Starting /dee2/code/volunteer_pipeline.sh SRR3208024 current disk space = 3050861981696 free memory = 1467277664 SRR3208024 SRAfilesize 7e63c928b5df7b792a8fde61e2f4fa3b SRR3208024.sra SRR3208024.sra file validated SRR3208024 is single end SRR3208024 is conventional basespace SRR3208024 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208024_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.127 33.0 33.0 33.0 33.0 33.0 2 32.03 33.0 33.0 33.0 33.0 33.0 3 32.06025 33.0 33.0 33.0 33.0 33.0 4 32.246 33.0 33.0 33.0 33.0 33.0 5 32.3745 33.0 33.0 33.0 33.0 33.0 6 36.01275 37.0 37.0 37.0 37.0 37.0 7 36.21175 37.0 37.0 37.0 37.0 37.0 8 36.2065 37.0 37.0 37.0 37.0 37.0 9 36.2375 37.0 37.0 37.0 37.0 37.0 10-11 36.20125 37.0 37.0 37.0 37.0 37.0 12-13 36.3065 37.0 37.0 37.0 37.0 37.0 14-15 36.25125 37.0 37.0 37.0 37.0 37.0 16-17 36.177625 37.0 37.0 37.0 37.0 37.0 18-19 36.32175 37.0 37.0 37.0 37.0 37.0 20-21 36.229375 37.0 37.0 37.0 37.0 37.0 22-23 36.283625 37.0 37.0 37.0 37.0 37.0 24-25 36.211 37.0 37.0 37.0 37.0 37.0 26-27 36.0315 37.0 37.0 37.0 37.0 37.0 28-29 36.201125000000005 37.0 37.0 37.0 37.0 37.0 30-31 36.129625000000004 37.0 37.0 37.0 37.0 37.0 32-33 36.235749999999996 37.0 37.0 37.0 37.0 37.0 34-35 36.245125 37.0 37.0 37.0 37.0 37.0 36-37 36.213625 37.0 37.0 37.0 37.0 37.0 38-39 36.216375 37.0 37.0 37.0 37.0 37.0 40-41 36.2745 37.0 37.0 37.0 37.0 37.0 42-43 36.285125 37.0 37.0 37.0 37.0 37.0 44-45 36.25275 37.0 37.0 37.0 37.0 37.0 46-47 36.270375 37.0 37.0 37.0 37.0 37.0 48-49 36.282624999999996 37.0 37.0 37.0 37.0 37.0 50-51 36.317125 37.0 37.0 37.0 37.0 37.0 52-53 36.207499999999996 37.0 37.0 37.0 37.0 37.0 54-55 36.28125 37.0 37.0 37.0 37.0 37.0 56-57 36.27625 37.0 37.0 37.0 37.0 37.0 58-59 36.23950000000001 37.0 37.0 37.0 37.0 37.0 60-61 36.313625 37.0 37.0 37.0 37.0 37.0 62-63 36.267624999999995 37.0 37.0 37.0 37.0 37.0 64-65 36.172625 37.0 37.0 37.0 37.0 37.0 66-67 36.148624999999996 37.0 37.0 37.0 37.0 37.0 68-69 36.204625 37.0 37.0 37.0 37.0 37.0 70-71 36.239125 37.0 37.0 37.0 37.0 37.0 72-73 36.228875 37.0 37.0 37.0 37.0 37.0 74-75 36.148250000000004 37.0 37.0 37.0 37.0 37.0 76-77 36.17675 37.0 37.0 37.0 37.0 37.0 78-79 36.1355 37.0 37.0 37.0 37.0 37.0 80-81 36.056250000000006 37.0 37.0 37.0 37.0 37.0 82-83 36.116125 37.0 37.0 37.0 37.0 37.0 84-85 36.110749999999996 37.0 37.0 37.0 37.0 37.0 86-87 36.116125 37.0 37.0 37.0 37.0 37.0 88-89 36.113625 37.0 37.0 37.0 37.0 37.0 90-91 36.073750000000004 37.0 37.0 37.0 37.0 37.0 92-93 36.075375 37.0 37.0 37.0 37.0 37.0 94-95 36.03725 37.0 37.0 37.0 37.0 37.0 96-97 36.063625 37.0 37.0 37.0 37.0 37.0 98-99 36.004125 37.0 37.0 37.0 37.0 37.0 100-101 36.012 37.0 37.0 37.0 37.0 37.0 102-103 35.90175 37.0 37.0 37.0 37.0 37.0 104-105 35.962374999999994 37.0 37.0 37.0 37.0 37.0 106-107 35.961749999999995 37.0 37.0 37.0 37.0 37.0 108-109 35.9225 37.0 37.0 37.0 37.0 37.0 110-111 35.841875 37.0 37.0 37.0 37.0 37.0 112-113 35.821875000000006 37.0 37.0 37.0 37.0 37.0 114-115 35.747749999999996 37.0 37.0 37.0 37.0 37.0 116-117 35.693375 37.0 37.0 37.0 37.0 37.0 118-119 35.68375 37.0 37.0 37.0 37.0 37.0 120-121 35.596125 37.0 37.0 37.0 37.0 37.0 122-123 35.505875 37.0 37.0 37.0 37.0 37.0 124-125 34.145875000000004 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 1.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 1.0 13 1.0 14 1.0 15 1.0 16 1.0 17 1.0 18 0.0 19 0.0 20 1.0 21 2.0 22 6.0 23 4.0 24 3.0 25 6.0 26 5.0 27 12.0 28 27.0 29 16.0 30 35.0 31 49.0 32 63.0 33 73.0 34 144.0 35 275.0 36 3252.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.86380113930606 14.70740548938374 13.102019678922838 49.32677369238736 2 19.175 21.475 40.949999999999996 18.4 3 21.5 24.05 27.6 26.85 4 24.15 32.225 20.575 23.05 5 25.6 33.1 22.975 18.325 6 19.5 36.8 23.799999999999997 19.900000000000002 7 16.650000000000002 19.2 43.075 21.075 8 18.725 22.975 31.4 26.900000000000002 9 20.1 22.925 32.875 24.099999999999998 10-11 22.45 32.9375 23.674999999999997 20.9375 12-13 20.474999999999998 27.0125 29.3375 23.175 14-15 20.6375 28.349999999999998 28.549999999999997 22.4625 16-17 21.375 27.8125 27.987499999999997 22.825 18-19 21.837500000000002 28.1125 27.2625 22.787499999999998 20-21 21.0375 28.825 27.875 22.2625 22-23 22.625 27.6625 27.6625 22.05 24-25 22.275 28.1875 27.8125 21.725 26-27 20.325 29.1625 28.349999999999998 22.162499999999998 28-29 22.2 28.3875 27.35 22.0625 30-31 21.8125 28.7 27.3375 22.15 32-33 21.675 28.037499999999998 27.200000000000003 23.0875 34-35 21.625 28.262500000000003 27.675 22.4375 36-37 21.3875 27.9125 27.900000000000002 22.8 38-39 22.325 27.875 27.2625 22.537499999999998 40-41 22.1 28.762500000000003 27.462500000000002 21.675 42-43 21.762500000000003 27.750000000000004 27.950000000000003 22.537499999999998 44-45 22.0 27.8875 27.6875 22.425 46-47 22.0125 28.6625 27.8875 21.4375 48-49 21.087500000000002 28.1375 27.250000000000004 23.525 50-51 21.3875 28.6875 27.5625 22.3625 52-53 22.2 28.9375 27.5125 21.349999999999998 54-55 21.925 27.474999999999998 28.3125 22.287499999999998 56-57 21.6 27.6625 27.900000000000002 22.8375 58-59 22.2 28.487499999999997 27.500000000000004 21.8125 60-61 21.5375 28.212500000000002 27.500000000000004 22.75 62-63 21.725 27.287499999999998 28.749999999999996 22.237499999999997 64-65 22.015251906488313 27.490936367045883 28.55356919614952 21.94024253031629 66-67 22.787499999999998 27.6125 28.125 21.475 68-69 22.852856607075882 28.66608326040755 27.340917614701837 21.140142517814727 70-71 21.1125 29.2375 27.8875 21.762500000000003 72-73 21.4375 27.8875 28.249999999999996 22.425 74-75 21.4375 28.749999999999996 28.499999999999996 21.3125 76-77 22.412499999999998 28.4125 27.525 21.65 78-79 21.50537634408602 28.59464866216554 27.106776694173547 22.793198299574893 80-81 22.59879939969985 29.264632316158078 27.063531765882942 21.07303651825913 82-83 23.055763940985248 29.044761190297574 27.019254813703427 20.880220055013755 84-85 22.115264408051004 28.19102387798475 27.55344418052256 22.14026753344168 86-87 21.6 28.787499999999998 27.537499999999998 22.075 88-89 23.200000000000003 28.325 27.474999999999998 21.0 90-91 21.75 28.1 27.962500000000002 22.1875 92-93 22.625 28.212500000000002 26.6625 22.5 94-95 22.05 28.6125 26.974999999999998 22.3625 96-97 22.225 28.199999999999996 27.487499999999997 22.0875 98-99 22.325 28.599999999999998 27.55 21.525 100-101 22.2 28.549999999999997 26.887499999999996 22.3625 102-103 22.925 27.9375 27.375 21.762500000000003 104-105 22.2 28.075 28.325 21.4 106-107 21.575 29.025000000000002 27.825 21.575 108-109 21.9375 28.15 27.1 22.8125 110-111 22.975 28.5625 26.687499999999996 21.775 112-113 22.6875 28.6875 27.425 21.2 114-115 22.4625 28.775000000000002 26.737499999999997 22.025 116-117 22.400000000000002 28.1375 27.237499999999997 22.225 118-119 22.6875 28.849999999999998 26.7125 21.75 120-121 22.925 28.549999999999997 26.525 22.0 122-123 22.8875 28.712500000000002 26.650000000000002 21.75 124-125 23.325000000000003 28.249999999999996 25.662499999999998 22.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.5 25 2.5 26 5.0 27 5.0 28 6.0 29 13.5 30 22.5 31 28.0 32 37.0 33 51.0 34 63.0 35 65.5 36 80.0 37 118.5 38 152.5 39 163.0 40 174.5 41 199.0 42 240.5 43 269.5 44 272.0 45 284.0 46 278.5 47 242.0 48 229.5 49 205.5 50 153.0 51 133.5 52 120.0 53 90.0 54 60.0 55 46.5 56 40.0 57 32.5 58 21.0 59 12.0 60 8.0 61 7.5 62 12.5 63 10.0 64 3.0 65 3.0 66 5.0 67 5.5 68 4.5 69 3.5 70 2.0 71 2.5 72 3.5 73 2.0 74 1.0 75 1.0 76 1.5 77 1.5 78 1.5 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.45 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0125 66-67 0.0 68-69 0.0125 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.025 80-81 0.05 82-83 0.025 84-85 0.0125 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.0875 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.1375 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.38749999999999996 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.9124999999999999 0.0 0.0 0.0 0.0 108-109 2.4875 0.0 0.0 0.0 0.0 110-111 2.925 0.0 0.0 0.0 0.0 112-113 3.8249999999999997 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1346043 spots for SRR3208024.sra Written 1346043 spots for SRR3208024.sra Read 1346043 spots for SRR3208024.sra Written 1346043 spots for SRR3208024.sra Read 1346043 spots for SRR3208024.sra Written 1346043 spots for SRR3208024.sra Read 1346043 spots for SRR3208024.sra Written 1346043 spots for SRR3208024.sra Read 1346043 spots for SRR3208024.sra Written 1346043 spots for SRR3208024.sra Read 1346043 spots for SRR3208024.sra Written 1346043 spots for SRR3208024.sra Read 1346043 spots for SRR3208024.sra Written 1346043 spots for SRR3208024.sra Read 1346043 spots for SRR3208024.sra Written 1346043 spots for SRR3208024.sra Read 1346043 spots for SRR3208024.sra Written 1346043 spots for SRR3208024.sra Read 1346043 spots for SRR3208024.sra Written 1346043 spots for SRR3208024.sra Read 1346043 spots for SRR3208024.sra Written 1346043 spots for SRR3208024.sra Read 1346043 spots for SRR3208024.sra Written 1346043 spots for SRR3208024.sra Read 1346043 spots for SRR3208024.sra Written 1346043 spots for SRR3208024.sra Read 1346043 spots for SRR3208024.sra Written 1346043 spots for SRR3208024.sra Read 1346043 spots for SRR3208024.sra Written 1346043 spots for SRR3208024.sra Read 1346043 spots for SRR3208024.sra Written 1346043 spots for SRR3208024.sra Read 1346043 spots for SRR3208024.sra Written 1346043 spots for SRR3208024.sra Read 1346043 spots for SRR3208024.sra Written 1346043 spots for SRR3208024.sra Read 1346057 spots for SRR3208024.sra Written 1346057 spots for SRR3208024.sra Read 1346043 spots for SRR3208024.sra Written 1346043 spots for SRR3208024.sra SRR ids: ['SRR3208024.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vgfy7h0r SRR3208024.sra spots: 26920874 blocks: [[1, 1346043], [1346044, 2692086], [2692087, 4038129], [4038130, 5384172], [5384173, 6730215], [6730216, 8076258], [8076259, 9422301], [9422302, 10768344], [10768345, 12114387], [12114388, 13460430], [13460431, 14806473], [14806474, 16152516], [16152517, 17498559], [17498560, 18844602], [18844603, 20190645], [20190646, 21536688], [21536689, 22882731], [22882732, 24228774], [24228775, 25574817], [25574818, 26920874]] SRR3208024 file size 8625395 SRR3208024 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208024 SRR3208024_1.fastq Input file: SRR3208024_1.fastq trimmed: SRR3208024-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 01:35:46 2025 >> started Wed Feb 12 01:36:01 2025 >> done (15.048s) 26920874 reads processed; of these: 20622 ( 0.08%) short reads filtered out after trimming by size control 81988 ( 0.30%) empty reads filtered out after trimming by size control 26818264 (99.62%) reads available; of these: 2947524 (10.99%) trimmed reads available after processing 23870740 (89.01%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 736 0.00% 19 804 0.00% 20 850 0.00% 21 869 0.00% 22 1008 0.00% 23 1150 0.00% 24 1328 0.00% 25 1538 0.01% 26 1590 0.01% 27 1426 0.01% 28 1435 0.01% 29 1598 0.01% 30 2352 0.01% 31 2199 0.01% 32 1430 0.01% 33 1277 0.00% 34 1288 0.00% 35 1296 0.00% 36 1359 0.01% 37 1393 0.01% 38 1404 0.01% 39 1305 0.00% 40 1421 0.01% 41 1401 0.01% 42 1372 0.01% 43 1484 0.01% 44 1456 0.01% 45 1461 0.01% 46 1525 0.01% 47 1493 0.01% 48 1532 0.01% 49 1633 0.01% 50 1533 0.01% 51 1706 0.01% 52 1698 0.01% 53 1662 0.01% 54 1774 0.01% 55 1797 0.01% 56 1879 0.01% 57 1912 0.01% 58 1969 0.01% 59 1976 0.01% 60 2216 0.01% 61 2126 0.01% 62 2304 0.01% 63 2264 0.01% 64 2334 0.01% 65 2320 0.01% 66 2349 0.01% 67 2406 0.01% 68 2617 0.01% 69 2628 0.01% 70 2796 0.01% 71 3017 0.01% 72 3137 0.01% 73 3398 0.01% 74 3450 0.01% 75 3482 0.01% 76 3579 0.01% 77 3879 0.01% 78 4092 0.02% 79 4542 0.02% 80 5007 0.02% 81 5439 0.02% 82 6004 0.02% 83 6756 0.03% 84 7323 0.03% 85 7834 0.03% 86 8327 0.03% 87 9068 0.03% 88 10125 0.04% 89 11536 0.04% 90 13186 0.05% 91 15606 0.06% 92 17671 0.07% 93 19941 0.07% 94 3953 0.01% 95 4110 0.02% 96 4316 0.02% 97 4608 0.02% 98 4921 0.02% 99 5241 0.02% 100 5746 0.02% 101 6446 0.02% 102 6771 0.03% 103 7103 0.03% 104 6660 0.02% 105 7257 0.03% 106 7701 0.03% 107 8360 0.03% 108 9337 0.03% 109 10071 0.04% 110 11125 0.04% 111 12547 0.05% 112 14146 0.05% 113 16268 0.06% 114 18747 0.07% 115 22045 0.08% 116 25626 0.10% 117 31013 0.12% 118 39749 0.15% 119 51159 0.19% 120 69371 0.26% 121 96758 0.36% 122 158611 0.59% 123 345801 1.29% 124 1666879 6.22% 125 23870740 89.01% 26818264 reads passed initial QC criterion=sequence-density sequence-density=3.66 sequence-density-rank=1 fanout-score=52.39 fanout-score-rank=1 prefix-density=5.09 prefix-fanout=37.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC criterion=fanout-score sequence-density=3.66 sequence-density-rank=1 fanout-score=52.39 fanout-score-rank=1 prefix-density=5.09 prefix-fanout=37.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC -o SRR3208024 - Input file: STDIN trimmed: SRR3208024-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 01:37:09 2025 >> started Wed Feb 12 01:37:24 2025 >> done (14.673s) 13409132 reads processed; of these: 111 ( 0.00%) short reads filtered out after trimming by size control 370 ( 0.00%) empty reads filtered out after trimming by size control 13408651 (100.00%) reads available; of these: 1623635 (12.11%) trimmed reads available after processing 11785016 (87.89%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 375 0.00% 19 423 0.00% 20 410 0.00% 21 437 0.00% 22 497 0.00% 23 570 0.00% 24 658 0.00% 25 824 0.01% 26 775 0.01% 27 711 0.01% 28 725 0.01% 29 836 0.01% 30 1141 0.01% 31 1113 0.01% 32 705 0.01% 33 605 0.00% 34 645 0.00% 35 625 0.00% 36 696 0.01% 37 672 0.01% 38 726 0.01% 39 653 0.00% 40 705 0.01% 41 686 0.01% 42 704 0.01% 43 760 0.01% 44 747 0.01% 45 759 0.01% 46 769 0.01% 47 775 0.01% 48 766 0.01% 49 842 0.01% 50 763 0.01% 51 869 0.01% 52 873 0.01% 53 847 0.01% 54 915 0.01% 55 884 0.01% 56 949 0.01% 57 945 0.01% 58 1007 0.01% 59 978 0.01% 60 1126 0.01% 61 1052 0.01% 62 1197 0.01% 63 1113 0.01% 64 1161 0.01% 65 1142 0.01% 66 1163 0.01% 67 1250 0.01% 68 1307 0.01% 69 1343 0.01% 70 1438 0.01% 71 1496 0.01% 72 1563 0.01% 73 1614 0.01% 74 1645 0.01% 75 1700 0.01% 76 1803 0.01% 77 2004 0.01% 78 2025 0.02% 79 2307 0.02% 80 2589 0.02% 81 2802 0.02% 82 2964 0.02% 83 3381 0.03% 84 3637 0.03% 85 3918 0.03% 86 4160 0.03% 87 4606 0.03% 88 5110 0.04% 89 5820 0.04% 90 6577 0.05% 91 7672 0.06% 92 8805 0.07% 93 10097 0.08% 94 11140 0.08% 95 12315 0.09% 96 13037 0.10% 97 14429 0.11% 98 16063 0.12% 99 18144 0.14% 100 20534 0.15% 101 23730 0.18% 102 27302 0.20% 103 30382 0.23% 104 33139 0.25% 105 35713 0.27% 106 37906 0.28% 107 39979 0.30% 108 42728 0.32% 109 46284 0.35% 110 51209 0.38% 111 56853 0.42% 112 63412 0.47% 113 69182 0.52% 114 75755 0.56% 115 81135 0.61% 116 84270 0.63% 117 88129 0.66% 118 94301 0.70% 119 104776 0.78% 120 132662 0.99% 121 196845 1.47% 122 411566 3.07% 123 156174 1.16% 124 757294 5.65% 125 10429311 77.78% criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=4.55 fanout-score-rank=21 prefix-density=0.13 prefix-fanout=3.1 sequence=TTCAACCAAGCGCG criterion=fanout-score sequence-density=0.05 sequence-density-rank=17 fanout-score=298.24 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=28.8 sequence=TTCTTCTTCTTT Started job on | Feb 12 01:37:56 Started mapping on | Feb 12 01:37:56 Finished on | Feb 12 01:38:32 Mapping speed, Million of reads per hour | 2681.78 Number of input reads | 26817783 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 24743411 Uniquely mapped reads % | 92.26% Average mapped length | 122.80 Number of splices: Total | 9351473 Number of splices: Annotated (sjdb) | 9171154 Number of splices: GT/AG | 9207965 Number of splices: GC/AG | 117231 Number of splices: AT/AC | 9304 Number of splices: Non-canonical | 16973 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.15 Insertion rate per base | 0.02% Insertion average length | 1.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 549844 % of reads mapped to multiple loci | 2.05% Number of reads mapped to too many loci | 1240036 % of reads mapped to too many loci | 4.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.05% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1524528 1524528 1524528 N_multimapping 549844 549844 549844 N_noFeature 1034561 12797312 12804614 N_ambiguous 263145 43366 44153 UnstrandedReadsAssigned:23445705 PositiveStrandReadsAssigned:11902733 NegativeStrandReadsAssigned:11894644 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208024 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208024-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,817,783 reads, 25,015,830 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,276 rounds 52401 SRR3208024.ke.tsv 34699 SRR3208024.se.tsv 87100 total ==> SRR3208024.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 714 20.9627 Potri.005G024800.1.v4.1 1035 936 116 6.98242 Potri.004G059700.1.v4.1 961 862 31 2.02618 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 446.459 8.84456 Potri.016G087400.1.v4.1 270 171 1079 355.508 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 68.5656 2.30767 Potri.012G127500.1.v4.1 977 878 3940 252.828 ==> SRR3208024.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2059 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 504 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 83 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3208024 completed mapping pipeline successfully