Starting /dee2/code/volunteer_pipeline.sh SRR3208023 current disk space = 3050898837504 free memory = 1406822648 SRR3208023 SRAfilesize 1dfd13e67b9ecf69e31a0d2a0b086d27 SRR3208023.sra SRR3208023.sra file validated SRR3208023 is single end SRR3208023 is conventional basespace SRR3208023 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208023_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.32375 33.0 33.0 33.0 33.0 33.0 2 32.00775 33.0 33.0 33.0 33.0 33.0 3 31.975 33.0 33.0 33.0 33.0 33.0 4 32.203 33.0 33.0 33.0 33.0 33.0 5 32.33275 33.0 33.0 33.0 33.0 33.0 6 36.0755 37.0 37.0 37.0 37.0 37.0 7 36.2855 37.0 37.0 37.0 37.0 37.0 8 36.3335 37.0 37.0 37.0 37.0 37.0 9 36.27175 37.0 37.0 37.0 37.0 37.0 10-11 36.251875 37.0 37.0 37.0 37.0 37.0 12-13 36.2625 37.0 37.0 37.0 37.0 37.0 14-15 36.156875 37.0 37.0 37.0 37.0 37.0 16-17 36.281375 37.0 37.0 37.0 37.0 37.0 18-19 36.294 37.0 37.0 37.0 37.0 37.0 20-21 36.2585 37.0 37.0 37.0 37.0 37.0 22-23 36.307375 37.0 37.0 37.0 37.0 37.0 24-25 36.2255 37.0 37.0 37.0 37.0 37.0 26-27 35.92425 37.0 37.0 37.0 37.0 37.0 28-29 36.14025 37.0 37.0 37.0 37.0 37.0 30-31 36.21625 37.0 37.0 37.0 37.0 37.0 32-33 36.223 37.0 37.0 37.0 37.0 37.0 34-35 36.269000000000005 37.0 37.0 37.0 37.0 37.0 36-37 36.197874999999996 37.0 37.0 37.0 37.0 37.0 38-39 36.147000000000006 37.0 37.0 37.0 37.0 37.0 40-41 36.218875 37.0 37.0 37.0 37.0 37.0 42-43 36.154875000000004 37.0 37.0 37.0 37.0 37.0 44-45 36.13875 37.0 37.0 37.0 37.0 37.0 46-47 36.141999999999996 37.0 37.0 37.0 37.0 37.0 48-49 36.1665 37.0 37.0 37.0 37.0 37.0 50-51 36.257374999999996 37.0 37.0 37.0 37.0 37.0 52-53 36.145125 37.0 37.0 37.0 37.0 37.0 54-55 36.1355 37.0 37.0 37.0 37.0 37.0 56-57 36.19025 37.0 37.0 37.0 37.0 37.0 58-59 36.1425 37.0 37.0 37.0 37.0 37.0 60-61 36.1685 37.0 37.0 37.0 37.0 37.0 62-63 36.213625 37.0 37.0 37.0 37.0 37.0 64-65 36.182375 37.0 37.0 37.0 37.0 37.0 66-67 36.184875000000005 37.0 37.0 37.0 37.0 37.0 68-69 36.142125 37.0 37.0 37.0 37.0 37.0 70-71 36.178875000000005 37.0 37.0 37.0 37.0 37.0 72-73 36.0895 37.0 37.0 37.0 37.0 37.0 74-75 36.05725 37.0 37.0 37.0 37.0 37.0 76-77 36.0685 37.0 37.0 37.0 37.0 37.0 78-79 36.037375 37.0 37.0 37.0 37.0 37.0 80-81 36.039625 37.0 37.0 37.0 37.0 37.0 82-83 36.065125 37.0 37.0 37.0 37.0 37.0 84-85 35.994749999999996 37.0 37.0 37.0 37.0 37.0 86-87 36.007875 37.0 37.0 37.0 37.0 37.0 88-89 35.941 37.0 37.0 37.0 37.0 37.0 90-91 36.089375000000004 37.0 37.0 37.0 37.0 37.0 92-93 36.0555 37.0 37.0 37.0 37.0 37.0 94-95 35.946375 37.0 37.0 37.0 37.0 37.0 96-97 35.967 37.0 37.0 37.0 37.0 37.0 98-99 35.86475 37.0 37.0 37.0 37.0 37.0 100-101 35.933375 37.0 37.0 37.0 37.0 37.0 102-103 35.857 37.0 37.0 37.0 37.0 37.0 104-105 35.880375 37.0 37.0 37.0 37.0 37.0 106-107 35.81725 37.0 37.0 37.0 37.0 37.0 108-109 35.876999999999995 37.0 37.0 37.0 37.0 37.0 110-111 35.888374999999996 37.0 37.0 37.0 37.0 37.0 112-113 35.833 37.0 37.0 37.0 37.0 37.0 114-115 35.77075 37.0 37.0 37.0 37.0 37.0 116-117 35.675125 37.0 37.0 37.0 37.0 37.0 118-119 35.589625 37.0 37.0 37.0 37.0 37.0 120-121 35.526875000000004 37.0 37.0 37.0 35.0 37.0 122-123 35.469875 37.0 37.0 37.0 37.0 37.0 124-125 34.038375 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 2.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 3.0 10 1.0 11 0.0 12 1.0 13 2.0 14 1.0 15 0.0 16 1.0 17 0.0 18 3.0 19 3.0 20 5.0 21 2.0 22 4.0 23 1.0 24 5.0 25 2.0 26 14.0 27 18.0 28 18.0 29 25.0 30 38.0 31 45.0 32 66.0 33 90.0 34 136.0 35 268.0 36 3232.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.14782384754056 15.374710275560133 11.975276847798094 50.50218902910121 2 19.05 20.849999999999998 41.775 18.325 3 19.725 24.95 28.499999999999996 26.825 4 24.725 31.525 20.025000000000002 23.724999999999998 5 26.025 34.425 22.45 17.1 6 19.25 38.125 22.375 20.25 7 17.375 18.625 43.35 20.65 8 19.425 21.975 31.35 27.250000000000004 9 19.5 22.55 32.300000000000004 25.650000000000002 10-11 22.85 33.225 23.1 20.825 12-13 20.6875 26.5375 29.65 23.125 14-15 21.3875 27.212500000000002 28.6875 22.7125 16-17 22.425 27.175 28.237499999999997 22.162499999999998 18-19 21.575 28.812500000000004 26.987499999999997 22.625 20-21 21.8 27.1 28.175 22.925 22-23 22.025 27.700000000000003 27.737499999999997 22.537499999999998 24-25 20.8875 27.875 28.287499999999998 22.95 26-27 22.15 27.975 28.0625 21.8125 28-29 21.9375 28.125 27.500000000000004 22.4375 30-31 21.762500000000003 27.200000000000003 28.1125 22.925 32-33 22.1875 27.3375 27.700000000000003 22.775000000000002 34-35 22.0625 28.8375 26.787499999999998 22.3125 36-37 22.275 28.212500000000002 28.050000000000004 21.462500000000002 38-39 21.224999999999998 28.799999999999997 27.35 22.625 40-41 22.125 28.175 27.625 22.075 42-43 22.15 27.325 28.000000000000004 22.525000000000002 44-45 21.512500000000003 28.287499999999998 28.0625 22.1375 46-47 21.775 27.900000000000002 28.549999999999997 21.775 48-49 21.512500000000003 28.599999999999998 27.462500000000002 22.425 50-51 22.7125 27.8375 27.250000000000004 22.2 52-53 22.7 28.8375 26.575 21.8875 54-55 22.0625 28.1875 27.425 22.325 56-57 21.5 27.2625 28.749999999999996 22.4875 58-59 22.3625 27.6125 27.875 22.15 60-61 21.4125 28.175 27.8375 22.575 62-63 21.8875 27.950000000000003 27.1625 23.0 64-65 21.475 27.925 28.0625 22.537499999999998 66-67 22.112499999999997 27.775 27.8625 22.25 68-69 22.2125 28.475 27.487499999999997 21.825 70-71 21.9375 26.974999999999998 28.3375 22.75 72-73 21.712500000000002 28.0875 28.075 22.125 74-75 22.0 28.8375 27.037499999999998 22.125 76-77 22.0625 27.6375 28.1875 22.112499999999997 78-79 22.662499999999998 28.050000000000004 27.125 22.162499999999998 80-81 21.5375 28.8875 27.762500000000003 21.8125 82-83 22.0875 27.962500000000002 27.6125 22.3375 84-85 23.2875 27.8625 27.987499999999997 20.8625 86-87 21.9 28.1125 27.975 22.0125 88-89 22.025 28.325 27.474999999999998 22.175 90-91 21.15 27.787499999999998 28.8625 22.2 92-93 22.725 28.1875 26.987499999999997 22.1 94-95 21.975 27.800000000000004 28.0875 22.1375 96-97 22.112499999999997 27.6125 27.625 22.650000000000002 98-99 22.400000000000002 28.249999999999996 27.537499999999998 21.8125 100-101 21.5375 27.8375 28.6625 21.9625 102-103 23.3875 27.462500000000002 28.037499999999998 21.1125 104-105 22.95 27.975 27.125 21.95 106-107 22.662499999999998 27.6 27.762500000000003 21.975 108-109 22.025 28.349999999999998 28.0625 21.5625 110-111 22.7375 28.262500000000003 26.724999999999998 22.275 112-113 22.825 29.4375 26.650000000000002 21.087500000000002 114-115 23.674999999999997 28.525 26.325 21.475 116-117 23.125 28.7375 26.400000000000002 21.7375 118-119 23.025000000000002 28.499999999999996 26.825 21.65 120-121 23.925 28.537499999999998 26.187500000000004 21.349999999999998 122-123 23.0875 29.099999999999998 25.5375 22.275 124-125 22.825 29.5375 26.0375 21.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.0 23 0.5 24 1.5 25 5.0 26 7.5 27 8.5 28 11.0 29 14.0 30 14.5 31 25.5 32 40.0 33 53.5 34 65.5 35 79.5 36 101.5 37 121.5 38 147.0 39 166.5 40 167.0 41 187.5 42 227.5 43 249.0 44 257.5 45 256.0 46 245.0 47 241.5 48 227.0 49 188.0 50 153.5 51 134.5 52 120.0 53 97.5 54 72.5 55 52.0 56 45.5 57 37.0 58 23.5 59 18.5 60 17.5 61 18.0 62 17.5 63 16.0 64 10.5 65 6.5 66 6.5 67 7.0 68 5.0 69 3.0 70 3.0 71 1.5 72 4.5 73 7.0 74 3.5 75 2.0 76 2.0 77 1.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9250000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.0625 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1125 0.0 0.0 0.0 0.0 54-55 0.1375 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.7125 0.0 0.0 0.0 0.0 106-107 2.2625 0.0 0.0 0.0 0.0 108-109 2.675 0.0 0.0 0.0 0.0 110-111 3.2625 0.0 0.0 0.0 0.0 112-113 4.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACACGTC 15 0.0040897233 59.481247 118-119 GCACACG 15 0.0040897233 59.481247 116-117 >>END_MODULE Read 1125841 spots for SRR3208023.sra Written 1125841 spots for SRR3208023.sra Read 1125841 spots for SRR3208023.sra Written 1125841 spots for SRR3208023.sra Read 1125841 spots for SRR3208023.sra Written 1125841 spots for SRR3208023.sra Read 1125841 spots for SRR3208023.sra Written 1125841 spots for SRR3208023.sra Read 1125841 spots for SRR3208023.sra Written 1125841 spots for SRR3208023.sra Read 1125841 spots for SRR3208023.sra Written 1125841 spots for SRR3208023.sra Read 1125841 spots for SRR3208023.sra Written 1125841 spots for SRR3208023.sra Read 1125841 spots for SRR3208023.sra Written 1125841 spots for SRR3208023.sra Read 1125841 spots for SRR3208023.sra Written 1125841 spots for SRR3208023.sra Read 1125841 spots for SRR3208023.sra Written 1125841 spots for SRR3208023.sra Read 1125841 spots for SRR3208023.sra Written 1125841 spots for SRR3208023.sra Read 1125841 spots for SRR3208023.sra Written 1125841 spots for SRR3208023.sra Read 1125841 spots for SRR3208023.sra Written 1125841 spots for SRR3208023.sra Read 1125841 spots for SRR3208023.sra Written 1125841 spots for SRR3208023.sra Read 1125841 spots for SRR3208023.sra Written 1125841 spots for SRR3208023.sra Read 1125841 spots for SRR3208023.sra Written 1125841 spots for SRR3208023.sra Read 1125852 spots for SRR3208023.sra Written 1125852 spots for SRR3208023.sra Read 1125841 spots for SRR3208023.sra Written 1125841 spots for SRR3208023.sra Read 1125841 spots for SRR3208023.sra Written 1125841 spots for SRR3208023.sra Read 1125841 spots for SRR3208023.sra Written 1125841 spots for SRR3208023.sra SRR ids: ['SRR3208023.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k5l9v4h3 SRR3208023.sra spots: 22516831 blocks: [[1, 1125841], [1125842, 2251682], [2251683, 3377523], [3377524, 4503364], [4503365, 5629205], [5629206, 6755046], [6755047, 7880887], [7880888, 9006728], [9006729, 10132569], [10132570, 11258410], [11258411, 12384251], [12384252, 13510092], [13510093, 14635933], [14635934, 15761774], [15761775, 16887615], [16887616, 18013456], [18013457, 19139297], [19139298, 20265138], [20265139, 21390979], [21390980, 22516831]] SRR3208023 file size 7212573 SRR3208023 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208023 SRR3208023_1.fastq Input file: SRR3208023_1.fastq trimmed: SRR3208023-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 01:52:35 2025 >> started Wed Feb 12 01:52:47 2025 >> done (11.739s) 22516831 reads processed; of these: 14820 ( 0.07%) short reads filtered out after trimming by size control 55277 ( 0.25%) empty reads filtered out after trimming by size control 22446734 (99.69%) reads available; of these: 2429014 (10.82%) trimmed reads available after processing 20017720 (89.18%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 636 0.00% 19 620 0.00% 20 675 0.00% 21 751 0.00% 22 872 0.00% 23 914 0.00% 24 1069 0.00% 25 1225 0.01% 26 1192 0.01% 27 1108 0.00% 28 1218 0.01% 29 1304 0.01% 30 1619 0.01% 31 1423 0.01% 32 1121 0.00% 33 1054 0.00% 34 1114 0.00% 35 1093 0.00% 36 1132 0.01% 37 1191 0.01% 38 1052 0.00% 39 1170 0.01% 40 1212 0.01% 41 1229 0.01% 42 1157 0.01% 43 1225 0.01% 44 1246 0.01% 45 1228 0.01% 46 1347 0.01% 47 1349 0.01% 48 1269 0.01% 49 1405 0.01% 50 1333 0.01% 51 1463 0.01% 52 1395 0.01% 53 1405 0.01% 54 1484 0.01% 55 1534 0.01% 56 1540 0.01% 57 1647 0.01% 58 1652 0.01% 59 1749 0.01% 60 1827 0.01% 61 1841 0.01% 62 1962 0.01% 63 1947 0.01% 64 2036 0.01% 65 1919 0.01% 66 2071 0.01% 67 2056 0.01% 68 2194 0.01% 69 2418 0.01% 70 2388 0.01% 71 2648 0.01% 72 2732 0.01% 73 2892 0.01% 74 2921 0.01% 75 3061 0.01% 76 3138 0.01% 77 3387 0.02% 78 3753 0.02% 79 4031 0.02% 80 4439 0.02% 81 4774 0.02% 82 5535 0.02% 83 5923 0.03% 84 6250 0.03% 85 6916 0.03% 86 7408 0.03% 87 8254 0.04% 88 9070 0.04% 89 10341 0.05% 90 11888 0.05% 91 13583 0.06% 92 15658 0.07% 93 17388 0.08% 94 3167 0.01% 95 3259 0.01% 96 3544 0.02% 97 3620 0.02% 98 4060 0.02% 99 4245 0.02% 100 4631 0.02% 101 5247 0.02% 102 5497 0.02% 103 5841 0.03% 104 5247 0.02% 105 5840 0.03% 106 6054 0.03% 107 6645 0.03% 108 7438 0.03% 109 8022 0.04% 110 8926 0.04% 111 10200 0.05% 112 11536 0.05% 113 13411 0.06% 114 15396 0.07% 115 17650 0.08% 116 20709 0.09% 117 25371 0.11% 118 31890 0.14% 119 41586 0.19% 120 55837 0.25% 121 77651 0.35% 122 128906 0.57% 123 280786 1.25% 124 1376731 6.13% 125 20017720 89.18% 22446734 reads passed initial QC criterion=sequence-density sequence-density=3.87 sequence-density-rank=1 fanout-score=47.35 fanout-score-rank=1 prefix-density=5.33 prefix-fanout=34.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=fanout-score sequence-density=3.87 sequence-density-rank=1 fanout-score=47.35 fanout-score-rank=1 prefix-density=5.33 prefix-fanout=34.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGAAAA -o SRR3208023 - Input file: STDIN trimmed: SRR3208023-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 01:53:54 2025 >> started Wed Feb 12 01:54:06 2025 >> done (11.839s) 11223367 reads processed; of these: 145 ( 0.00%) short reads filtered out after trimming by size control 351 ( 0.00%) empty reads filtered out after trimming by size control 11222871 (100.00%) reads available; of these: 1397831 (12.46%) trimmed reads available after processing 9825040 (87.54%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 323 0.00% 19 333 0.00% 20 343 0.00% 21 385 0.00% 22 448 0.00% 23 475 0.00% 24 552 0.00% 25 639 0.01% 26 616 0.01% 27 536 0.00% 28 583 0.01% 29 659 0.01% 30 831 0.01% 31 701 0.01% 32 578 0.01% 33 527 0.00% 34 549 0.00% 35 568 0.01% 36 575 0.01% 37 601 0.01% 38 520 0.00% 39 596 0.01% 40 627 0.01% 41 622 0.01% 42 605 0.01% 43 575 0.01% 44 616 0.01% 45 612 0.01% 46 684 0.01% 47 665 0.01% 48 628 0.01% 49 674 0.01% 50 671 0.01% 51 765 0.01% 52 720 0.01% 53 716 0.01% 54 735 0.01% 55 741 0.01% 56 794 0.01% 57 823 0.01% 58 836 0.01% 59 854 0.01% 60 935 0.01% 61 944 0.01% 62 964 0.01% 63 929 0.01% 64 1046 0.01% 65 916 0.01% 66 1010 0.01% 67 1028 0.01% 68 1107 0.01% 69 1248 0.01% 70 1199 0.01% 71 1316 0.01% 72 1378 0.01% 73 1407 0.01% 74 1380 0.01% 75 1500 0.01% 76 1585 0.01% 77 1723 0.02% 78 1866 0.02% 79 2016 0.02% 80 2275 0.02% 81 2388 0.02% 82 2794 0.02% 83 2968 0.03% 84 3168 0.03% 85 3506 0.03% 86 3738 0.03% 87 4186 0.04% 88 4492 0.04% 89 5243 0.05% 90 6062 0.05% 91 6789 0.06% 92 7744 0.07% 93 8732 0.08% 94 9719 0.09% 95 10846 0.10% 96 11582 0.10% 97 12911 0.12% 98 14167 0.13% 99 16020 0.14% 100 18339 0.16% 101 21017 0.19% 102 23738 0.21% 103 26351 0.23% 104 28533 0.25% 105 30999 0.28% 106 32340 0.29% 107 35127 0.31% 108 37160 0.33% 109 40161 0.36% 110 44168 0.39% 111 49333 0.44% 112 54770 0.49% 113 59256 0.53% 114 64482 0.57% 115 68280 0.61% 116 72101 0.64% 117 75142 0.67% 118 80185 0.71% 119 89898 0.80% 120 111907 1.00% 121 163614 1.46% 122 346205 3.08% 123 127400 1.14% 124 621504 5.54% 125 8710133 77.61% criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.57 fanout-score-rank=25 prefix-density=0.18 prefix-fanout=2.7 sequence=TTCAACCAAGCGCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=391.43 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=16.0 sequence=CAGCAGCAAGACAAACCGAATTATTCATAAGTACCAATAAAATAAGCATTGCGCAAAAGGGATAGGATAAATCACTCTTAAGCTTGAGGCTTCTCCCATTTGAGGGGCTTGACAACTTCCCAGGTGAAGTCTGGGTCATCCCTTCCAAAATGTCCGTATGCAGCTGTCTTCAAGAACCTATTACCCCCCCTCTTGAGATCCAGGTTGATGGTCATCATTCCAGGCCTAAAGTCAAAGCTCTCCTTCACAATCTTAAGGATCTCCTTGTCAGGAATTTTTCCAGTGCCATAGGTGTCCACAAAGACTGACAAAGGCTCAGGTACACCAATAGCATAGGAAACTTGCACAATGCACCTACGAGCAAGACCATTTGCTACGATGCTCTTGGCAGCTT Started job on | Feb 12 01:54:37 Started mapping on | Feb 12 01:54:37 Finished on | Feb 12 01:55:07 Mapping speed, Million of reads per hour | 2693.55 Number of input reads | 22446238 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 20256963 Uniquely mapped reads % | 90.25% Average mapped length | 122.74 Number of splices: Total | 7557588 Number of splices: Annotated (sjdb) | 7405730 Number of splices: GT/AG | 7439860 Number of splices: GC/AG | 95901 Number of splices: AT/AC | 7665 Number of splices: Non-canonical | 14162 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.16 Insertion rate per base | 0.02% Insertion average length | 1.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 478110 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 1438647 % of reads mapped to too many loci | 6.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.20% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1711165 1711165 1711165 N_multimapping 478110 478110 478110 N_noFeature 908887 10506341 10515547 N_ambiguous 218266 37135 37612 UnstrandedReadsAssigned:19129810 PositiveStrandReadsAssigned:9713487 NegativeStrandReadsAssigned:9703804 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208023 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208023-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,446,238 reads, 20,819,112 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52401 SRR3208023.ke.tsv 34699 SRR3208023.se.tsv 87100 total ==> SRR3208023.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 595 20.6142 Potri.005G024800.1.v4.1 1035 936 142 10.0864 Potri.004G059700.1.v4.1 961 862 20 1.54258 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 294.286 6.87962 Potri.016G087400.1.v4.1 270 171 819 318.429 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 84 3.33617 Potri.012G127500.1.v4.1 977 878 4555 344.92 ==> SRR3208023.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2094 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 466 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 43 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR3208023 completed mapping pipeline successfully