAATATTTATTATAAATCAAGTCGTCAGCTATGTTCTTAGCTTCTTACTTACTCCGCACGCTGTTCTTCAACCATCTCCAAGGGGAAATGAGGAGACCCCCGAGGGCAAAAGATAACCCTATAGTTGGTCCCGCCAGGGCATGTAAATGTGCTCGAAGGGTCATCCTGGGGATAGCTGTAAGAAGTAGGGCACCTATCCTTAAAAAACCTTGAGAAATAGGTAGGGCCACAGCTCCCCTGCCCATTAGTGCAGCAATATTCGTTAGTTTTAAACACAGTGCATGGGTTATTACACCCACCAGGAGCCCTCAATTCATTAGGACATTGCCCATTAATATCTGCTGTGCAGAGAAGCGCCTGACACTTCCCTGAGCCACCGCTTGATGTTGGACTAAATTCCATAGGGATATTAAATCCATCAACAAGGGATATATCATAA Started job on | Feb 12 01:48:45 Started mapping on | Feb 12 01:48:45 Finished on | Feb 12 01:49:22 Mapping speed, Million of reads per hour | 1474.45 Number of input reads | 15154116 Average input read length | 122 UNIQUE READS: Uniquely mapped reads number | 12823880 Uniquely mapped reads % | 84.62% Average mapped length | 122.18 Number of splices: Total | 4568419 Number of splices: Annotated (sjdb) | 4462668 Number of splices: GT/AG | 4489870 Number of splices: GC/AG | 63262 Number of splices: AT/AC | 5272 Number of splices: Non-canonical | 10015 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 1.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 376880 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 1067434 % of reads mapped to too many loci | 7.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.82% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1953356 1953356 1953356 N_multimapping 376880 376880 376880 N_noFeature 667432 6679368 6726544 N_ambiguous 142250 28490 28664 UnstrandedReadsAssigned:12014198 PositiveStrandReadsAssigned:6116022 NegativeStrandReadsAssigned:6068672 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208019 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208019-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,154,116 reads, 13,238,187 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,241 rounds 52401 SRR3208019.ke.tsv 34699 SRR3208019.se.tsv 87100 total ==> SRR3208019.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1060 52.0603 Potri.005G024800.1.v4.1 1035 936 3880.22 390.712 Potri.004G059700.1.v4.1 961 862 3 0.328012 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 301.32 9.9856 Potri.016G087400.1.v4.1 270 171 342 188.498 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 219 12.33 Potri.012G127500.1.v4.1 977 878 2337 250.865 ==> SRR3208019.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 352 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 266 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 23 SRR3208019 completed mapping pipeline successfully