Starting /dee2/code/volunteer_pipeline.sh SRR3208026 current disk space = 3049531146240 free memory = 1575292700 SRR3208026 SRAfilesize d6175d3dabbd770090913a53ddbef0e1 SRR3208026.sra SRR3208026.sra file validated SRR3208026 is single end SRR3208026 is conventional basespace SRR3208026 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208026_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.41425 33.0 33.0 33.0 33.0 33.0 2 32.11775 33.0 33.0 33.0 33.0 33.0 3 32.15525 33.0 33.0 33.0 33.0 33.0 4 32.29775 33.0 33.0 33.0 33.0 33.0 5 32.48275 33.0 33.0 33.0 33.0 33.0 6 36.1275 37.0 37.0 37.0 37.0 37.0 7 36.37575 37.0 37.0 37.0 37.0 37.0 8 36.30975 37.0 37.0 37.0 37.0 37.0 9 36.34225 37.0 37.0 37.0 37.0 37.0 10-11 36.38175 37.0 37.0 37.0 37.0 37.0 12-13 36.396625 37.0 37.0 37.0 37.0 37.0 14-15 36.384249999999994 37.0 37.0 37.0 37.0 37.0 16-17 36.344875 37.0 37.0 37.0 37.0 37.0 18-19 36.385625 37.0 37.0 37.0 37.0 37.0 20-21 36.41375 37.0 37.0 37.0 37.0 37.0 22-23 36.402625 37.0 37.0 37.0 37.0 37.0 24-25 36.31725 37.0 37.0 37.0 37.0 37.0 26-27 36.181125 37.0 37.0 37.0 37.0 37.0 28-29 36.317125000000004 37.0 37.0 37.0 37.0 37.0 30-31 36.355375 37.0 37.0 37.0 37.0 37.0 32-33 36.351625 37.0 37.0 37.0 37.0 37.0 34-35 36.344375 37.0 37.0 37.0 37.0 37.0 36-37 36.323625 37.0 37.0 37.0 37.0 37.0 38-39 36.40925 37.0 37.0 37.0 37.0 37.0 40-41 36.38675 37.0 37.0 37.0 37.0 37.0 42-43 36.328875 37.0 37.0 37.0 37.0 37.0 44-45 36.314375 37.0 37.0 37.0 37.0 37.0 46-47 36.401625 37.0 37.0 37.0 37.0 37.0 48-49 36.39149999999999 37.0 37.0 37.0 37.0 37.0 50-51 36.422125 37.0 37.0 37.0 37.0 37.0 52-53 36.322874999999996 37.0 37.0 37.0 37.0 37.0 54-55 36.36325 37.0 37.0 37.0 37.0 37.0 56-57 36.353875 37.0 37.0 37.0 37.0 37.0 58-59 36.373125 37.0 37.0 37.0 37.0 37.0 60-61 36.318625 37.0 37.0 37.0 37.0 37.0 62-63 36.311625 37.0 37.0 37.0 37.0 37.0 64-65 36.252875 37.0 37.0 37.0 37.0 37.0 66-67 36.251125 37.0 37.0 37.0 37.0 37.0 68-69 36.312875 37.0 37.0 37.0 37.0 37.0 70-71 36.262375 37.0 37.0 37.0 37.0 37.0 72-73 36.258624999999995 37.0 37.0 37.0 37.0 37.0 74-75 36.219875 37.0 37.0 37.0 37.0 37.0 76-77 36.231625 37.0 37.0 37.0 37.0 37.0 78-79 36.201 37.0 37.0 37.0 37.0 37.0 80-81 36.142375 37.0 37.0 37.0 37.0 37.0 82-83 36.212625 37.0 37.0 37.0 37.0 37.0 84-85 36.153625000000005 37.0 37.0 37.0 37.0 37.0 86-87 36.102125 37.0 37.0 37.0 37.0 37.0 88-89 36.1515 37.0 37.0 37.0 37.0 37.0 90-91 36.187875 37.0 37.0 37.0 37.0 37.0 92-93 36.162625 37.0 37.0 37.0 37.0 37.0 94-95 36.049625 37.0 37.0 37.0 37.0 37.0 96-97 36.02775 37.0 37.0 37.0 37.0 37.0 98-99 36.008250000000004 37.0 37.0 37.0 37.0 37.0 100-101 36.06975 37.0 37.0 37.0 37.0 37.0 102-103 36.018625 37.0 37.0 37.0 37.0 37.0 104-105 36.010625 37.0 37.0 37.0 37.0 37.0 106-107 36.066 37.0 37.0 37.0 37.0 37.0 108-109 36.019875 37.0 37.0 37.0 37.0 37.0 110-111 35.936 37.0 37.0 37.0 37.0 37.0 112-113 35.904375 37.0 37.0 37.0 37.0 37.0 114-115 35.8335 37.0 37.0 37.0 37.0 37.0 116-117 35.785375 37.0 37.0 37.0 37.0 37.0 118-119 35.864000000000004 37.0 37.0 37.0 37.0 37.0 120-121 35.763625000000005 37.0 37.0 37.0 37.0 37.0 122-123 35.74575 37.0 37.0 37.0 37.0 37.0 124-125 34.14675 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 0.0 15 0.0 16 1.0 17 5.0 18 1.0 19 2.0 20 1.0 21 2.0 22 5.0 23 3.0 24 2.0 25 7.0 26 8.0 27 11.0 28 8.0 29 19.0 30 31.0 31 52.0 32 66.0 33 98.0 34 137.0 35 261.0 36 3268.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.191763191763194 16.422136422136422 14.543114543114545 45.84298584298585 2 19.475 22.075 38.875 19.575 3 21.65 24.975 28.249999999999996 25.124999999999996 4 23.925 31.324999999999996 21.4 23.35 5 26.150000000000002 33.275 22.825 17.75 6 20.175 35.15 24.675 20.0 7 17.2 19.075 43.425000000000004 20.3 8 18.7 25.174999999999997 30.4 25.724999999999998 9 20.175 23.125 32.324999999999996 24.375 10-11 22.537499999999998 33.6 23.025000000000002 20.837500000000002 12-13 21.087500000000002 26.5125 29.6875 22.7125 14-15 21.3 27.625 28.712500000000002 22.3625 16-17 21.3 28.512500000000003 27.5875 22.6 18-19 21.6125 28.749999999999996 27.650000000000002 21.987499999999997 20-21 21.0125 28.762500000000003 28.4375 21.7875 22-23 21.5 29.8875 27.175 21.4375 24-25 21.4125 29.812499999999996 27.025 21.75 26-27 20.962500000000002 28.787499999999998 27.575 22.675 28-29 21.525 28.6125 28.012500000000003 21.85 30-31 21.325 27.900000000000002 27.962500000000002 22.8125 32-33 22.075 28.962500000000002 27.1125 21.85 34-35 22.112499999999997 28.462500000000002 27.900000000000002 21.525 36-37 22.3375 28.275 27.85 21.5375 38-39 20.549999999999997 28.95 28.925 21.575 40-41 22.375 28.1 27.212500000000002 22.3125 42-43 20.6125 29.049999999999997 28.4375 21.9 44-45 21.1875 28.5875 28.5625 21.6625 46-47 22.5625 29.1125 26.85 21.475 48-49 22.35 28.5625 27.474999999999998 21.6125 50-51 22.162499999999998 28.1375 28.025 21.675 52-53 22.2125 27.437499999999996 28.3875 21.9625 54-55 21.2875 28.1125 28.3375 22.2625 56-57 21.1375 28.125 29.062500000000004 21.675 58-59 22.6125 28.299999999999997 27.737499999999997 21.349999999999998 60-61 20.8125 28.000000000000004 28.249999999999996 22.9375 62-63 21.725 28.125 28.037499999999998 22.112499999999997 64-65 21.802725340667585 28.528566070758842 27.87848481060132 21.790223777972244 66-67 22.075 28.849999999999998 27.537499999999998 21.5375 68-69 22.502812851606453 28.56607075884486 27.715964495561945 21.215151893986747 70-71 22.237499999999997 28.575 27.8375 21.349999999999998 72-73 21.4875 27.700000000000003 28.9375 21.875 74-75 22.3375 27.85 28.212500000000002 21.6 76-77 21.9 28.599999999999998 27.85 21.65 78-79 22.090261282660332 28.453556694586823 27.990998874859358 21.465183147893487 80-81 21.298149074537267 28.77688844422211 28.36418209104552 21.5607803901951 82-83 21.427678459807474 29.25365670708839 27.665958244780597 21.65270658832354 84-85 21.602700337542196 28.153519189898734 27.97849731216402 22.26528316039505 86-87 21.875 28.375 28.725 21.025 88-89 22.35 27.6125 27.900000000000002 22.1375 90-91 22.0125 27.500000000000004 28.025 22.4625 92-93 21.8125 28.449999999999996 27.85 21.8875 94-95 22.725 28.625 26.937499999999996 21.712500000000002 96-97 22.475 27.825 27.900000000000002 21.8 98-99 22.725 27.325 28.262500000000003 21.6875 100-101 23.075000000000003 27.425 27.950000000000003 21.55 102-103 22.5875 28.625 27.400000000000002 21.3875 104-105 22.3375 29.1125 26.875 21.675 106-107 22.725 28.7 27.725 20.849999999999998 108-109 22.662499999999998 28.199999999999996 27.325 21.8125 110-111 23.1625 28.225 26.775 21.837500000000002 112-113 21.9625 28.6625 27.6 21.775 114-115 22.8 28.225 26.8375 22.1375 116-117 22.825 28.012500000000003 27.3625 21.8 118-119 22.15 28.975 26.674999999999997 22.2 120-121 23.5375 28.4 25.912499999999998 22.15 122-123 23.45 29.4375 25.9625 21.15 124-125 23.75 28.9125 27.0875 20.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 1.5 23 2.5 24 1.5 25 4.5 26 8.5 27 9.0 28 13.0 29 18.5 30 22.5 31 33.0 32 46.5 33 54.0 34 57.5 35 71.0 36 96.0 37 117.5 38 134.0 39 166.5 40 206.5 41 224.0 42 253.0 43 261.0 44 259.5 45 273.5 46 252.5 47 227.0 48 208.5 49 195.5 50 168.0 51 137.5 52 103.0 53 74.0 54 66.0 55 43.5 56 35.0 57 33.5 58 24.0 59 17.5 60 10.5 61 9.5 62 9.0 63 7.0 64 8.0 65 6.0 66 3.0 67 2.5 68 2.5 69 3.0 70 2.5 71 1.0 72 0.0 73 4.0 74 4.0 75 0.5 76 1.0 77 1.5 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0125 66-67 0.0 68-69 0.0125 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0125 80-81 0.05 82-83 0.0125 84-85 0.0125 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77420973406925 99.425 2 0.17561465127947817 0.35000000000000003 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025087807325639738 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGC 6 0.15 TruSeq Adapter, Index 12 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.35 0.0 0.0 0.0 0.0 100-101 1.525 0.0 0.0 0.0 0.0 102-103 1.8250000000000002 0.0 0.0 0.0 0.0 104-105 2.2625 0.0 0.0 0.0 0.0 106-107 2.625 0.0 0.0 0.0 0.0 108-109 3.1 0.0 0.0 0.0 0.0 110-111 3.7625 0.0 0.0 0.0 0.0 112-113 4.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1296284 spots for SRR3208026.sra Written 1296284 spots for SRR3208026.sra Read 1296284 spots for SRR3208026.sra Written 1296284 spots for SRR3208026.sra Read 1296284 spots for SRR3208026.sra Written 1296284 spots for SRR3208026.sra Read 1296284 spots for SRR3208026.sra Written 1296284 spots for SRR3208026.sra Read 1296284 spots for SRR3208026.sra Written 1296284 spots for SRR3208026.sra Read 1296284 spots for SRR3208026.sra Written 1296284 spots for SRR3208026.sra Read 1296284 spots for SRR3208026.sra Written 1296284 spots for SRR3208026.sra Read 1296284 spots for SRR3208026.sra Written 1296284 spots for SRR3208026.sra Read 1296284 spots for SRR3208026.sra Written 1296284 spots for SRR3208026.sra Read 1296284 spots for SRR3208026.sra Written 1296284 spots for SRR3208026.sra Read 1296284 spots for SRR3208026.sra Written 1296284 spots for SRR3208026.sra Read 1296284 spots for SRR3208026.sra Written 1296284 spots for SRR3208026.sra Read 1296284 spots for SRR3208026.sra Written 1296284 spots for SRR3208026.sra Read 1296284 spots for SRR3208026.sra Written 1296284 spots for SRR3208026.sra Read 1296284 spots for SRR3208026.sra Written 1296284 spots for SRR3208026.sra Read 1296284 spots for SRR3208026.sra Written 1296284 spots for SRR3208026.sra Read 1296284 spots for SRR3208026.sra Written 1296284 spots for SRR3208026.sra Read 1296299 spots for SRR3208026.sra Written 1296299 spots for SRR3208026.sra Read 1296284 spots for SRR3208026.sra Written 1296284 spots for SRR3208026.sra Read 1296284 spots for SRR3208026.sra Written 1296284 spots for SRR3208026.sra SRR ids: ['SRR3208026.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bitjvj5p SRR3208026.sra spots: 25925695 blocks: [[1, 1296284], [1296285, 2592568], [2592569, 3888852], [3888853, 5185136], [5185137, 6481420], [6481421, 7777704], [7777705, 9073988], [9073989, 10370272], [10370273, 11666556], [11666557, 12962840], [12962841, 14259124], [14259125, 15555408], [15555409, 16851692], [16851693, 18147976], [18147977, 19444260], [19444261, 20740544], [20740545, 22036828], [22036829, 23333112], [23333113, 24629396], [24629397, 25925695]] SRR3208026 file size 8306145 SRR3208026 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208026 SRR3208026_1.fastq Input file: SRR3208026_1.fastq trimmed: SRR3208026-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 02:13:55 2025 >> started Wed Feb 12 02:14:09 2025 >> done (13.961s) 25925695 reads processed; of these: 17415 ( 0.07%) short reads filtered out after trimming by size control 94802 ( 0.37%) empty reads filtered out after trimming by size control 25813478 (99.57%) reads available; of these: 2872808 (11.13%) trimmed reads available after processing 22940670 (88.87%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 715 0.00% 19 764 0.00% 20 758 0.00% 21 845 0.00% 22 971 0.00% 23 1107 0.00% 24 1343 0.01% 25 1449 0.01% 26 1481 0.01% 27 1420 0.01% 28 1416 0.01% 29 1485 0.01% 30 1983 0.01% 31 2000 0.01% 32 1378 0.01% 33 1323 0.01% 34 1257 0.00% 35 1242 0.00% 36 1361 0.01% 37 1382 0.01% 38 1460 0.01% 39 1300 0.01% 40 1404 0.01% 41 1385 0.01% 42 1416 0.01% 43 1446 0.01% 44 1523 0.01% 45 1559 0.01% 46 1469 0.01% 47 1550 0.01% 48 1543 0.01% 49 1650 0.01% 50 1708 0.01% 51 1662 0.01% 52 1762 0.01% 53 1702 0.01% 54 1811 0.01% 55 1785 0.01% 56 1890 0.01% 57 1979 0.01% 58 2064 0.01% 59 2211 0.01% 60 2249 0.01% 61 2352 0.01% 62 2485 0.01% 63 2356 0.01% 64 2396 0.01% 65 2480 0.01% 66 2487 0.01% 67 2516 0.01% 68 2805 0.01% 69 2926 0.01% 70 3110 0.01% 71 3215 0.01% 72 3389 0.01% 73 3778 0.01% 74 3846 0.01% 75 3834 0.01% 76 3883 0.02% 77 4270 0.02% 78 4662 0.02% 79 5204 0.02% 80 5741 0.02% 81 6447 0.02% 82 7129 0.03% 83 7984 0.03% 84 8600 0.03% 85 9238 0.04% 86 10102 0.04% 87 10929 0.04% 88 11994 0.05% 89 13768 0.05% 90 16245 0.06% 91 18419 0.07% 92 20778 0.08% 93 23228 0.09% 94 3996 0.02% 95 4195 0.02% 96 4314 0.02% 97 4622 0.02% 98 4946 0.02% 99 5326 0.02% 100 5687 0.02% 101 6520 0.03% 102 6450 0.02% 103 7006 0.03% 104 6680 0.03% 105 7241 0.03% 106 7657 0.03% 107 8297 0.03% 108 9159 0.04% 109 10015 0.04% 110 10978 0.04% 111 12282 0.05% 112 14090 0.05% 113 16255 0.06% 114 18210 0.07% 115 21251 0.08% 116 24956 0.10% 117 30327 0.12% 118 38102 0.15% 119 48864 0.19% 120 66269 0.26% 121 91983 0.36% 122 151952 0.59% 123 328479 1.27% 124 1599895 6.20% 125 22940670 88.87% 25813478 reads passed initial QC criterion=sequence-density sequence-density=4.38 sequence-density-rank=1 fanout-score=55.05 fanout-score-rank=1 prefix-density=6.00 prefix-fanout=40.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTGAAA criterion=fanout-score sequence-density=4.38 sequence-density-rank=1 fanout-score=55.05 fanout-score-rank=1 prefix-density=6.00 prefix-fanout=40.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTGAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTGAAA -o SRR3208026 - Input file: STDIN trimmed: SRR3208026-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 02:15:33 2025 >> started Wed Feb 12 02:15:50 2025 >> done (16.951s) 15488087 reads processed; of these: 113 ( 0.00%) short reads filtered out after trimming by size control 615 ( 0.00%) empty reads filtered out after trimming by size control 15487359 (100.00%) reads available; of these: 2091088 (13.50%) trimmed reads available after processing 13396271 (86.50%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 457 0.00% 19 474 0.00% 20 452 0.00% 21 488 0.00% 22 579 0.00% 23 686 0.00% 24 817 0.01% 25 886 0.01% 26 894 0.01% 27 855 0.01% 28 829 0.01% 29 877 0.01% 30 1199 0.01% 31 1250 0.01% 32 800 0.01% 33 807 0.01% 34 747 0.00% 35 718 0.00% 36 821 0.01% 37 838 0.01% 38 876 0.01% 39 805 0.01% 40 800 0.01% 41 817 0.01% 42 870 0.01% 43 887 0.01% 44 936 0.01% 45 957 0.01% 46 869 0.01% 47 917 0.01% 48 935 0.01% 49 990 0.01% 50 988 0.01% 51 967 0.01% 52 1052 0.01% 53 1003 0.01% 54 1093 0.01% 55 1085 0.01% 56 1128 0.01% 57 1185 0.01% 58 1236 0.01% 59 1316 0.01% 60 1378 0.01% 61 1412 0.01% 62 1480 0.01% 63 1415 0.01% 64 1461 0.01% 65 1508 0.01% 66 1500 0.01% 67 1524 0.01% 68 1735 0.01% 69 1779 0.01% 70 1870 0.01% 71 1874 0.01% 72 1941 0.01% 73 2201 0.01% 74 2181 0.01% 75 2225 0.01% 76 2279 0.01% 77 2592 0.02% 78 2761 0.02% 79 3156 0.02% 80 3496 0.02% 81 3852 0.02% 82 4348 0.03% 83 4759 0.03% 84 5211 0.03% 85 5535 0.04% 86 6076 0.04% 87 6624 0.04% 88 7282 0.05% 89 8265 0.05% 90 9753 0.06% 91 10817 0.07% 92 12328 0.08% 93 13910 0.09% 94 15687 0.10% 95 17433 0.11% 96 18586 0.12% 97 20542 0.13% 98 22770 0.15% 99 25441 0.16% 100 29079 0.19% 101 33013 0.21% 102 37318 0.24% 103 42120 0.27% 104 45210 0.29% 105 48274 0.31% 106 50821 0.33% 107 54196 0.35% 108 57745 0.37% 109 61825 0.40% 110 68499 0.44% 111 75108 0.48% 112 83479 0.54% 113 90719 0.59% 114 97602 0.63% 115 103593 0.67% 116 107742 0.70% 117 112875 0.73% 118 119018 0.77% 119 131652 0.85% 120 162759 1.05% 121 235050 1.52% 122 478323 3.09% 123 176931 1.14% 124 858235 5.54% 125 11828000 76.37% criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=5.80 fanout-score-rank=18 prefix-density=0.13 prefix-fanout=3.5 sequence=TTCAACCAAGCGCG criterion=fanout-score sequence-density=0.05 sequence-density-rank=19 fanout-score=310.92 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=29.7 sequence=TTCTTCTTCTTT Started job on | Feb 12 02:16:19 Started mapping on | Feb 12 02:16:19 Finished on | Feb 12 02:16:57 Mapping speed, Million of reads per hour | 2445.42 Number of input reads | 25812750 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 23592532 Uniquely mapped reads % | 91.40% Average mapped length | 122.49 Number of splices: Total | 8398269 Number of splices: Annotated (sjdb) | 8225806 Number of splices: GT/AG | 8266925 Number of splices: GC/AG | 105987 Number of splices: AT/AC | 8970 Number of splices: Non-canonical | 16387 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.16 Insertion rate per base | 0.02% Insertion average length | 1.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 525745 % of reads mapped to multiple loci | 2.04% Number of reads mapped to too many loci | 918491 % of reads mapped to too many loci | 3.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.99% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1694473 1694473 1694473 N_multimapping 525745 525745 525745 N_noFeature 1015940 12196412 12231654 N_ambiguous 266735 43143 43692 UnstrandedReadsAssigned:22309857 PositiveStrandReadsAssigned:11352977 NegativeStrandReadsAssigned:11317186 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208026 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208026-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,812,750 reads, 23,572,047 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,144 rounds 52401 SRR3208026.ke.tsv 34699 SRR3208026.se.tsv 87100 total ==> SRR3208026.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 792 23.875 Potri.005G024800.1.v4.1 1035 936 220 13.5969 Potri.004G059700.1.v4.1 961 862 34 2.28173 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 413.225 8.40525 Potri.016G087400.1.v4.1 270 171 1108 374.832 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 83 2.86824 Potri.012G127500.1.v4.1 977 878 4119 271.388 ==> SRR3208026.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2644 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 456 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 31 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 29 SRR3208026 completed mapping pipeline successfully