Starting /dee2/code/volunteer_pipeline.sh SRR3208022 current disk space = 3050720665600 free memory = 1300060164 SRR3208022 SRAfilesize 4fdaa8dd92ca8f61595685094a3851f1 SRR3208022.sra SRR3208022.sra file validated SRR3208022 is single end SRR3208022 is conventional basespace SRR3208022 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208022_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.26075 33.0 33.0 33.0 33.0 33.0 2 32.0895 33.0 33.0 33.0 33.0 33.0 3 32.136 33.0 33.0 33.0 33.0 33.0 4 32.30625 33.0 33.0 33.0 33.0 33.0 5 32.44025 33.0 33.0 33.0 33.0 33.0 6 36.00475 37.0 37.0 37.0 37.0 37.0 7 36.18375 37.0 37.0 37.0 37.0 37.0 8 36.25125 37.0 37.0 37.0 37.0 37.0 9 36.262 37.0 37.0 37.0 37.0 37.0 10-11 36.238749999999996 37.0 37.0 37.0 37.0 37.0 12-13 36.320875 37.0 37.0 37.0 37.0 37.0 14-15 36.284375 37.0 37.0 37.0 37.0 37.0 16-17 36.239000000000004 37.0 37.0 37.0 37.0 37.0 18-19 36.317 37.0 37.0 37.0 37.0 37.0 20-21 36.241125 37.0 37.0 37.0 37.0 37.0 22-23 36.180375 37.0 37.0 37.0 37.0 37.0 24-25 36.081500000000005 37.0 37.0 37.0 37.0 37.0 26-27 35.979 37.0 37.0 37.0 37.0 37.0 28-29 36.178 37.0 37.0 37.0 37.0 37.0 30-31 36.167874999999995 37.0 37.0 37.0 37.0 37.0 32-33 36.138625000000005 37.0 37.0 37.0 37.0 37.0 34-35 36.158875 37.0 37.0 37.0 37.0 37.0 36-37 36.18025 37.0 37.0 37.0 37.0 37.0 38-39 36.179125 37.0 37.0 37.0 37.0 37.0 40-41 36.119375 37.0 37.0 37.0 37.0 37.0 42-43 36.145875000000004 37.0 37.0 37.0 37.0 37.0 44-45 36.104124999999996 37.0 37.0 37.0 37.0 37.0 46-47 36.138625 37.0 37.0 37.0 37.0 37.0 48-49 36.17275 37.0 37.0 37.0 37.0 37.0 50-51 36.158375 37.0 37.0 37.0 37.0 37.0 52-53 36.114000000000004 37.0 37.0 37.0 37.0 37.0 54-55 36.144625 37.0 37.0 37.0 37.0 37.0 56-57 36.13275 37.0 37.0 37.0 37.0 37.0 58-59 36.116 37.0 37.0 37.0 37.0 37.0 60-61 36.1835 37.0 37.0 37.0 37.0 37.0 62-63 36.160125 37.0 37.0 37.0 37.0 37.0 64-65 36.035 37.0 37.0 37.0 37.0 37.0 66-67 36.027 37.0 37.0 37.0 37.0 37.0 68-69 35.937125 37.0 37.0 37.0 37.0 37.0 70-71 35.985 37.0 37.0 37.0 37.0 37.0 72-73 35.89475 37.0 37.0 37.0 37.0 37.0 74-75 35.579375 37.0 37.0 37.0 37.0 37.0 76-77 35.574 37.0 37.0 37.0 37.0 37.0 78-79 35.579625 37.0 37.0 37.0 37.0 37.0 80-81 35.575874999999996 37.0 37.0 37.0 37.0 37.0 82-83 35.612125 37.0 37.0 37.0 37.0 37.0 84-85 35.554625 37.0 37.0 37.0 37.0 37.0 86-87 35.535375 37.0 37.0 37.0 37.0 37.0 88-89 35.444125 37.0 37.0 37.0 37.0 37.0 90-91 35.492125 37.0 37.0 37.0 37.0 37.0 92-93 35.507875 37.0 37.0 37.0 37.0 37.0 94-95 35.407875000000004 37.0 37.0 37.0 37.0 37.0 96-97 35.35275 37.0 37.0 37.0 37.0 37.0 98-99 35.38925 37.0 37.0 37.0 37.0 37.0 100-101 35.432874999999996 37.0 37.0 37.0 37.0 37.0 102-103 35.313125 37.0 37.0 37.0 37.0 37.0 104-105 35.261250000000004 37.0 37.0 37.0 37.0 37.0 106-107 35.3035 37.0 37.0 37.0 37.0 37.0 108-109 35.283125 37.0 37.0 37.0 37.0 37.0 110-111 35.289 37.0 37.0 37.0 37.0 37.0 112-113 35.329750000000004 37.0 37.0 37.0 37.0 37.0 114-115 35.21075 37.0 37.0 37.0 35.0 37.0 116-117 35.107 37.0 37.0 37.0 33.0 37.0 118-119 35.135625 37.0 37.0 37.0 37.0 37.0 120-121 35.03475 37.0 37.0 37.0 33.0 37.0 122-123 35.006625 37.0 37.0 37.0 35.0 37.0 124-125 33.8155 37.0 37.0 37.0 27.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 0.0 4 0.0 5 0.0 6 2.0 7 7.0 8 1.0 9 3.0 10 0.0 11 1.0 12 1.0 13 0.0 14 1.0 15 2.0 16 2.0 17 3.0 18 3.0 19 9.0 20 6.0 21 10.0 22 33.0 23 7.0 24 7.0 25 7.0 26 12.0 27 12.0 28 17.0 29 23.0 30 30.0 31 30.0 32 64.0 33 78.0 34 121.0 35 229.0 36 3259.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.955486542443065 15.320910973084887 11.30952380952381 50.414078674948236 2 16.8 22.375 42.225 18.6 3 20.150000000000002 25.1 29.775000000000002 24.975 4 23.575 31.724999999999998 20.200000000000003 24.5 5 26.25 34.275 22.275 17.2 6 21.349999999999998 35.625 23.625 19.400000000000002 7 17.0 20.375 41.0 21.625 8 18.6 25.275 30.3 25.825 9 21.425 22.875 31.724999999999998 23.974999999999998 10-11 22.4625 32.8125 23.3125 21.4125 12-13 19.8125 27.3875 29.9625 22.8375 14-15 20.5 28.175 28.15 23.175 16-17 22.412499999999998 27.487499999999997 26.8 23.3 18-19 21.4875 26.987499999999997 28.4375 23.0875 20-21 22.650000000000002 27.975 27.787499999999998 21.587500000000002 22-23 21.3125 30.25 26.8625 21.575 24-25 21.099999999999998 27.125 28.65 23.125 26-27 20.4625 28.3625 27.6875 23.4875 28-29 22.1 28.825 26.7125 22.3625 30-31 20.837500000000002 28.825 27.675 22.662499999999998 32-33 21.075 27.800000000000004 27.800000000000004 23.325000000000003 34-35 22.125 28.712500000000002 27.1 22.0625 36-37 20.8 28.9375 26.737499999999997 23.525 38-39 21.175 27.750000000000004 27.250000000000004 23.825 40-41 21.5375 28.7375 28.225 21.5 42-43 21.625 28.025 28.237499999999997 22.112499999999997 44-45 22.8 27.05 27.762500000000003 22.3875 46-47 21.4875 28.537499999999998 28.7375 21.2375 48-49 21.6125 28.212500000000002 28.1625 22.0125 50-51 21.512500000000003 27.275 27.750000000000004 23.4625 52-53 21.712500000000002 27.85 28.15 22.287499999999998 54-55 21.25 28.749999999999996 27.250000000000004 22.75 56-57 21.6 27.375 28.199999999999996 22.825 58-59 23.025000000000002 27.325 27.2625 22.3875 60-61 21.7 27.750000000000004 28.5625 21.987499999999997 62-63 22.0875 27.675 28.9 21.337500000000002 64-65 21.55 29.525000000000002 27.55 21.375 66-67 21.3875 29.4375 27.6125 21.5625 68-69 21.475 29.375 27.8375 21.3125 70-71 22.075 28.4375 27.775 21.712500000000002 72-73 22.525000000000002 29.95 26.9625 20.5625 74-75 21.85 28.825 27.0 22.325 76-77 20.8125 29.475 27.175 22.537499999999998 78-79 21.075 29.0875 27.487499999999997 22.35 80-81 23.1 27.625 27.6 21.675 82-83 22.112499999999997 28.3875 27.875 21.625 84-85 22.0 28.037499999999998 27.1375 22.825 86-87 21.75 29.3875 27.0125 21.85 88-89 22.775000000000002 28.749999999999996 27.224999999999998 21.25 90-91 22.525000000000002 28.075 27.1625 22.237499999999997 92-93 22.4375 27.8375 28.325 21.4 94-95 21.5 26.5625 29.0875 22.85 96-97 22.05 27.525 28.287499999999998 22.1375 98-99 23.1375 27.175 28.025 21.6625 100-101 21.5375 28.975 27.8125 21.675 102-103 22.0 28.0875 27.875 22.037499999999998 104-105 22.5875 29.025000000000002 27.187499999999996 21.2 106-107 21.9375 28.6625 26.575 22.825 108-109 21.6625 28.6375 27.487499999999997 22.2125 110-111 22.4625 29.799999999999997 26.575 21.1625 112-113 22.625 27.962500000000002 28.1375 21.275 114-115 22.8875 27.6 27.762500000000003 21.75 116-117 23.6625 28.812500000000004 26.6 20.925 118-119 23.4875 29.15 26.674999999999997 20.6875 120-121 23.825 28.549999999999997 24.9 22.725 122-123 23.45 27.400000000000002 27.1125 22.037499999999998 124-125 22.675 29.6875 25.4625 22.175 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 0.0 25 2.0 26 6.5 27 8.5 28 7.0 29 13.5 30 20.5 31 26.0 32 40.0 33 48.5 34 51.0 35 74.5 36 98.5 37 105.0 38 132.0 39 159.0 40 190.5 41 213.0 42 235.5 43 264.0 44 265.0 45 269.0 46 266.5 47 267.0 48 247.5 49 203.0 50 158.5 51 129.5 52 111.0 53 84.5 54 67.5 55 53.0 56 43.5 57 33.5 58 20.5 59 13.0 60 9.5 61 7.0 62 9.0 63 10.5 64 5.5 65 5.0 66 4.5 67 2.5 68 2.5 69 3.0 70 4.0 71 3.0 72 1.0 73 0.0 74 0.5 75 1.5 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.4000000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09886714727085 96.22500000000001 2 0.7209062821833162 1.4000000000000001 3 0.12873326467559218 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025746652935118432 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.025746652935118432 1.7999999999999998 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC 72 1.7999999999999998 TruSeq Adapter, Index 4 (100% over 50bp) CGTATGCCGTCTTCTGCTTGAGATCGGAAGAGCACACGTCTGAACTCCAG 8 0.2 Illumina Multiplexing PCR Primer 2.01 (100% over 30bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.21250000000000002 0.0 0.0 0.0 0.0 22-23 0.325 0.0 0.0 0.0 0.0 24-25 0.325 0.0 0.0 0.0 0.0 26-27 0.325 0.0 0.0 0.0 0.0 28-29 0.325 0.0 0.0 0.0 0.0 30-31 0.3375 0.0 0.0 0.0 0.0 32-33 0.3625 0.0 0.0 0.0 0.0 34-35 0.4 0.0 0.0 0.0 0.0 36-37 0.4 0.0 0.0 0.0 0.0 38-39 0.4 0.0 0.0 0.0 0.0 40-41 0.4 0.0 0.0 0.0 0.0 42-43 0.4 0.0 0.0 0.0 0.0 44-45 0.4 0.0 0.0 0.0 0.0 46-47 0.4 0.0 0.0 0.0 0.0 48-49 0.4 0.0 0.0 0.0 0.0 50-51 0.4 0.0 0.0 0.0 0.0 52-53 0.4 0.0 0.0 0.0 0.0 54-55 0.4 0.0 0.0 0.0 0.0 56-57 0.4 0.0 0.0 0.0 0.0 58-59 0.4 0.0 0.0 0.0 0.0 60-61 0.425 0.0 0.0 0.0 0.0 62-63 0.475 0.0 0.0 0.0 0.0 64-65 0.475 0.0 0.0 0.0 0.0 66-67 0.475 0.0 0.0 0.0 0.0 68-69 0.5 0.0 0.0 0.0 0.0 70-71 0.5 0.0 0.0 0.0 0.0 72-73 0.5 0.0 0.0 0.0 0.0 74-75 0.5 0.0 0.0 0.0 0.0 76-77 0.5 0.0 0.0 0.0 0.0 78-79 0.5125 0.0 0.0 0.0 0.0 80-81 0.575 0.0 0.0 0.0 0.0 82-83 0.5874999999999999 0.0 0.0 0.0 0.0 84-85 0.6 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.1375 0.0 0.0 0.0 0.0 96-97 1.3625 0.0 0.0 0.0 0.0 98-99 1.575 0.0 0.0 0.0 0.0 100-101 1.825 0.0 0.0 0.0 0.0 102-103 2.25 0.0 0.0 0.0 0.0 104-105 2.8125 0.0 0.0 0.0 0.0 106-107 3.275 0.0 0.0 0.0 0.0 108-109 3.9875 0.0 0.0 0.0 0.0 110-111 4.825 0.0 0.0 0.0 0.0 112-113 5.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1265178 spots for SRR3208022.sra Written 1265178 spots for SRR3208022.sra Read 1265178 spots for SRR3208022.sra Written 1265178 spots for SRR3208022.sra Read 1265178 spots for SRR3208022.sra Written 1265178 spots for SRR3208022.sra Read 1265178 spots for SRR3208022.sra Written 1265178 spots for SRR3208022.sra Read 1265178 spots for SRR3208022.sra Written 1265178 spots for SRR3208022.sra Read 1265178 spots for SRR3208022.sra Written 1265178 spots for SRR3208022.sra Read 1265178 spots for SRR3208022.sra Written 1265178 spots for SRR3208022.sra Read 1265178 spots for SRR3208022.sra Written 1265178 spots for SRR3208022.sra Read 1265178 spots for SRR3208022.sra Written 1265178 spots for SRR3208022.sra Read 1265178 spots for SRR3208022.sra Written 1265178 spots for SRR3208022.sra Read 1265178 spots for SRR3208022.sra Written 1265178 spots for SRR3208022.sra Read 1265178 spots for SRR3208022.sra Written 1265178 spots for SRR3208022.sra Read 1265178 spots for SRR3208022.sra Written 1265178 spots for SRR3208022.sra Read 1265178 spots for SRR3208022.sra Written 1265178 spots for SRR3208022.sra Read 1265178 spots for SRR3208022.sra Written 1265178 spots for SRR3208022.sra Read 1265178 spots for SRR3208022.sra Written 1265178 spots for SRR3208022.sra Read 1265178 spots for SRR3208022.sra Written 1265178 spots for SRR3208022.sra Read 1265178 spots for SRR3208022.sra Written 1265178 spots for SRR3208022.sra Read 1265192 spots for SRR3208022.sra Written 1265192 spots for SRR3208022.sra Read 1265178 spots for SRR3208022.sra Written 1265178 spots for SRR3208022.sra SRR ids: ['SRR3208022.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8lphhvay SRR3208022.sra spots: 25303574 blocks: [[1, 1265178], [1265179, 2530356], [2530357, 3795534], [3795535, 5060712], [5060713, 6325890], [6325891, 7591068], [7591069, 8856246], [8856247, 10121424], [10121425, 11386602], [11386603, 12651780], [12651781, 13916958], [13916959, 15182136], [15182137, 16447314], [16447315, 17712492], [17712493, 18977670], [18977671, 20242848], [20242849, 21508026], [21508027, 22773204], [22773205, 24038382], [24038383, 25303574]] SRR3208022 file size 8106551 SRR3208022 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208022 SRR3208022_1.fastq Input file: SRR3208022_1.fastq trimmed: SRR3208022-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 01:54:46 2025 >> started Wed Feb 12 01:54:59 2025 >> done (13.332s) 25303574 reads processed; of these: 40221 ( 0.16%) short reads filtered out after trimming by size control 543472 ( 2.15%) empty reads filtered out after trimming by size control 24719881 (97.69%) reads available; of these: 2829773 (11.45%) trimmed reads available after processing 21890108 (88.55%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2452 0.01% 19 4683 0.02% 20 62581 0.25% 21 3181 0.01% 22 1875 0.01% 23 3764 0.02% 24 3679 0.01% 25 2694 0.01% 26 4596 0.02% 27 1885 0.01% 28 2169 0.01% 29 3575 0.01% 30 3269 0.01% 31 4627 0.02% 32 1935 0.01% 33 1734 0.01% 34 1913 0.01% 35 1876 0.01% 36 2047 0.01% 37 2223 0.01% 38 2111 0.01% 39 1870 0.01% 40 1883 0.01% 41 1974 0.01% 42 1985 0.01% 43 2034 0.01% 44 1891 0.01% 45 2042 0.01% 46 2147 0.01% 47 2064 0.01% 48 2171 0.01% 49 2291 0.01% 50 2344 0.01% 51 2363 0.01% 52 2421 0.01% 53 2379 0.01% 54 2427 0.01% 55 2582 0.01% 56 2682 0.01% 57 2845 0.01% 58 3067 0.01% 59 3142 0.01% 60 3550 0.01% 61 3823 0.02% 62 5600 0.02% 63 51003 0.21% 64 6906 0.03% 65 5099 0.02% 66 4107 0.02% 67 4167 0.02% 68 4119 0.02% 69 4592 0.02% 70 4703 0.02% 71 5443 0.02% 72 8759 0.04% 73 9069 0.04% 74 9029 0.04% 75 7307 0.03% 76 5640 0.02% 77 5694 0.02% 78 6355 0.03% 79 6987 0.03% 80 7157 0.03% 81 8650 0.03% 82 9076 0.04% 83 9928 0.04% 84 15866 0.06% 85 11153 0.05% 86 11621 0.05% 87 12807 0.05% 88 15314 0.06% 89 19019 0.08% 90 17868 0.07% 91 20083 0.08% 92 22382 0.09% 93 25025 0.10% 94 5100 0.02% 95 5354 0.02% 96 4729 0.02% 97 4680 0.02% 98 5153 0.02% 99 5332 0.02% 100 5901 0.02% 101 6578 0.03% 102 6618 0.03% 103 7101 0.03% 104 6528 0.03% 105 7031 0.03% 106 7358 0.03% 107 7885 0.03% 108 8973 0.04% 109 9600 0.04% 110 10505 0.04% 111 11669 0.05% 112 13275 0.05% 113 15026 0.06% 114 17324 0.07% 115 19920 0.08% 116 23185 0.09% 117 27610 0.11% 118 34310 0.14% 119 44195 0.18% 120 59001 0.24% 121 81035 0.33% 122 132164 0.53% 123 284433 1.15% 124 1416826 5.73% 125 21890108 88.55% 24719881 reads passed initial QC criterion=sequence-density sequence-density=4.54 sequence-density-rank=1 fanout-score=44.16 fanout-score-rank=1 prefix-density=6.18 prefix-fanout=32.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAG criterion=fanout-score sequence-density=4.54 sequence-density-rank=1 fanout-score=44.16 fanout-score-rank=1 prefix-density=6.18 prefix-fanout=32.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAG Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAG -o SRR3208022 - Input file: STDIN trimmed: SRR3208022-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 01:55:57 2025 >> started Wed Feb 12 01:56:13 2025 >> done (16.177s) 14831929 reads processed; of these: 1431 ( 0.01%) short reads filtered out after trimming by size control 48917 ( 0.33%) empty reads filtered out after trimming by size control 14781581 (99.66%) reads available; of these: 2046552 (13.85%) trimmed reads available after processing 12735029 (86.15%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1484 0.01% 19 2971 0.02% 20 48630 0.33% 21 2162 0.01% 22 1143 0.01% 23 2260 0.02% 24 2202 0.01% 25 1646 0.01% 26 3877 0.03% 27 1196 0.01% 28 1351 0.01% 29 2182 0.01% 30 1931 0.01% 31 2754 0.02% 32 1178 0.01% 33 1076 0.01% 34 1151 0.01% 35 1159 0.01% 36 1255 0.01% 37 1340 0.01% 38 1321 0.01% 39 1141 0.01% 40 1129 0.01% 41 1224 0.01% 42 1211 0.01% 43 1220 0.01% 44 1162 0.01% 45 1230 0.01% 46 1288 0.01% 47 1296 0.01% 48 1354 0.01% 49 1315 0.01% 50 1396 0.01% 51 1412 0.01% 52 1455 0.01% 53 1433 0.01% 54 1471 0.01% 55 1511 0.01% 56 1618 0.01% 57 1686 0.01% 58 1770 0.01% 59 1787 0.01% 60 2050 0.01% 61 2028 0.01% 62 2029 0.01% 63 2163 0.01% 64 2117 0.01% 65 2172 0.01% 66 2154 0.01% 67 2189 0.01% 68 2319 0.02% 69 2530 0.02% 70 2498 0.02% 71 2660 0.02% 72 2914 0.02% 73 2799 0.02% 74 2734 0.02% 75 2893 0.02% 76 2978 0.02% 77 3268 0.02% 78 3479 0.02% 79 3981 0.03% 80 3989 0.03% 81 4759 0.03% 82 4944 0.03% 83 5439 0.04% 84 5978 0.04% 85 6218 0.04% 86 6739 0.05% 87 7379 0.05% 88 8174 0.06% 89 9256 0.06% 90 10201 0.07% 91 11460 0.08% 92 12906 0.09% 93 14598 0.10% 94 16346 0.11% 95 17980 0.12% 96 19321 0.13% 97 20791 0.14% 98 22907 0.15% 99 25320 0.17% 100 29119 0.20% 101 32943 0.22% 102 36956 0.25% 103 41265 0.28% 104 44132 0.30% 105 47162 0.32% 106 49496 0.33% 107 52397 0.35% 108 55945 0.38% 109 60227 0.41% 110 65677 0.44% 111 72416 0.49% 112 79840 0.54% 113 86670 0.59% 114 92859 0.63% 115 98741 0.67% 116 102811 0.70% 117 106929 0.72% 118 113140 0.77% 119 124978 0.85% 120 153978 1.04% 121 222432 1.50% 122 461439 3.12% 123 152339 1.03% 124 756877 5.12% 125 11240775 76.05% criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=42 prefix-density=0.06 prefix-fanout=2.0 sequence=CAGTTGGGCACC criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=334.06 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=29.7 sequence=TTCTTCTTCTTC Started job on | Feb 12 01:56:47 Started mapping on | Feb 12 01:56:47 Finished on | Feb 12 01:57:24 Mapping speed, Million of reads per hour | 2400.28 Number of input reads | 24669533 Average input read length | 122 UNIQUE READS: Uniquely mapped reads number | 22880817 Uniquely mapped reads % | 92.75% Average mapped length | 122.37 Number of splices: Total | 8687548 Number of splices: Annotated (sjdb) | 8512084 Number of splices: GT/AG | 8551560 Number of splices: GC/AG | 111387 Number of splices: AT/AC | 8740 Number of splices: Non-canonical | 15861 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.16 Insertion rate per base | 0.02% Insertion average length | 1.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 567473 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 518284 % of reads mapped to too many loci | 2.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.84% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1221243 1221243 1221243 N_multimapping 567473 567473 567473 N_noFeature 1012587 11867183 11872593 N_ambiguous 237553 41708 42641 UnstrandedReadsAssigned:21630677 PositiveStrandReadsAssigned:10971926 NegativeStrandReadsAssigned:10965583 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208022 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208022-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,669,533 reads, 22,507,669 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,269 rounds 52401 SRR3208022.ke.tsv 34699 SRR3208022.se.tsv 87100 total ==> SRR3208022.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 678 22.422 Potri.005G024800.1.v4.1 1035 936 134 9.08548 Potri.004G059700.1.v4.1 961 862 19 1.39883 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 339.28 7.57091 Potri.016G087400.1.v4.1 270 171 959 355.911 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 93.5465 3.54643 Potri.012G127500.1.v4.1 977 878 5720 413.448 ==> SRR3208022.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2587 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 438 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 37 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3208022 completed mapping pipeline successfully