Starting /dee2/code/volunteer_pipeline.sh SRR3208020 current disk space = 3051076476928 free memory = 1542967600 SRR3208020 SRAfilesize c9c0210ce537ee9b12ce919d6936ac4b SRR3208020.sra SRR3208020.sra file validated SRR3208020 is single end SRR3208020 is conventional basespace SRR3208020 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208020_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9375 33.0 33.0 33.0 33.0 33.0 2 32.4045 33.0 33.0 33.0 33.0 33.0 3 32.438 33.0 33.0 33.0 33.0 33.0 4 32.5105 33.0 33.0 33.0 33.0 33.0 5 32.601 33.0 33.0 33.0 33.0 33.0 6 36.24075 37.0 37.0 37.0 37.0 37.0 7 36.316 37.0 37.0 37.0 37.0 37.0 8 36.36075 37.0 37.0 37.0 37.0 37.0 9 36.34175 37.0 37.0 37.0 37.0 37.0 10-11 36.371125 37.0 37.0 37.0 37.0 37.0 12-13 36.297 37.0 37.0 37.0 37.0 37.0 14-15 36.351124999999996 37.0 37.0 37.0 37.0 37.0 16-17 36.299875 37.0 37.0 37.0 37.0 37.0 18-19 36.407 37.0 37.0 37.0 37.0 37.0 20-21 36.319625 37.0 37.0 37.0 37.0 37.0 22-23 36.34425 37.0 37.0 37.0 37.0 37.0 24-25 36.3655 37.0 37.0 37.0 37.0 37.0 26-27 36.287625 37.0 37.0 37.0 37.0 37.0 28-29 36.352125 37.0 37.0 37.0 37.0 37.0 30-31 36.300875 37.0 37.0 37.0 37.0 37.0 32-33 36.324250000000006 37.0 37.0 37.0 37.0 37.0 34-35 36.35675 37.0 37.0 37.0 37.0 37.0 36-37 36.35125 37.0 37.0 37.0 37.0 37.0 38-39 36.303125 37.0 37.0 37.0 37.0 37.0 40-41 36.325625 37.0 37.0 37.0 37.0 37.0 42-43 36.305375 37.0 37.0 37.0 37.0 37.0 44-45 36.3595 37.0 37.0 37.0 37.0 37.0 46-47 36.314 37.0 37.0 37.0 37.0 37.0 48-49 36.35775 37.0 37.0 37.0 37.0 37.0 50-51 36.323375 37.0 37.0 37.0 37.0 37.0 52-53 36.299499999999995 37.0 37.0 37.0 37.0 37.0 54-55 36.321375 37.0 37.0 37.0 37.0 37.0 56-57 36.332375 37.0 37.0 37.0 37.0 37.0 58-59 36.285624999999996 37.0 37.0 37.0 37.0 37.0 60-61 36.288250000000005 37.0 37.0 37.0 37.0 37.0 62-63 36.266375 37.0 37.0 37.0 37.0 37.0 64-65 36.249750000000006 37.0 37.0 37.0 37.0 37.0 66-67 36.332875 37.0 37.0 37.0 37.0 37.0 68-69 36.2535 37.0 37.0 37.0 37.0 37.0 70-71 36.280874999999995 37.0 37.0 37.0 37.0 37.0 72-73 36.288 37.0 37.0 37.0 37.0 37.0 74-75 36.208124999999995 37.0 37.0 37.0 37.0 37.0 76-77 36.244875 37.0 37.0 37.0 37.0 37.0 78-79 36.135125 37.0 37.0 37.0 37.0 37.0 80-81 36.062375 37.0 37.0 37.0 37.0 37.0 82-83 36.05225 37.0 37.0 37.0 37.0 37.0 84-85 36.062125 37.0 37.0 37.0 37.0 37.0 86-87 36.122875 37.0 37.0 37.0 37.0 37.0 88-89 36.115875 37.0 37.0 37.0 37.0 37.0 90-91 36.060249999999996 37.0 37.0 37.0 37.0 37.0 92-93 36.08925 37.0 37.0 37.0 37.0 37.0 94-95 36.030625 37.0 37.0 37.0 37.0 37.0 96-97 35.979875 37.0 37.0 37.0 37.0 37.0 98-99 35.96725 37.0 37.0 37.0 37.0 37.0 100-101 36.02375 37.0 37.0 37.0 37.0 37.0 102-103 35.9305 37.0 37.0 37.0 37.0 37.0 104-105 35.925625 37.0 37.0 37.0 37.0 37.0 106-107 35.93125 37.0 37.0 37.0 37.0 37.0 108-109 35.897999999999996 37.0 37.0 37.0 37.0 37.0 110-111 35.852625 37.0 37.0 37.0 37.0 37.0 112-113 35.7645 37.0 37.0 37.0 37.0 37.0 114-115 35.83525 37.0 37.0 37.0 37.0 37.0 116-117 35.756875 37.0 37.0 37.0 37.0 37.0 118-119 35.698125 37.0 37.0 37.0 37.0 37.0 120-121 35.6405 37.0 37.0 37.0 37.0 37.0 122-123 35.601625 37.0 37.0 37.0 37.0 37.0 124-125 34.298125 37.0 37.0 37.0 32.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 2.0 4 1.0 5 0.0 6 0.0 7 1.0 8 1.0 9 1.0 10 3.0 11 0.0 12 0.0 13 0.0 14 2.0 15 2.0 16 1.0 17 0.0 18 1.0 19 0.0 20 2.0 21 1.0 22 7.0 23 6.0 24 8.0 25 5.0 26 7.0 27 13.0 28 19.0 29 19.0 30 23.0 31 27.0 32 41.0 33 74.0 34 108.0 35 218.0 36 3390.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.622306717363752 15.766793409378959 13.155893536121674 49.455006337135615 2 18.875 21.575 40.25 19.3 3 21.05 24.675 27.800000000000004 26.474999999999998 4 24.075 30.2 21.55 24.175 5 25.1 33.775 23.200000000000003 17.925 6 19.525000000000002 35.85 24.875 19.75 7 17.625 19.175 42.4 20.8 8 19.125 23.225 31.775 25.874999999999996 9 20.200000000000003 24.775 31.05 23.974999999999998 10-11 23.775 32.175 23.325000000000003 20.724999999999998 12-13 21.512500000000003 26.3625 29.3875 22.7375 14-15 21.025 27.375 28.487499999999997 23.1125 16-17 22.025 27.6125 27.825 22.537499999999998 18-19 21.775 28.0625 27.1375 23.025000000000002 20-21 22.75 28.125 27.5125 21.6125 22-23 21.7375 28.0625 28.199999999999996 22.0 24-25 21.525 27.462500000000002 28.6375 22.375 26-27 21.6875 27.650000000000002 27.400000000000002 23.2625 28-29 20.974999999999998 28.95 27.787499999999998 22.287499999999998 30-31 22.1875 27.6 27.9125 22.3 32-33 21.9625 28.499999999999996 26.724999999999998 22.8125 34-35 21.587500000000002 27.725 27.762500000000003 22.925 36-37 21.4375 27.8375 29.175 21.55 38-39 21.625 28.8625 27.2625 22.25 40-41 22.05 28.65 27.537499999999998 21.762500000000003 42-43 21.712500000000002 27.900000000000002 28.199999999999996 22.1875 44-45 22.25 28.1875 26.8625 22.7 46-47 22.7375 27.525 27.8625 21.875 48-49 21.3 29.3375 27.8625 21.5 50-51 21.6125 27.8625 27.85 22.675 52-53 21.5625 27.0875 28.6875 22.662499999999998 54-55 21.987499999999997 28.199999999999996 27.575 22.237499999999997 56-57 22.0 27.987499999999997 27.750000000000004 22.2625 58-59 22.55 28.050000000000004 27.8625 21.5375 60-61 21.7 27.3875 28.212500000000002 22.7 62-63 22.537499999999998 27.85 27.5875 22.025 64-65 22.037499999999998 27.8625 28.1625 21.9375 66-67 21.7 28.012500000000003 28.325 21.9625 68-69 22.3125 28.712500000000002 27.237499999999997 21.7375 70-71 22.112499999999997 27.8125 28.037499999999998 22.037499999999998 72-73 21.637500000000003 28.7 27.200000000000003 22.4625 74-75 21.675 27.8375 28.1875 22.3 76-77 22.8625 27.8375 27.725 21.575 78-79 21.9942449643438 27.336419366946078 27.724258726385585 22.945076942324533 80-81 21.738041572752316 28.136739293764084 28.32456799398948 21.800651139494114 82-83 22.67434581194441 28.621509953674725 27.13158883185176 21.572555402529108 84-85 22.851782363977485 27.479674796747965 27.34208880550344 22.326454033771107 86-87 21.95 27.987499999999997 28.0875 21.975 88-89 22.4375 27.3875 27.650000000000002 22.525000000000002 90-91 22.125 27.9375 27.55 22.3875 92-93 21.9 27.525 28.7 21.875 94-95 21.925 28.6875 27.4125 21.975 96-97 22.475 28.65 27.4125 21.462500000000002 98-99 21.8875 28.1625 28.050000000000004 21.9 100-101 22.2 27.0 28.4 22.400000000000002 102-103 21.925 27.925 26.924999999999997 23.225 104-105 22.084584584584587 28.703703703703702 27.43993993993994 21.77177177177177 106-107 22.57135703555333 29.31897846770155 26.639959939909865 21.469704556835254 108-109 23.051907442151347 27.80487804878049 26.879299562226393 22.263914946841776 110-111 22.345879704889335 28.323121170438913 27.360260097536575 21.970739027135174 112-113 23.474999999999998 29.4375 26.424999999999997 20.6625 114-115 23.223223223223226 28.816316316316314 25.900900900900904 22.05955955955956 116-117 23.332916301764044 29.1254847991993 26.18541223570624 21.356186663330416 118-119 22.735235235235233 29.166666666666668 25.863363363363362 22.234734734734733 120-121 23.9125 28.349999999999998 26.5125 21.224999999999998 122-123 22.976860537836146 29.168230143839903 25.65353345841151 22.201375859912446 124-125 23.450607236759737 29.397771378490045 25.053211468636533 22.098409916113685 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.5 20 1.0 21 2.5 22 3.0 23 2.0 24 4.0 25 5.0 26 5.5 27 9.5 28 19.5 29 24.5 30 23.0 31 32.0 32 41.5 33 53.5 34 61.0 35 66.5 36 92.0 37 115.5 38 138.5 39 160.5 40 178.0 41 200.5 42 234.0 43 249.0 44 256.5 45 269.5 46 249.5 47 228.5 48 204.5 49 175.0 50 150.0 51 120.5 52 103.0 53 92.5 54 74.5 55 58.0 56 52.0 57 42.5 58 27.0 59 22.5 60 22.0 61 14.5 62 14.0 63 14.0 64 10.5 65 9.5 66 6.5 67 7.5 68 12.0 69 8.5 70 3.5 71 5.0 72 4.0 73 3.5 74 4.5 75 3.5 76 2.0 77 1.0 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.08750000000000001 80-81 0.17500000000000002 82-83 0.1625 84-85 0.0625 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.1 106-107 0.15 108-109 0.0625 110-111 0.0375 112-113 0.0 114-115 0.1 116-117 0.08750000000000001 118-119 0.1 120-121 0.0 122-123 0.0625 124-125 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34376577486118 98.4 2 0.5552751135790005 1.0999999999999999 3 0.05047955577990913 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.05047955577990913 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 19 (97% over 40bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTA 7 0.17500000000000002 TruSeq Adapter, Index 19 (97% over 40bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.175 0.0 0.0 0.0 0.0 2 0.175 0.0 0.0 0.0 0.0 3 0.175 0.0 0.0 0.0 0.0 4 0.175 0.0 0.0 0.0 0.0 5 0.175 0.0 0.0 0.0 0.0 6 0.175 0.0 0.0 0.0 0.0 7 0.175 0.0 0.0 0.0 0.0 8 0.175 0.0 0.0 0.0 0.0 9 0.175 0.0 0.0 0.0 0.0 10-11 0.1875 0.0 0.0 0.0 0.0 12-13 0.21250000000000002 0.0 0.0 0.0 0.0 14-15 0.225 0.0 0.0 0.0 0.0 16-17 0.225 0.0 0.0 0.0 0.0 18-19 0.225 0.0 0.0 0.0 0.0 20-21 0.225 0.0 0.0 0.0 0.0 22-23 0.225 0.0 0.0 0.0 0.0 24-25 0.225 0.0 0.0 0.0 0.0 26-27 0.225 0.0 0.0 0.0 0.0 28-29 0.225 0.0 0.0 0.0 0.0 30-31 0.225 0.0 0.0 0.0 0.0 32-33 0.225 0.0 0.0 0.0 0.0 34-35 0.225 0.0 0.0 0.0 0.0 36-37 0.225 0.0 0.0 0.0 0.0 38-39 0.225 0.0 0.0 0.0 0.0 40-41 0.225 0.0 0.0 0.0 0.0 42-43 0.225 0.0 0.0 0.0 0.0 44-45 0.225 0.0 0.0 0.0 0.0 46-47 0.225 0.0 0.0 0.0 0.0 48-49 0.225 0.0 0.0 0.0 0.0 50-51 0.225 0.0 0.0 0.0 0.0 52-53 0.225 0.0 0.0 0.0 0.0 54-55 0.225 0.0 0.0 0.0 0.0 56-57 0.225 0.0 0.0 0.0 0.0 58-59 0.225 0.0 0.0 0.0 0.0 60-61 0.225 0.0 0.0 0.0 0.0 62-63 0.225 0.0 0.0 0.0 0.0 64-65 0.225 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.2625 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.325 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.44999999999999996 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.6625000000000001 0.0 0.0 0.0 0.0 92-93 0.8 0.0 0.0 0.0 0.0 94-95 1.075 0.0 0.0 0.0 0.0 96-97 1.2375 0.0 0.0 0.0 0.0 98-99 1.5875 0.0 0.0 0.0 0.0 100-101 2.1 0.0 0.0 0.0 0.0 102-103 2.6375 0.0 0.0 0.0 0.0 104-105 3.1625 0.0 0.0 0.0 0.0 106-107 3.9375 0.0 0.0 0.0 0.0 108-109 4.475 0.0 0.0 0.0 0.0 110-111 5.4125 0.0 0.0 0.0 0.0 112-113 6.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAGCA 45 0.008989325 26.441668 118-119 GATCGGA 45 0.008989325 26.441668 112-113 TCGGAAG 45 0.008989325 26.441668 114-115 >>END_MODULE Read 540321 spots for SRR3208020.sra Written 540321 spots for SRR3208020.sra Read 540321 spots for SRR3208020.sra Written 540321 spots for SRR3208020.sra Read 540321 spots for SRR3208020.sra Written 540321 spots for SRR3208020.sra Read 540321 spots for SRR3208020.sra Written 540321 spots for SRR3208020.sra Read 540321 spots for SRR3208020.sra Written 540321 spots for SRR3208020.sra Read 540321 spots for SRR3208020.sra Written 540321 spots for SRR3208020.sra Read 540321 spots for SRR3208020.sra Written 540321 spots for SRR3208020.sra Read 540321 spots for SRR3208020.sra Written 540321 spots for SRR3208020.sra Read 540321 spots for SRR3208020.sra Written 540321 spots for SRR3208020.sra Read 540321 spots for SRR3208020.sra Written 540321 spots for SRR3208020.sra Read 540321 spots for SRR3208020.sra Written 540321 spots for SRR3208020.sra Read 540321 spots for SRR3208020.sra Written 540321 spots for SRR3208020.sra Read 540321 spots for SRR3208020.sra Written 540321 spots for SRR3208020.sra Read 540321 spots for SRR3208020.sra Written 540321 spots for SRR3208020.sra Read 540321 spots for SRR3208020.sra Written 540321 spots for SRR3208020.sra Read 540321 spots for SRR3208020.sra Written 540321 spots for SRR3208020.sra Read 540321 spots for SRR3208020.sra Written 540321 spots for SRR3208020.sra Read 540324 spots for SRR3208020.sra Written 540324 spots for SRR3208020.sra Read 540321 spots for SRR3208020.sra Written 540321 spots for SRR3208020.sra Read 540321 spots for SRR3208020.sra Written 540321 spots for SRR3208020.sra SRR ids: ['SRR3208020.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_glxpfcay SRR3208020.sra spots: 10806423 blocks: [[1, 540321], [540322, 1080642], [1080643, 1620963], [1620964, 2161284], [2161285, 2701605], [2701606, 3241926], [3241927, 3782247], [3782248, 4322568], [4322569, 4862889], [4862890, 5403210], [5403211, 5943531], [5943532, 6483852], [6483853, 7024173], [7024174, 7564494], [7564495, 8104815], [8104816, 8645136], [8645137, 9185457], [9185458, 9725778], [9725779, 10266099], [10266100, 10806423]] SRR3208020 file size 3455812 SRR3208020 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208020 SRR3208020_1.fastq Input file: SRR3208020_1.fastq trimmed: SRR3208020-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 01:20:18 2025 >> started Wed Feb 12 01:20:24 2025 >> done (5.569s) 10806423 reads processed; of these: 9685 ( 0.09%) short reads filtered out after trimming by size control 57021 ( 0.53%) empty reads filtered out after trimming by size control 10739717 (99.38%) reads available; of these: 1123125 (10.46%) trimmed reads available after processing 9616592 (89.54%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 417 0.00% 19 557 0.01% 20 1657 0.02% 21 430 0.00% 22 442 0.00% 23 529 0.00% 24 608 0.01% 25 642 0.01% 26 675 0.01% 27 578 0.01% 28 635 0.01% 29 649 0.01% 30 906 0.01% 31 785 0.01% 32 609 0.01% 33 561 0.01% 34 567 0.01% 35 570 0.01% 36 623 0.01% 37 610 0.01% 38 645 0.01% 39 584 0.01% 40 668 0.01% 41 641 0.01% 42 649 0.01% 43 663 0.01% 44 656 0.01% 45 643 0.01% 46 725 0.01% 47 711 0.01% 48 712 0.01% 49 705 0.01% 50 714 0.01% 51 737 0.01% 52 754 0.01% 53 753 0.01% 54 766 0.01% 55 830 0.01% 56 896 0.01% 57 921 0.01% 58 906 0.01% 59 956 0.01% 60 1015 0.01% 61 1073 0.01% 62 1421 0.01% 63 1095 0.01% 64 1355 0.01% 65 1472 0.01% 66 1298 0.01% 67 1431 0.01% 68 1366 0.01% 69 1509 0.01% 70 1551 0.01% 71 1730 0.02% 72 1827 0.02% 73 1937 0.02% 74 1975 0.02% 75 2167 0.02% 76 2423 0.02% 77 2347 0.02% 78 2665 0.02% 79 2857 0.03% 80 3197 0.03% 81 3633 0.03% 82 4106 0.04% 83 4421 0.04% 84 4808 0.04% 85 5171 0.05% 86 5521 0.05% 87 6052 0.06% 88 6674 0.06% 89 7665 0.07% 90 8823 0.08% 91 10136 0.09% 92 11386 0.11% 93 12604 0.12% 94 1503 0.01% 95 1611 0.02% 96 1879 0.02% 97 2111 0.02% 98 1677 0.02% 99 1748 0.02% 100 1985 0.02% 101 2000 0.02% 102 2357 0.02% 103 3336 0.03% 104 2500 0.02% 105 2565 0.02% 106 2591 0.02% 107 2832 0.03% 108 3139 0.03% 109 3323 0.03% 110 3798 0.04% 111 4063 0.04% 112 4663 0.04% 113 5227 0.05% 114 6267 0.06% 115 7242 0.07% 116 8700 0.08% 117 9906 0.09% 118 12554 0.12% 119 15939 0.15% 120 22016 0.20% 121 31392 0.29% 122 51783 0.48% 123 111792 1.04% 124 632630 5.89% 125 9616592 89.54% 10739717 reads passed initial QC criterion=sequence-density sequence-density=5.37 sequence-density-rank=1 fanout-score=48.21 fanout-score-rank=1 prefix-density=7.19 prefix-fanout=36.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=5.37 sequence-density-rank=1 fanout-score=48.21 fanout-score-rank=1 prefix-density=7.19 prefix-fanout=36.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR3208020 - Input file: STDIN trimmed: SRR3208020-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 01:21:05 2025 >> started Wed Feb 12 01:21:13 2025 >> done (7.589s) 7159811 reads processed; of these: 130 ( 0.00%) short reads filtered out after trimming by size control 857 ( 0.01%) empty reads filtered out after trimming by size control 7158824 (99.99%) reads available; of these: 1082038 (15.11%) trimmed reads available after processing 6076786 (84.89%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 293 0.00% 19 390 0.01% 20 1823 0.03% 21 296 0.00% 22 314 0.00% 23 340 0.00% 24 398 0.01% 25 429 0.01% 26 459 0.01% 27 395 0.01% 28 413 0.01% 29 440 0.01% 30 637 0.01% 31 527 0.01% 32 386 0.01% 33 385 0.01% 34 380 0.01% 35 364 0.01% 36 416 0.01% 37 392 0.01% 38 447 0.01% 39 406 0.01% 40 456 0.01% 41 433 0.01% 42 421 0.01% 43 448 0.01% 44 432 0.01% 45 450 0.01% 46 483 0.01% 47 495 0.01% 48 458 0.01% 49 469 0.01% 50 492 0.01% 51 498 0.01% 52 514 0.01% 53 495 0.01% 54 525 0.01% 55 567 0.01% 56 594 0.01% 57 615 0.01% 58 605 0.01% 59 651 0.01% 60 697 0.01% 61 730 0.01% 62 918 0.01% 63 716 0.01% 64 894 0.01% 65 760 0.01% 66 848 0.01% 67 935 0.01% 68 944 0.01% 69 1006 0.01% 70 1053 0.01% 71 1166 0.02% 72 1235 0.02% 73 1254 0.02% 74 1317 0.02% 75 1268 0.02% 76 1459 0.02% 77 1519 0.02% 78 1805 0.03% 79 1911 0.03% 80 2140 0.03% 81 2362 0.03% 82 2745 0.04% 83 2905 0.04% 84 3259 0.05% 85 3434 0.05% 86 3649 0.05% 87 4072 0.06% 88 4494 0.06% 89 5136 0.07% 90 5805 0.08% 91 6622 0.09% 92 7569 0.11% 93 8515 0.12% 94 9393 0.13% 95 10152 0.14% 96 10940 0.15% 97 12027 0.17% 98 13117 0.18% 99 14642 0.20% 100 16669 0.23% 101 18612 0.26% 102 20938 0.29% 103 23506 0.33% 104 24968 0.35% 105 26436 0.37% 106 27275 0.38% 107 29087 0.41% 108 30540 0.43% 109 32852 0.46% 110 35559 0.50% 111 38951 0.54% 112 42313 0.59% 113 45962 0.64% 114 49271 0.69% 115 51735 0.72% 116 53845 0.75% 117 55181 0.77% 118 57264 0.80% 119 62203 0.87% 120 75060 1.05% 121 106710 1.49% 122 218590 3.05% 123 65855 0.92% 124 370500 5.18% 125 5403098 75.47% criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=28 prefix-density=0.20 prefix-fanout=2.1 sequence=CCTCTACTGTGGCCTAACCCTATGGCTCAACACCATTTCCCTAAGTTCAGCTGGATCAATCTCTGCTACATAATTAGCAGGCCTGTAATACCCAGTAACTGGATCAGGAGCCCATGCAGAGTAGGCCTCAGAATCTTCTTTGGCCACCGCCCCATCTTCCATTTTCCCTGTCATAGCACTGGTCCTTGACCCACCCCTACCGAAGCTCGCTGTTACAGCAGCACTGATCGGTGCAGCAGCCGCGTAACCTCTCCGGAAAACAGAGAGGGAAAGACCATCAGCAAGAGAAGCGACAAGAAGCTTAGCGTTTGGGAGAGAGCGAGCCATTTTATTTATGGTTTTCGTGTATATATATAGCTGCAGATGATACCGCAAATTCTTCTTGGAGTGGATTCTCAAGAAGAACAGCG criterion=fanout-score sequence-density=0.07 sequence-density-rank=12 fanout-score=23.28 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=8.5 sequence=GAAAAAGAAAAA Started job on | Feb 12 01:21:40 Started mapping on | Feb 12 01:21:40 Finished on | Feb 12 01:22:05 Mapping speed, Million of reads per hour | 1546.38 Number of input reads | 10738730 Average input read length | 122 UNIQUE READS: Uniquely mapped reads number | 9028824 Uniquely mapped reads % | 84.08% Average mapped length | 122.16 Number of splices: Total | 3338718 Number of splices: Annotated (sjdb) | 3255776 Number of splices: GT/AG | 3280336 Number of splices: GC/AG | 47703 Number of splices: AT/AC | 3800 Number of splices: Non-canonical | 6879 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.03% Deletion average length | 3.13 Insertion rate per base | 0.02% Insertion average length | 1.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 250979 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 622884 % of reads mapped to too many loci | 5.80% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.77% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1458927 1458927 1458927 N_multimapping 250979 250979 250979 N_noFeature 511179 4741170 4742938 N_ambiguous 95007 19469 19831 UnstrandedReadsAssigned:8422638 PositiveStrandReadsAssigned:4268185 NegativeStrandReadsAssigned:4266055 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208020 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208020-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,738,730 reads, 9,158,831 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,186 rounds 52401 SRR3208020.ke.tsv 34699 SRR3208020.se.tsv 87100 total ==> SRR3208020.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 899 65.5379 Potri.005G024800.1.v4.1 1035 936 3230 482.764 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 330.218 16.2435 Potri.016G087400.1.v4.1 270 171 175 143.169 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 151 12.6191 Potri.012G127500.1.v4.1 977 878 5950 948.049 ==> SRR3208020.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 25 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 173 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 31 SRR3208020 completed mapping pipeline successfully