Starting /dee2/code/volunteer_pipeline.sh SRR3208021 current disk space = 3051164045312 free memory = 1098540880 SRR3208021 SRAfilesize 215abaf1b20cbf315ead690fb5c57f9b SRR3208021.sra SRR3208021.sra file validated SRR3208021 is single end SRR3208021 is conventional basespace SRR3208021 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208021_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.51075 33.0 33.0 33.0 33.0 33.0 2 31.9995 33.0 33.0 33.0 33.0 33.0 3 31.99 33.0 33.0 33.0 33.0 33.0 4 32.20425 33.0 33.0 33.0 33.0 33.0 5 32.3075 33.0 33.0 33.0 33.0 33.0 6 35.97525 37.0 37.0 37.0 37.0 37.0 7 36.04375 37.0 37.0 37.0 37.0 37.0 8 36.02875 37.0 37.0 37.0 37.0 37.0 9 36.121 37.0 37.0 37.0 37.0 37.0 10-11 36.15975 37.0 37.0 37.0 37.0 37.0 12-13 36.216499999999996 37.0 37.0 37.0 37.0 37.0 14-15 36.1545 37.0 37.0 37.0 37.0 37.0 16-17 36.152875 37.0 37.0 37.0 37.0 37.0 18-19 36.1755 37.0 37.0 37.0 37.0 37.0 20-21 36.11775 37.0 37.0 37.0 37.0 37.0 22-23 36.165375 37.0 37.0 37.0 37.0 37.0 24-25 36.091 37.0 37.0 37.0 37.0 37.0 26-27 35.945 37.0 37.0 37.0 37.0 37.0 28-29 36.123875 37.0 37.0 37.0 37.0 37.0 30-31 36.11125 37.0 37.0 37.0 37.0 37.0 32-33 36.1475 37.0 37.0 37.0 37.0 37.0 34-35 36.069625 37.0 37.0 37.0 37.0 37.0 36-37 36.099500000000006 37.0 37.0 37.0 37.0 37.0 38-39 36.1195 37.0 37.0 37.0 37.0 37.0 40-41 36.09725 37.0 37.0 37.0 37.0 37.0 42-43 36.11175 37.0 37.0 37.0 37.0 37.0 44-45 36.1015 37.0 37.0 37.0 37.0 37.0 46-47 36.140875 37.0 37.0 37.0 37.0 37.0 48-49 36.158375 37.0 37.0 37.0 37.0 37.0 50-51 36.137625 37.0 37.0 37.0 37.0 37.0 52-53 35.995374999999996 37.0 37.0 37.0 37.0 37.0 54-55 36.016625000000005 37.0 37.0 37.0 37.0 37.0 56-57 36.0705 37.0 37.0 37.0 37.0 37.0 58-59 36.046875 37.0 37.0 37.0 37.0 37.0 60-61 36.0565 37.0 37.0 37.0 37.0 37.0 62-63 35.9555 37.0 37.0 37.0 37.0 37.0 64-65 35.966625 37.0 37.0 37.0 37.0 37.0 66-67 36.031 37.0 37.0 37.0 37.0 37.0 68-69 35.958875000000006 37.0 37.0 37.0 37.0 37.0 70-71 35.955375000000004 37.0 37.0 37.0 37.0 37.0 72-73 35.98725 37.0 37.0 37.0 37.0 37.0 74-75 35.945 37.0 37.0 37.0 37.0 37.0 76-77 35.8925 37.0 37.0 37.0 37.0 37.0 78-79 35.885625000000005 37.0 37.0 37.0 37.0 37.0 80-81 35.858875 37.0 37.0 37.0 37.0 37.0 82-83 35.874875 37.0 37.0 37.0 37.0 37.0 84-85 35.860875 37.0 37.0 37.0 37.0 37.0 86-87 35.87425 37.0 37.0 37.0 37.0 37.0 88-89 35.829875 37.0 37.0 37.0 37.0 37.0 90-91 35.8665 37.0 37.0 37.0 37.0 37.0 92-93 35.835375 37.0 37.0 37.0 37.0 37.0 94-95 35.8335 37.0 37.0 37.0 37.0 37.0 96-97 35.785375 37.0 37.0 37.0 37.0 37.0 98-99 35.75375 37.0 37.0 37.0 37.0 37.0 100-101 35.8 37.0 37.0 37.0 37.0 37.0 102-103 35.699375 37.0 37.0 37.0 37.0 37.0 104-105 35.668375 37.0 37.0 37.0 37.0 37.0 106-107 35.735749999999996 37.0 37.0 37.0 37.0 37.0 108-109 35.70725 37.0 37.0 37.0 37.0 37.0 110-111 35.71575 37.0 37.0 37.0 37.0 37.0 112-113 35.630875 37.0 37.0 37.0 37.0 37.0 114-115 35.541625 37.0 37.0 37.0 37.0 37.0 116-117 35.49725 37.0 37.0 37.0 33.0 37.0 118-119 35.50087499999999 37.0 37.0 37.0 35.0 37.0 120-121 35.471375 37.0 37.0 37.0 37.0 37.0 122-123 35.379125 37.0 37.0 37.0 35.0 37.0 124-125 34.024375 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 25.0 3 0.0 4 1.0 5 0.0 6 1.0 7 2.0 8 2.0 9 0.0 10 2.0 11 0.0 12 1.0 13 1.0 14 3.0 15 2.0 16 2.0 17 1.0 18 2.0 19 2.0 20 2.0 21 5.0 22 2.0 23 4.0 24 2.0 25 6.0 26 9.0 27 10.0 28 26.0 29 28.0 30 34.0 31 48.0 32 74.0 33 86.0 34 135.0 35 275.0 36 3207.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 20.12226184411615 18.059093224656138 13.219561895058584 48.59908303616913 2 18.375 23.075000000000003 38.675 19.875 3 20.150000000000002 27.325 26.6 25.924999999999997 4 24.15 30.175 22.0 23.674999999999997 5 25.424999999999997 34.025 23.35 17.2 6 18.6 36.7 24.8 19.900000000000002 7 17.95 21.275 41.25 19.525000000000002 8 18.775 25.4 31.125000000000004 24.7 9 19.1 23.724999999999998 32.375 24.8 10-11 21.7375 32.9 24.087500000000002 21.275 12-13 19.9125 27.200000000000003 29.8875 23.0 14-15 20.9375 27.8625 28.237499999999997 22.9625 16-17 21.7 28.1375 27.8875 22.275 18-19 21.5625 28.7375 28.262500000000003 21.4375 20-21 22.275 28.425 28.1375 21.1625 22-23 21.925 28.925 28.212500000000002 20.9375 24-25 21.375 28.9125 27.575 22.1375 26-27 21.025 28.5875 28.725 21.6625 28-29 21.825 28.249999999999996 28.1 21.825 30-31 20.925 29.525000000000002 27.462500000000002 22.0875 32-33 20.65 28.712500000000002 28.449999999999996 22.1875 34-35 21.337500000000002 28.037499999999998 28.812500000000004 21.8125 36-37 21.5 28.6125 28.1 21.7875 38-39 21.7875 29.0875 27.950000000000003 21.175 40-41 21.8625 28.3125 28.1 21.725 42-43 20.549999999999997 28.0875 28.237499999999997 23.125 44-45 21.075 28.6125 28.349999999999998 21.9625 46-47 21.4375 28.050000000000004 28.012500000000003 22.5 48-49 20.7625 29.2 28.962500000000002 21.075 50-51 21.987499999999997 28.037499999999998 27.925 22.05 52-53 22.225 28.599999999999998 27.85 21.325 54-55 22.0625 26.987499999999997 28.475 22.475 56-57 20.6625 28.275 28.050000000000004 23.0125 58-59 21.462500000000002 29.025000000000002 27.575 21.9375 60-61 21.8 28.525 27.125 22.55 62-63 22.400000000000002 28.325 27.675 21.6 64-65 20.677584698087262 29.028628578572324 28.716089511188898 21.57769721215152 66-67 21.4125 29.225 28.1375 21.224999999999998 68-69 21.277659707463435 28.60357544693087 28.328541067633456 21.790223777972244 70-71 21.55 28.875 27.625 21.95 72-73 21.625 28.525 27.962500000000002 21.8875 74-75 21.6125 26.724999999999998 29.599999999999998 22.0625 76-77 21.865233154144267 28.96612076509564 27.84098012251531 21.327665958244783 78-79 21.705426356589147 27.53188297074269 29.232308077019255 21.530382595648913 80-81 22.123561780890444 28.4392196098049 28.251625812906454 21.1855927963982 82-83 21.80545136284071 27.294323580895224 29.03225806451613 21.867966991747938 84-85 22.602825353169145 28.353544193024128 28.34104263032879 20.702587823477934 86-87 21.375 28.762500000000003 27.975 21.8875 88-89 21.525 28.625 28.487499999999997 21.3625 90-91 21.875 29.075 27.737499999999997 21.3125 92-93 22.4375 28.3125 28.3875 20.8625 94-95 20.837500000000002 29.725 28.1375 21.3 96-97 21.05 28.787499999999998 27.700000000000003 22.4625 98-99 21.7875 28.9 27.625 21.6875 100-101 22.112499999999997 28.075 27.575 22.237499999999997 102-103 22.05 28.799999999999997 28.125 21.025 104-105 22.0625 28.975 27.5625 21.4 106-107 23.275000000000002 28.6875 27.474999999999998 20.5625 108-109 22.2625 29.1875 28.125 20.424999999999997 110-111 22.6 28.1375 27.8875 21.375 112-113 23.0125 28.599999999999998 27.55 20.837500000000002 114-115 22.400000000000002 29.025000000000002 27.900000000000002 20.674999999999997 116-117 22.82785348168521 28.90361295161895 27.590948868608578 20.677584698087262 118-119 23.25 29.462500000000002 26.200000000000003 21.087500000000002 120-121 23.175 29.362500000000004 26.3 21.1625 122-123 23.425 29.4125 26.200000000000003 20.962500000000002 124-125 22.675 29.362500000000004 26.400000000000002 21.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.5 19 2.5 20 1.5 21 4.5 22 6.5 23 4.5 24 6.0 25 10.5 26 10.0 27 9.5 28 18.0 29 22.5 30 26.0 31 38.5 32 54.0 33 55.5 34 63.5 35 84.0 36 105.0 37 129.5 38 143.0 39 174.0 40 207.0 41 214.5 42 221.5 43 244.0 44 271.5 45 273.5 46 244.5 47 207.5 48 188.5 49 168.0 50 146.5 51 133.0 52 106.5 53 81.5 54 68.0 55 51.5 56 36.0 57 26.0 58 23.0 59 23.5 60 17.5 61 13.0 62 12.0 63 9.5 64 4.0 65 6.5 66 8.0 67 3.0 68 2.0 69 5.0 70 4.5 71 1.0 72 1.0 73 0.5 74 1.5 75 2.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.8499999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0125 66-67 0.0 68-69 0.0125 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0125 78-79 0.025 80-81 0.05 82-83 0.025 84-85 0.0125 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0125 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94997498749375 99.9 2 0.05002501250625312 0.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 1.1124999999999998 0.0 0.0 0.0 0.0 98-99 1.3625 0.0 0.0 0.0 0.0 100-101 1.6375 0.0 0.0 0.0 0.0 102-103 2.0125 0.0 0.0 0.0 0.0 104-105 2.3875 0.0 0.0 0.0 0.0 106-107 3.175 0.0 0.0 0.0 0.0 108-109 3.9124999999999996 0.0 0.0 0.0 0.0 110-111 4.7375 0.0 0.0 0.0 0.0 112-113 5.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 665980 spots for SRR3208021.sra Written 665980 spots for SRR3208021.sra Read 665980 spots for SRR3208021.sra Written 665980 spots for SRR3208021.sra Read 665980 spots for SRR3208021.sra Written 665980 spots for SRR3208021.sra Read 665980 spots for SRR3208021.sra Written 665980 spots for SRR3208021.sra Read 665980 spots for SRR3208021.sra Written 665980 spots for SRR3208021.sra Read 665980 spots for SRR3208021.sra Written 665980 spots for SRR3208021.sra Read 665992 spots for SRR3208021.sra Written 665992 spots for SRR3208021.sra Read 665980 spots for SRR3208021.sra Written 665980 spots for SRR3208021.sra Read 665980 spots for SRR3208021.sra Written 665980 spots for SRR3208021.sra Read 665980 spots for SRR3208021.sra Written 665980 spots for SRR3208021.sra Read 665980 spots for SRR3208021.sra Written 665980 spots for SRR3208021.sra Read 665980 spots for SRR3208021.sra Written 665980 spots for SRR3208021.sra Read 665980 spots for SRR3208021.sra Written 665980 spots for SRR3208021.sra Read 665980 spots for SRR3208021.sra Written 665980 spots for SRR3208021.sra Read 665980 spots for SRR3208021.sra Written 665980 spots for SRR3208021.sra Read 665980 spots for SRR3208021.sra Written 665980 spots for SRR3208021.sra Read 665980 spots for SRR3208021.sra Written 665980 spots for SRR3208021.sra Read 665980 spots for SRR3208021.sra Written 665980 spots for SRR3208021.sra Read 665980 spots for SRR3208021.sra Written 665980 spots for SRR3208021.sra Read 665980 spots for SRR3208021.sra Written 665980 spots for SRR3208021.sra SRR ids: ['SRR3208021.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qs4k7xl1 SRR3208021.sra spots: 13319612 blocks: [[1, 665980], [665981, 1331960], [1331961, 1997940], [1997941, 2663920], [2663921, 3329900], [3329901, 3995880], [3995881, 4661860], [4661861, 5327840], [5327841, 5993820], [5993821, 6659800], [6659801, 7325780], [7325781, 7991760], [7991761, 8657740], [8657741, 9323720], [9323721, 9989700], [9989701, 10655680], [10655681, 11321660], [11321661, 11987640], [11987641, 12653620], [12653621, 13319612]] SRR3208021 file size 4262093 SRR3208021 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208021 SRR3208021_1.fastq Input file: SRR3208021_1.fastq trimmed: SRR3208021-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 01:17:03 2025 >> started Wed Feb 12 01:17:10 2025 >> done (7.465s) 13319612 reads processed; of these: 13137 ( 0.10%) short reads filtered out after trimming by size control 54191 ( 0.41%) empty reads filtered out after trimming by size control 13252284 (99.49%) reads available; of these: 1569827 (11.85%) trimmed reads available after processing 11682457 (88.15%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 471 0.00% 19 522 0.00% 20 554 0.00% 21 600 0.00% 22 667 0.01% 23 772 0.01% 24 856 0.01% 25 1008 0.01% 26 1010 0.01% 27 937 0.01% 28 938 0.01% 29 1025 0.01% 30 1328 0.01% 31 1152 0.01% 32 931 0.01% 33 927 0.01% 34 928 0.01% 35 922 0.01% 36 961 0.01% 37 950 0.01% 38 1019 0.01% 39 1020 0.01% 40 1013 0.01% 41 998 0.01% 42 1058 0.01% 43 1048 0.01% 44 1025 0.01% 45 1082 0.01% 46 1075 0.01% 47 1098 0.01% 48 1164 0.01% 49 1249 0.01% 50 1209 0.01% 51 1287 0.01% 52 1296 0.01% 53 1247 0.01% 54 1287 0.01% 55 1307 0.01% 56 1381 0.01% 57 1417 0.01% 58 1477 0.01% 59 1572 0.01% 60 1688 0.01% 61 1617 0.01% 62 1686 0.01% 63 1592 0.01% 64 1783 0.01% 65 1780 0.01% 66 1815 0.01% 67 1886 0.01% 68 2009 0.02% 69 2150 0.02% 70 2279 0.02% 71 2364 0.02% 72 2471 0.02% 73 2524 0.02% 74 2735 0.02% 75 2815 0.02% 76 2915 0.02% 77 3142 0.02% 78 3368 0.03% 79 3633 0.03% 80 3996 0.03% 81 4368 0.03% 82 4745 0.04% 83 5189 0.04% 84 5579 0.04% 85 6122 0.05% 86 6427 0.05% 87 6985 0.05% 88 7789 0.06% 89 9036 0.07% 90 9902 0.07% 91 11446 0.09% 92 12814 0.10% 93 14154 0.11% 94 2267 0.02% 95 2433 0.02% 96 2608 0.02% 97 2736 0.02% 98 2871 0.02% 99 3033 0.02% 100 3327 0.03% 101 3520 0.03% 102 3743 0.03% 103 4077 0.03% 104 3736 0.03% 105 4140 0.03% 106 4292 0.03% 107 4640 0.04% 108 5267 0.04% 109 5516 0.04% 110 6105 0.05% 111 6972 0.05% 112 7697 0.06% 113 9148 0.07% 114 10109 0.08% 115 11856 0.09% 116 13926 0.11% 117 16499 0.12% 118 20783 0.16% 119 27354 0.21% 120 35965 0.27% 121 49828 0.38% 122 81571 0.62% 123 175724 1.33% 124 839492 6.33% 125 11682457 88.15% 13252284 reads passed initial QC criterion=sequence-density sequence-density=4.71 sequence-density-rank=1 fanout-score=47.54 fanout-score-rank=1 prefix-density=6.33 prefix-fanout=35.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTGAAA criterion=fanout-score sequence-density=4.71 sequence-density-rank=1 fanout-score=47.54 fanout-score-rank=1 prefix-density=6.33 prefix-fanout=35.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTGAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTGAAA -o SRR3208021 - Input file: STDIN trimmed: SRR3208021-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 01:17:45 2025 >> started Wed Feb 12 01:17:55 2025 >> done (10.222s) 7951371 reads processed; of these: 86 ( 0.00%) short reads filtered out after trimming by size control 240 ( 0.00%) empty reads filtered out after trimming by size control 7951045 (100.00%) reads available; of these: 1100197 (13.84%) trimmed reads available after processing 6850848 (86.16%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 276 0.00% 19 317 0.00% 20 356 0.00% 21 350 0.00% 22 413 0.01% 23 461 0.01% 24 517 0.01% 25 600 0.01% 26 636 0.01% 27 572 0.01% 28 552 0.01% 29 610 0.01% 30 803 0.01% 31 693 0.01% 32 579 0.01% 33 546 0.01% 34 549 0.01% 35 554 0.01% 36 574 0.01% 37 569 0.01% 38 621 0.01% 39 620 0.01% 40 607 0.01% 41 613 0.01% 42 668 0.01% 43 646 0.01% 44 611 0.01% 45 645 0.01% 46 662 0.01% 47 657 0.01% 48 708 0.01% 49 715 0.01% 50 711 0.01% 51 760 0.01% 52 767 0.01% 53 735 0.01% 54 756 0.01% 55 798 0.01% 56 835 0.01% 57 858 0.01% 58 909 0.01% 59 937 0.01% 60 1023 0.01% 61 971 0.01% 62 996 0.01% 63 945 0.01% 64 1062 0.01% 65 1066 0.01% 66 1116 0.01% 67 1162 0.01% 68 1195 0.02% 69 1295 0.02% 70 1381 0.02% 71 1429 0.02% 72 1431 0.02% 73 1413 0.02% 74 1556 0.02% 75 1706 0.02% 76 1714 0.02% 77 1912 0.02% 78 2059 0.03% 79 2245 0.03% 80 2369 0.03% 81 2657 0.03% 82 2780 0.03% 83 3163 0.04% 84 3398 0.04% 85 3706 0.05% 86 3880 0.05% 87 4199 0.05% 88 4822 0.06% 89 5489 0.07% 90 5954 0.07% 91 6709 0.08% 92 7697 0.10% 93 8524 0.11% 94 9316 0.12% 95 10427 0.13% 96 11045 0.14% 97 11975 0.15% 98 13180 0.17% 99 14620 0.18% 100 16611 0.21% 101 18711 0.24% 102 21133 0.27% 103 23478 0.30% 104 24939 0.31% 105 26431 0.33% 106 27813 0.35% 107 29247 0.37% 108 31489 0.40% 109 33841 0.43% 110 36813 0.46% 111 40585 0.51% 112 43961 0.55% 113 48154 0.61% 114 50956 0.64% 115 53752 0.68% 116 55945 0.70% 117 58227 0.73% 118 61802 0.78% 119 68007 0.86% 120 83834 1.05% 121 121386 1.53% 122 247772 3.12% 123 94386 1.19% 124 450304 5.66% 125 5991515 75.36% criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=35 prefix-density=0.11 prefix-fanout=2.4 sequence=TTTTTGTATTTTTAGTAGAGAC criterion=fanout-score sequence-density=0.06 sequence-density-rank=16 fanout-score=20.04 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=8.1 sequence=GAATTTCTTCCA Started job on | Feb 12 01:18:27 Started mapping on | Feb 12 01:18:28 Finished on | Feb 12 01:19:15 Mapping speed, Million of reads per hour | 1015.04 Number of input reads | 13251958 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 10906340 Uniquely mapped reads % | 82.30% Average mapped length | 122.23 Number of splices: Total | 4081996 Number of splices: Annotated (sjdb) | 3988331 Number of splices: GT/AG | 4012282 Number of splices: GC/AG | 56600 Number of splices: AT/AC | 4516 Number of splices: Non-canonical | 8598 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.42 Insertion rate per base | 0.02% Insertion average length | 1.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 286251 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 255281 % of reads mapped to too many loci | 1.93% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.60% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2059367 2059367 2059367 N_multimapping 286251 286251 286251 N_noFeature 556816 5703636 5698748 N_ambiguous 108104 23697 23866 UnstrandedReadsAssigned:10241420 PositiveStrandReadsAssigned:5179007 NegativeStrandReadsAssigned:5183726 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208021 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208021-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,251,958 reads, 10,688,524 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,159 rounds 52401 SRR3208021.ke.tsv 34699 SRR3208021.se.tsv 87100 total ==> SRR3208021.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1034 68.4284 Potri.005G024800.1.v4.1 1035 936 1280 173.67 Potri.004G059700.1.v4.1 961 862 8 1.17862 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 273.284 12.2032 Potri.016G087400.1.v4.1 270 171 248.447 184.514 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 394 29.8904 Potri.012G127500.1.v4.1 977 878 4230 611.839 ==> SRR3208021.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 464 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 173 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 24 SRR3208021 completed mapping pipeline successfully