Starting /dee2/code/volunteer_pipeline.sh SRR3208025 current disk space = 3050235846656 free memory = 1342886680 SRR3208025 SRAfilesize 4f35e80ea521cb0a61438b3a2086eb6c SRR3208025.sra SRR3208025.sra file validated SRR3208025 is single end SRR3208025 is conventional basespace SRR3208025 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208025_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.58375 33.0 33.0 33.0 33.0 33.0 2 32.166 33.0 33.0 33.0 33.0 33.0 3 32.021 33.0 33.0 33.0 33.0 33.0 4 32.31275 33.0 33.0 33.0 33.0 33.0 5 32.2935 33.0 33.0 33.0 33.0 33.0 6 36.01375 37.0 37.0 37.0 37.0 37.0 7 36.188 37.0 37.0 37.0 37.0 37.0 8 36.29325 37.0 37.0 37.0 37.0 37.0 9 36.29775 37.0 37.0 37.0 37.0 37.0 10-11 36.214749999999995 37.0 37.0 37.0 37.0 37.0 12-13 36.311875 37.0 37.0 37.0 37.0 37.0 14-15 36.341625 37.0 37.0 37.0 37.0 37.0 16-17 36.320750000000004 37.0 37.0 37.0 37.0 37.0 18-19 36.297250000000005 37.0 37.0 37.0 37.0 37.0 20-21 36.33625 37.0 37.0 37.0 37.0 37.0 22-23 36.321124999999995 37.0 37.0 37.0 37.0 37.0 24-25 36.25075 37.0 37.0 37.0 37.0 37.0 26-27 36.087375 37.0 37.0 37.0 37.0 37.0 28-29 36.2315 37.0 37.0 37.0 37.0 37.0 30-31 36.211749999999995 37.0 37.0 37.0 37.0 37.0 32-33 36.24425 37.0 37.0 37.0 37.0 37.0 34-35 36.217375 37.0 37.0 37.0 37.0 37.0 36-37 36.232375000000005 37.0 37.0 37.0 37.0 37.0 38-39 36.273375 37.0 37.0 37.0 37.0 37.0 40-41 36.26049999999999 37.0 37.0 37.0 37.0 37.0 42-43 36.24925 37.0 37.0 37.0 37.0 37.0 44-45 36.2245 37.0 37.0 37.0 37.0 37.0 46-47 36.27375 37.0 37.0 37.0 37.0 37.0 48-49 36.2585 37.0 37.0 37.0 37.0 37.0 50-51 36.18575 37.0 37.0 37.0 37.0 37.0 52-53 36.119125 37.0 37.0 37.0 37.0 37.0 54-55 36.223 37.0 37.0 37.0 37.0 37.0 56-57 36.209625 37.0 37.0 37.0 37.0 37.0 58-59 36.183125000000004 37.0 37.0 37.0 37.0 37.0 60-61 36.1465 37.0 37.0 37.0 37.0 37.0 62-63 36.159125 37.0 37.0 37.0 37.0 37.0 64-65 36.155625 37.0 37.0 37.0 37.0 37.0 66-67 36.12225 37.0 37.0 37.0 37.0 37.0 68-69 36.127375 37.0 37.0 37.0 37.0 37.0 70-71 36.167500000000004 37.0 37.0 37.0 37.0 37.0 72-73 36.193 37.0 37.0 37.0 37.0 37.0 74-75 36.09 37.0 37.0 37.0 37.0 37.0 76-77 36.060375 37.0 37.0 37.0 37.0 37.0 78-79 36.048125 37.0 37.0 37.0 37.0 37.0 80-81 36.006375000000006 37.0 37.0 37.0 37.0 37.0 82-83 36.028875 37.0 37.0 37.0 37.0 37.0 84-85 35.93175 37.0 37.0 37.0 37.0 37.0 86-87 35.961749999999995 37.0 37.0 37.0 37.0 37.0 88-89 36.012249999999995 37.0 37.0 37.0 37.0 37.0 90-91 35.905874999999995 37.0 37.0 37.0 37.0 37.0 92-93 35.890625 37.0 37.0 37.0 37.0 37.0 94-95 35.882125 37.0 37.0 37.0 37.0 37.0 96-97 35.8915 37.0 37.0 37.0 37.0 37.0 98-99 35.8745 37.0 37.0 37.0 37.0 37.0 100-101 35.911125 37.0 37.0 37.0 37.0 37.0 102-103 35.826375 37.0 37.0 37.0 37.0 37.0 104-105 35.7845 37.0 37.0 37.0 37.0 37.0 106-107 35.831125 37.0 37.0 37.0 37.0 37.0 108-109 35.791 37.0 37.0 37.0 37.0 37.0 110-111 35.897499999999994 37.0 37.0 37.0 37.0 37.0 112-113 35.712625 37.0 37.0 37.0 37.0 37.0 114-115 35.710875 37.0 37.0 37.0 37.0 37.0 116-117 35.590125 37.0 37.0 37.0 37.0 37.0 118-119 35.567625 37.0 37.0 37.0 37.0 37.0 120-121 35.521 37.0 37.0 37.0 35.0 37.0 122-123 35.483125 37.0 37.0 37.0 35.0 37.0 124-125 34.043875 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 1.0 4 0.0 5 0.0 6 1.0 7 0.0 8 1.0 9 2.0 10 3.0 11 0.0 12 3.0 13 1.0 14 1.0 15 0.0 16 3.0 17 1.0 18 1.0 19 6.0 20 1.0 21 3.0 22 6.0 23 1.0 24 5.0 25 7.0 26 12.0 27 15.0 28 12.0 29 31.0 30 24.0 31 38.0 32 55.0 33 102.0 34 125.0 35 265.0 36 3259.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.387755102040817 15.0 16.81122448979592 43.80102040816327 2 20.349999999999998 21.7 37.85 20.1 3 21.425 24.975 28.825 24.775 4 23.974999999999998 31.374999999999996 21.8 22.85 5 24.5 35.025 22.725 17.75 6 19.475 38.800000000000004 23.799999999999997 17.925 7 17.724999999999998 19.225 42.525 20.525 8 19.05 23.375 30.625000000000004 26.950000000000003 9 21.2 22.125 32.2 24.474999999999998 10-11 21.925 32.875 23.25 21.95 12-13 21.2375 26.525 29.849999999999998 22.3875 14-15 21.0375 27.400000000000002 28.6875 22.875 16-17 22.25 28.599999999999998 27.900000000000002 21.25 18-19 21.5375 27.750000000000004 28.9 21.8125 20-21 22.5 27.925 27.55 22.025 22-23 22.2625 29.5375 26.950000000000003 21.25 24-25 21.6 28.9125 27.975 21.512500000000003 26-27 21.1875 29.049999999999997 27.6125 22.15 28-29 21.075 28.0625 28.6625 22.2 30-31 20.925 28.6625 27.8375 22.575 32-33 22.037499999999998 28.075 27.987499999999997 21.9 34-35 21.712500000000002 28.000000000000004 28.4125 21.875 36-37 21.15 29.075 27.9125 21.8625 38-39 21.925 29.125 27.375 21.575 40-41 22.175 29.025000000000002 28.15 20.65 42-43 21.975 27.787499999999998 28.6125 21.625 44-45 21.1375 28.925 28.675 21.2625 46-47 21.712500000000002 27.675 28.1875 22.425 48-49 22.4375 28.037499999999998 27.925 21.6 50-51 20.9375 28.712500000000002 27.900000000000002 22.45 52-53 22.25 28.9375 26.5 22.3125 54-55 22.025 27.85 28.237499999999997 21.8875 56-57 21.725 28.65 28.225 21.4 58-59 21.9375 27.712500000000002 27.787499999999998 22.5625 60-61 21.4375 28.262500000000003 28.7 21.6 62-63 22.0875 27.987499999999997 28.1125 21.8125 64-65 21.645617106414903 27.53532574715518 28.02300862823559 22.796048518194322 66-67 21.25 28.425 27.787499999999998 22.537499999999998 68-69 21.42053269976241 28.42315868450669 28.548205577091405 21.608103038639488 70-71 21.212500000000002 29.75 27.537499999999998 21.5 72-73 21.7875 28.549999999999997 28.212500000000002 21.45 74-75 21.1625 29.349999999999998 27.3625 22.125 76-77 22.1055263815954 28.644661165291325 27.219304826206553 22.030507626906726 78-79 21.88868042526579 28.430268918073796 28.19262038774234 21.488430268918073 80-81 21.727158948685858 27.40926157697122 28.548185231539424 22.315394242803503 82-83 21.885942971485743 28.339169584792394 28.87693846923462 20.897948974487242 84-85 22.083281230461424 28.373139927472803 27.810428910841566 21.73314993122421 86-87 21.912499999999998 28.3125 28.025 21.75 88-89 22.25 29.2 27.187499999999996 21.3625 90-91 21.6125 28.425 28.1875 21.775 92-93 22.1 28.462500000000002 28.15 21.2875 94-95 22.2125 28.3875 28.0625 21.337500000000002 96-97 22.725 28.4 27.85 21.025 98-99 22.35 28.212500000000002 28.1625 21.275 100-101 21.3875 28.525 27.950000000000003 22.1375 102-103 21.6875 28.8625 28.037499999999998 21.4125 104-105 21.5 28.287499999999998 28.8375 21.375 106-107 23.1 28.749999999999996 27.200000000000003 20.95 108-109 21.7 28.212500000000002 28.8625 21.224999999999998 110-111 22.0 28.749999999999996 26.7125 22.537499999999998 112-113 23.200000000000003 28.7375 26.875 21.1875 114-115 22.577822227778473 29.353669208651077 26.428303537942245 21.640205025628205 116-117 22.90286285785723 28.316039504938118 26.95336917114639 21.827728466058257 118-119 24.1625 28.65 26.775 20.4125 120-121 23.1 27.762500000000003 27.450000000000003 21.6875 122-123 23.6875 28.8875 26.05 21.375 124-125 23.25 29.1875 26.224999999999998 21.337500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 1.5 20 1.0 21 1.0 22 1.0 23 1.0 24 4.0 25 4.0 26 4.0 27 9.5 28 10.0 29 14.0 30 23.0 31 30.0 32 38.0 33 49.5 34 65.0 35 82.5 36 103.0 37 120.5 38 146.5 39 179.5 40 208.0 41 227.0 42 249.5 43 271.5 44 277.0 45 263.0 46 246.5 47 242.5 48 221.5 49 171.0 50 128.0 51 112.5 52 97.5 53 78.0 54 59.0 55 48.0 56 38.0 57 32.0 58 29.0 59 20.0 60 15.0 61 13.5 62 15.0 63 10.5 64 5.0 65 6.0 66 6.5 67 5.0 68 2.5 69 1.0 70 1.0 71 1.0 72 0.5 73 1.0 74 2.5 75 2.0 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0375 66-67 0.0 68-69 0.0375 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.025 78-79 0.0625 80-81 0.125 82-83 0.05 84-85 0.0375 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0125 116-117 0.0125 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79924717691343 99.425 2 0.17565872020075282 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02509410288582183 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC 9 0.22499999999999998 TruSeq Adapter, Index 7 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 1.0625 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.5 0.0 0.0 0.0 0.0 102-103 1.8875000000000002 0.0 0.0 0.0 0.0 104-105 2.3375000000000004 0.0 0.0 0.0 0.0 106-107 2.7 0.0 0.0 0.0 0.0 108-109 3.1 0.0 0.0 0.0 0.0 110-111 3.8125 0.0 0.0 0.0 0.0 112-113 4.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 653842 spots for SRR3208025.sra Written 653842 spots for SRR3208025.sra Read 653842 spots for SRR3208025.sra Written 653842 spots for SRR3208025.sra Read 653842 spots for SRR3208025.sra Written 653842 spots for SRR3208025.sra Read 653842 spots for SRR3208025.sra Written 653842 spots for SRR3208025.sra Read 653842 spots for SRR3208025.sra Written 653842 spots for SRR3208025.sra Read 653842 spots for SRR3208025.sra Written 653842 spots for SRR3208025.sra Read 653842 spots for SRR3208025.sra Written 653842 spots for SRR3208025.sra Read 653842 spots for SRR3208025.sra Written 653842 spots for SRR3208025.sra Read 653842 spots for SRR3208025.sra Written 653842 spots for SRR3208025.sra Read 653842 spots for SRR3208025.sra Written 653842 spots for SRR3208025.sra Read 653842 spots for SRR3208025.sra Written 653842 spots for SRR3208025.sra Read 653842 spots for SRR3208025.sra Written 653842 spots for SRR3208025.sra Read 653842 spots for SRR3208025.sra Written 653842 spots for SRR3208025.sra Read 653848 spots for SRR3208025.sra Written 653848 spots for SRR3208025.sra Read 653842 spots for SRR3208025.sra Written 653842 spots for SRR3208025.sra Read 653842 spots for SRR3208025.sra Written 653842 spots for SRR3208025.sra Read 653842 spots for SRR3208025.sra Written 653842 spots for SRR3208025.sra Read 653842 spots for SRR3208025.sra Written 653842 spots for SRR3208025.sra Read 653842 spots for SRR3208025.sra Written 653842 spots for SRR3208025.sra Read 653842 spots for SRR3208025.sra Written 653842 spots for SRR3208025.sra SRR ids: ['SRR3208025.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dcin8oz2 SRR3208025.sra spots: 13076846 blocks: [[1, 653842], [653843, 1307684], [1307685, 1961526], [1961527, 2615368], [2615369, 3269210], [3269211, 3923052], [3923053, 4576894], [4576895, 5230736], [5230737, 5884578], [5884579, 6538420], [6538421, 7192262], [7192263, 7846104], [7846105, 8499946], [8499947, 9153788], [9153789, 9807630], [9807631, 10461472], [10461473, 11115314], [11115315, 11769156], [11769157, 12422998], [12422999, 13076846]] SRR3208025 file size 4184219 SRR3208025 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208025 SRR3208025_1.fastq Input file: SRR3208025_1.fastq trimmed: SRR3208025-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 02:00:08 2025 >> started Wed Feb 12 02:00:15 2025 >> done (7.112s) 13076846 reads processed; of these: 9443 ( 0.07%) short reads filtered out after trimming by size control 54613 ( 0.42%) empty reads filtered out after trimming by size control 13012790 (99.51%) reads available; of these: 1458994 (11.21%) trimmed reads available after processing 11553796 (88.79%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 373 0.00% 19 382 0.00% 20 415 0.00% 21 441 0.00% 22 472 0.00% 23 557 0.00% 24 674 0.01% 25 753 0.01% 26 720 0.01% 27 660 0.01% 28 754 0.01% 29 706 0.01% 30 1127 0.01% 31 968 0.01% 32 703 0.01% 33 665 0.01% 34 672 0.01% 35 694 0.01% 36 729 0.01% 37 683 0.01% 38 759 0.01% 39 736 0.01% 40 751 0.01% 41 679 0.01% 42 713 0.01% 43 763 0.01% 44 746 0.01% 45 726 0.01% 46 806 0.01% 47 772 0.01% 48 806 0.01% 49 821 0.01% 50 821 0.01% 51 927 0.01% 52 835 0.01% 53 894 0.01% 54 901 0.01% 55 940 0.01% 56 953 0.01% 57 1020 0.01% 58 1026 0.01% 59 1056 0.01% 60 1070 0.01% 61 1094 0.01% 62 1168 0.01% 63 1197 0.01% 64 1192 0.01% 65 1133 0.01% 66 1185 0.01% 67 1287 0.01% 68 1351 0.01% 69 1383 0.01% 70 1506 0.01% 71 1525 0.01% 72 1864 0.01% 73 2074 0.02% 74 2107 0.02% 75 2056 0.02% 76 2007 0.02% 77 2174 0.02% 78 2408 0.02% 79 2531 0.02% 80 2789 0.02% 81 3216 0.02% 82 3658 0.03% 83 4011 0.03% 84 4315 0.03% 85 4620 0.04% 86 5092 0.04% 87 5419 0.04% 88 6140 0.05% 89 6910 0.05% 90 8074 0.06% 91 9202 0.07% 92 10767 0.08% 93 12030 0.09% 94 1912 0.01% 95 2156 0.02% 96 2173 0.02% 97 2228 0.02% 98 2395 0.02% 99 2552 0.02% 100 2847 0.02% 101 3282 0.03% 102 3373 0.03% 103 3623 0.03% 104 3237 0.02% 105 3705 0.03% 106 3721 0.03% 107 4123 0.03% 108 4630 0.04% 109 5040 0.04% 110 5598 0.04% 111 6304 0.05% 112 7254 0.06% 113 8221 0.06% 114 9295 0.07% 115 10717 0.08% 116 12893 0.10% 117 15224 0.12% 118 19455 0.15% 119 25067 0.19% 120 33989 0.26% 121 46915 0.36% 122 77061 0.59% 123 167916 1.29% 124 811934 6.24% 125 11553796 88.79% 13012790 reads passed initial QC criterion=sequence-density sequence-density=4.36 sequence-density-rank=1 fanout-score=55.77 fanout-score-rank=1 prefix-density=5.94 prefix-fanout=40.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGAAA criterion=fanout-score sequence-density=4.36 sequence-density-rank=1 fanout-score=55.77 fanout-score-rank=1 prefix-density=5.94 prefix-fanout=40.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGAAA -o SRR3208025 - Input file: STDIN trimmed: SRR3208025-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 02:01:01 2025 >> started Wed Feb 12 02:01:10 2025 >> done (8.614s) 7807674 reads processed; of these: 72 ( 0.00%) short reads filtered out after trimming by size control 910 ( 0.01%) empty reads filtered out after trimming by size control 7806692 (99.99%) reads available; of these: 1036398 (13.28%) trimmed reads available after processing 6770294 (86.72%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 210 0.00% 19 237 0.00% 20 246 0.00% 21 280 0.00% 22 300 0.00% 23 333 0.00% 24 407 0.01% 25 448 0.01% 26 427 0.01% 27 406 0.01% 28 462 0.01% 29 435 0.01% 30 651 0.01% 31 584 0.01% 32 396 0.01% 33 418 0.01% 34 421 0.01% 35 394 0.01% 36 457 0.01% 37 409 0.01% 38 444 0.01% 39 445 0.01% 40 466 0.01% 41 432 0.01% 42 421 0.01% 43 425 0.01% 44 456 0.01% 45 454 0.01% 46 475 0.01% 47 469 0.01% 48 512 0.01% 49 468 0.01% 50 487 0.01% 51 552 0.01% 52 506 0.01% 53 542 0.01% 54 521 0.01% 55 575 0.01% 56 590 0.01% 57 608 0.01% 58 626 0.01% 59 626 0.01% 60 633 0.01% 61 661 0.01% 62 712 0.01% 63 680 0.01% 64 688 0.01% 65 663 0.01% 66 709 0.01% 67 773 0.01% 68 798 0.01% 69 806 0.01% 70 897 0.01% 71 904 0.01% 72 1003 0.01% 73 1002 0.01% 74 1034 0.01% 75 1162 0.01% 76 1238 0.02% 77 1325 0.02% 78 1425 0.02% 79 1550 0.02% 80 1725 0.02% 81 1929 0.02% 82 2230 0.03% 83 2407 0.03% 84 2621 0.03% 85 2799 0.04% 86 3103 0.04% 87 3308 0.04% 88 3746 0.05% 89 4167 0.05% 90 4762 0.06% 91 5474 0.07% 92 6370 0.08% 93 7312 0.09% 94 8082 0.10% 95 8913 0.11% 96 9539 0.12% 97 10200 0.13% 98 11325 0.15% 99 12842 0.16% 100 14529 0.19% 101 16688 0.21% 102 18784 0.24% 103 21186 0.27% 104 22516 0.29% 105 24271 0.31% 106 25564 0.33% 107 26761 0.34% 108 28425 0.36% 109 30866 0.40% 110 33692 0.43% 111 37284 0.48% 112 41472 0.53% 113 45159 0.58% 114 48304 0.62% 115 51236 0.66% 116 53184 0.68% 117 55259 0.71% 118 58439 0.75% 119 64463 0.83% 120 80416 1.03% 121 117434 1.50% 122 240018 3.07% 123 90744 1.16% 124 436775 5.59% 125 5972685 76.51% criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=5.91 fanout-score-rank=20 prefix-density=0.12 prefix-fanout=3.7 sequence=TCCTTCAGCTGAAGGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=287.46 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=19.7 sequence=TTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTGGAAAAGAAGGAAAGTGTGATGAAATTAAGGGATTTCTTTTACTTAGAAGAA Started job on | Feb 12 02:01:35 Started mapping on | Feb 12 02:01:35 Finished on | Feb 12 02:01:55 Mapping speed, Million of reads per hour | 2342.13 Number of input reads | 13011808 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 12000392 Uniquely mapped reads % | 92.23% Average mapped length | 122.49 Number of splices: Total | 4352236 Number of splices: Annotated (sjdb) | 4243596 Number of splices: GT/AG | 4274029 Number of splices: GC/AG | 63242 Number of splices: AT/AC | 5541 Number of splices: Non-canonical | 9424 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.53 Insertion rate per base | 0.02% Insertion average length | 1.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 298900 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 319620 % of reads mapped to too many loci | 2.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.01% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 712516 712516 712516 N_multimapping 298900 298900 298900 N_noFeature 687742 6309513 6320545 N_ambiguous 109605 25923 25835 UnstrandedReadsAssigned:11203045 PositiveStrandReadsAssigned:5664956 NegativeStrandReadsAssigned:5654012 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208025 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208025-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,011,808 reads, 11,700,925 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,152 rounds 52401 SRR3208025.ke.tsv 34699 SRR3208025.se.tsv 87100 total ==> SRR3208025.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 719 43.097 Potri.005G024800.1.v4.1 1035 936 1081 132.844 Potri.004G059700.1.v4.1 961 862 10 1.3344 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 294.601 11.9151 Potri.016G087400.1.v4.1 270 171 330 221.979 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 59 4.05406 Potri.012G127500.1.v4.1 977 878 2947 386.082 ==> SRR3208025.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1081 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 168 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR3208025 completed mapping pipeline successfully