Starting /dee2/code/volunteer_pipeline.sh SRR3208027 current disk space = 3050729353216 free memory = 1366049860 SRR3208027 SRAfilesize 9e9636c18b3f12ae674f922a5b231719 SRR3208027.sra SRR3208027.sra file validated SRR3208027 is single end SRR3208027 is conventional basespace SRR3208027 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208027_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5295 33.0 33.0 33.0 33.0 33.0 2 32.219 33.0 33.0 33.0 33.0 33.0 3 32.1165 33.0 33.0 33.0 33.0 33.0 4 32.3505 33.0 33.0 33.0 33.0 33.0 5 32.44775 33.0 33.0 33.0 33.0 33.0 6 36.07075 37.0 37.0 37.0 37.0 37.0 7 36.298 37.0 37.0 37.0 37.0 37.0 8 36.25925 37.0 37.0 37.0 37.0 37.0 9 36.31925 37.0 37.0 37.0 37.0 37.0 10-11 36.305125000000004 37.0 37.0 37.0 37.0 37.0 12-13 36.302875 37.0 37.0 37.0 37.0 37.0 14-15 36.28975 37.0 37.0 37.0 37.0 37.0 16-17 36.313625 37.0 37.0 37.0 37.0 37.0 18-19 36.292 37.0 37.0 37.0 37.0 37.0 20-21 36.259375 37.0 37.0 37.0 37.0 37.0 22-23 36.343 37.0 37.0 37.0 37.0 37.0 24-25 36.2845 37.0 37.0 37.0 37.0 37.0 26-27 36.063125 37.0 37.0 37.0 37.0 37.0 28-29 36.27825 37.0 37.0 37.0 37.0 37.0 30-31 36.236999999999995 37.0 37.0 37.0 37.0 37.0 32-33 36.279125 37.0 37.0 37.0 37.0 37.0 34-35 36.256125 37.0 37.0 37.0 37.0 37.0 36-37 36.271625 37.0 37.0 37.0 37.0 37.0 38-39 36.258250000000004 37.0 37.0 37.0 37.0 37.0 40-41 36.2675 37.0 37.0 37.0 37.0 37.0 42-43 36.239 37.0 37.0 37.0 37.0 37.0 44-45 36.252624999999995 37.0 37.0 37.0 37.0 37.0 46-47 36.28875 37.0 37.0 37.0 37.0 37.0 48-49 36.222125000000005 37.0 37.0 37.0 37.0 37.0 50-51 36.24912500000001 37.0 37.0 37.0 37.0 37.0 52-53 36.16475 37.0 37.0 37.0 37.0 37.0 54-55 36.18875 37.0 37.0 37.0 37.0 37.0 56-57 36.2515 37.0 37.0 37.0 37.0 37.0 58-59 36.267624999999995 37.0 37.0 37.0 37.0 37.0 60-61 36.278875 37.0 37.0 37.0 37.0 37.0 62-63 36.182375 37.0 37.0 37.0 37.0 37.0 64-65 36.2065 37.0 37.0 37.0 37.0 37.0 66-67 36.197500000000005 37.0 37.0 37.0 37.0 37.0 68-69 36.188874999999996 37.0 37.0 37.0 37.0 37.0 70-71 36.177375 37.0 37.0 37.0 37.0 37.0 72-73 36.13375 37.0 37.0 37.0 37.0 37.0 74-75 36.118375 37.0 37.0 37.0 37.0 37.0 76-77 36.09 37.0 37.0 37.0 37.0 37.0 78-79 36.053749999999994 37.0 37.0 37.0 37.0 37.0 80-81 36.087 37.0 37.0 37.0 37.0 37.0 82-83 36.015249999999995 37.0 37.0 37.0 37.0 37.0 84-85 36.067875 37.0 37.0 37.0 37.0 37.0 86-87 36.045125 37.0 37.0 37.0 37.0 37.0 88-89 35.99425 37.0 37.0 37.0 37.0 37.0 90-91 36.103125000000006 37.0 37.0 37.0 37.0 37.0 92-93 36.01575 37.0 37.0 37.0 37.0 37.0 94-95 35.983125 37.0 37.0 37.0 37.0 37.0 96-97 35.96325 37.0 37.0 37.0 37.0 37.0 98-99 35.957875 37.0 37.0 37.0 37.0 37.0 100-101 35.9555 37.0 37.0 37.0 37.0 37.0 102-103 35.759625 37.0 37.0 37.0 37.0 37.0 104-105 35.81325 37.0 37.0 37.0 37.0 37.0 106-107 35.880624999999995 37.0 37.0 37.0 37.0 37.0 108-109 35.7745 37.0 37.0 37.0 37.0 37.0 110-111 35.77775 37.0 37.0 37.0 37.0 37.0 112-113 35.830125 37.0 37.0 37.0 37.0 37.0 114-115 35.736875 37.0 37.0 37.0 37.0 37.0 116-117 35.666125 37.0 37.0 37.0 37.0 37.0 118-119 35.675749999999994 37.0 37.0 37.0 37.0 37.0 120-121 35.638625000000005 37.0 37.0 37.0 37.0 37.0 122-123 35.548125 37.0 37.0 37.0 37.0 37.0 124-125 34.0965 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 2.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 2.0 15 3.0 16 2.0 17 0.0 18 2.0 19 1.0 20 3.0 21 4.0 22 5.0 23 3.0 24 6.0 25 9.0 26 5.0 27 12.0 28 18.0 29 31.0 30 28.0 31 29.0 32 70.0 33 69.0 34 141.0 35 257.0 36 3279.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.32735196103563 14.816713663163291 13.663163291463729 48.19277108433735 2 18.45 22.0 40.775 18.775 3 21.325 25.6 26.974999999999998 26.1 4 24.975 31.2 20.65 23.175 5 25.0 34.675 22.15 18.175 6 19.025 37.275000000000006 23.400000000000002 20.3 7 16.625 20.45 41.575 21.349999999999998 8 19.7 22.475 32.525 25.3 9 21.125 23.35 30.775000000000002 24.75 10-11 22.45 33.7625 23.225 20.5625 12-13 20.474999999999998 25.8 30.7125 23.0125 14-15 20.325 28.6625 28.012500000000003 23.0 16-17 21.6625 27.85 27.525 22.9625 18-19 21.025 28.812500000000004 28.0625 22.1 20-21 21.987499999999997 28.599999999999998 27.3625 22.05 22-23 21.7 28.6125 27.525 22.162499999999998 24-25 21.575 29.012500000000003 27.9125 21.5 26-27 21.212500000000002 27.55 28.3875 22.85 28-29 21.087500000000002 28.375 27.825 22.7125 30-31 21.1875 28.249999999999996 28.5625 22.0 32-33 21.075 29.312500000000004 27.1 22.5125 34-35 22.125 28.549999999999997 27.775 21.55 36-37 21.7 28.4 27.800000000000004 22.1 38-39 21.375 29.2 27.6125 21.8125 40-41 21.912499999999998 28.625 27.2625 22.2 42-43 22.0 27.437499999999996 27.800000000000004 22.7625 44-45 21.7 27.800000000000004 28.1625 22.3375 46-47 21.1125 27.575 28.95 22.3625 48-49 21.8 28.012500000000003 27.287499999999998 22.900000000000002 50-51 21.825 28.6125 27.6875 21.875 52-53 22.7375 28.449999999999996 27.400000000000002 21.4125 54-55 22.0125 27.375 29.062500000000004 21.55 56-57 21.95 27.487499999999997 28.175 22.3875 58-59 21.7875 28.5875 27.85 21.775 60-61 21.637500000000003 27.875 28.375 22.112499999999997 62-63 21.6125 28.0875 28.8375 21.462500000000002 64-65 22.14026753344168 27.21590198774847 28.441055131891485 22.202775346918365 66-67 21.775 27.962500000000002 28.3125 21.95 68-69 21.690211276409553 27.753469183647955 28.691086385798226 21.865233154144267 70-71 22.05 28.375 27.0625 22.5125 72-73 21.8625 28.8625 27.175 22.1 74-75 21.462500000000002 28.825 28.1375 21.575 76-77 22.95 27.224999999999998 27.987499999999997 21.837500000000002 78-79 21.792948237059264 27.60690172543136 28.644661165291325 21.955488872218055 80-81 21.710855427713856 28.42671335667834 27.66383191595798 22.198599299649825 82-83 22.99324831207802 27.7569392348087 28.00700175043761 21.24281070267567 84-85 21.390173771721464 28.27853481685211 28.94111763970496 21.390173771721464 86-87 22.8875 28.549999999999997 27.0 21.5625 88-89 21.7875 28.175 27.987499999999997 22.05 90-91 21.775 27.6625 28.1375 22.425 92-93 21.5625 27.85 28.325 22.2625 94-95 21.8125 28.199999999999996 28.1375 21.85 96-97 23.6625 27.075 27.925 21.337500000000002 98-99 22.3375 27.975 28.262500000000003 21.425 100-101 22.0625 28.7375 27.525 21.675 102-103 22.662499999999998 27.975 27.925 21.4375 104-105 22.4625 28.725 27.1625 21.65 106-107 22.912499999999998 29.312500000000004 26.525 21.25 108-109 22.275 28.9125 26.924999999999997 21.8875 110-111 23.075000000000003 28.999999999999996 26.737499999999997 21.1875 112-113 22.1 29.075 27.212500000000002 21.6125 114-115 22.3 29.849999999999998 26.724999999999998 21.125 116-117 22.3375 29.2875 26.85 21.525 118-119 23.2125 28.3375 27.5875 20.8625 120-121 23.175 28.125 26.387500000000003 22.3125 122-123 23.9375 28.925 26.0125 21.125 124-125 24.05 29.012500000000003 24.425 22.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 0.5 24 0.5 25 1.0 26 3.5 27 8.0 28 8.0 29 11.5 30 18.0 31 21.5 32 33.0 33 48.5 34 56.5 35 69.5 36 93.0 37 119.0 38 157.0 39 180.0 40 196.0 41 232.0 42 256.0 43 262.5 44 265.5 45 275.5 46 263.5 47 241.0 48 224.5 49 183.5 50 153.5 51 121.0 52 96.5 53 91.5 54 67.5 55 50.0 56 39.5 57 30.5 58 23.5 59 15.5 60 12.5 61 12.5 62 11.5 63 7.0 64 4.5 65 4.5 66 5.0 67 4.5 68 3.5 69 2.5 70 3.0 71 2.5 72 0.5 73 1.0 74 1.5 75 1.5 76 1.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0125 66-67 0.0 68-69 0.0125 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.025 80-81 0.05 82-83 0.025 84-85 0.0125 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.0875 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.15 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.15 0.0 0.0 0.0 0.0 40-41 0.15 0.0 0.0 0.0 0.0 42-43 0.15 0.0 0.0 0.0 0.0 44-45 0.15 0.0 0.0 0.0 0.0 46-47 0.15 0.0 0.0 0.0 0.0 48-49 0.15 0.0 0.0 0.0 0.0 50-51 0.15 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.16249999999999998 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.4375 0.0 0.0 0.0 0.0 102-103 1.9125 0.0 0.0 0.0 0.0 104-105 2.2125000000000004 0.0 0.0 0.0 0.0 106-107 2.775 0.0 0.0 0.0 0.0 108-109 3.3375 0.0 0.0 0.0 0.0 110-111 3.9875 0.0 0.0 0.0 0.0 112-113 4.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 923856 spots for SRR3208027.sra Written 923856 spots for SRR3208027.sra Read 923856 spots for SRR3208027.sra Written 923856 spots for SRR3208027.sra Read 923856 spots for SRR3208027.sra Written 923856 spots for SRR3208027.sra Read 923856 spots for SRR3208027.sra Written 923856 spots for SRR3208027.sra Read 923856 spots for SRR3208027.sra Written 923856 spots for SRR3208027.sra Read 923856 spots for SRR3208027.sra Written 923856 spots for SRR3208027.sra Read 923856 spots for SRR3208027.sra Written 923856 spots for SRR3208027.sra Read 923856 spots for SRR3208027.sra Written 923856 spots for SRR3208027.sra Read 923856 spots for SRR3208027.sra Written 923856 spots for SRR3208027.sra Read 923856 spots for SRR3208027.sra Written 923856 spots for SRR3208027.sra Read 923856 spots for SRR3208027.sra Written 923856 spots for SRR3208027.sra Read 923856 spots for SRR3208027.sra Written 923856 spots for SRR3208027.sra Read 923856 spots for SRR3208027.sra Written 923856 spots for SRR3208027.sra Read 923856 spots for SRR3208027.sra Written 923856 spots for SRR3208027.sra Read 923856 spots for SRR3208027.sra Written 923856 spots for SRR3208027.sra Read 923856 spots for SRR3208027.sra Written 923856 spots for SRR3208027.sra Read 923856 spots for SRR3208027.sra Written 923856 spots for SRR3208027.sra Read 923856 spots for SRR3208027.sra Written 923856 spots for SRR3208027.sra Read 923858 spots for SRR3208027.sra Written 923858 spots for SRR3208027.sra Read 923856 spots for SRR3208027.sra Written 923856 spots for SRR3208027.sra SRR ids: ['SRR3208027.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hrmjnn1d SRR3208027.sra spots: 18477122 blocks: [[1, 923856], [923857, 1847712], [1847713, 2771568], [2771569, 3695424], [3695425, 4619280], [4619281, 5543136], [5543137, 6466992], [6466993, 7390848], [7390849, 8314704], [8314705, 9238560], [9238561, 10162416], [10162417, 11086272], [11086273, 12010128], [12010129, 12933984], [12933985, 13857840], [13857841, 14781696], [14781697, 15705552], [15705553, 16629408], [16629409, 17553264], [17553265, 18477122]] SRR3208027 file size 5916632 SRR3208027 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208027 SRR3208027_1.fastq Input file: SRR3208027_1.fastq trimmed: SRR3208027-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 01:55:29 2025 >> started Wed Feb 12 01:55:39 2025 >> done (10.351s) 18477122 reads processed; of these: 12654 ( 0.07%) short reads filtered out after trimming by size control 60020 ( 0.32%) empty reads filtered out after trimming by size control 18404448 (99.61%) reads available; of these: 1997460 (10.85%) trimmed reads available after processing 16406988 (89.15%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 540 0.00% 19 538 0.00% 20 690 0.00% 21 575 0.00% 22 677 0.00% 23 720 0.00% 24 852 0.00% 25 1014 0.01% 26 1089 0.01% 27 968 0.01% 28 973 0.01% 29 1051 0.01% 30 1278 0.01% 31 1189 0.01% 32 894 0.00% 33 883 0.00% 34 834 0.00% 35 900 0.00% 36 927 0.01% 37 908 0.00% 38 995 0.01% 39 901 0.00% 40 905 0.00% 41 954 0.01% 42 944 0.01% 43 967 0.01% 44 938 0.01% 45 965 0.01% 46 1059 0.01% 47 998 0.01% 48 1100 0.01% 49 1058 0.01% 50 1160 0.01% 51 1118 0.01% 52 1095 0.01% 53 1141 0.01% 54 1162 0.01% 55 1210 0.01% 56 1253 0.01% 57 1353 0.01% 58 1325 0.01% 59 1437 0.01% 60 1475 0.01% 61 1498 0.01% 62 1629 0.01% 63 1488 0.01% 64 1599 0.01% 65 1661 0.01% 66 1662 0.01% 67 1682 0.01% 68 1731 0.01% 69 1929 0.01% 70 1930 0.01% 71 2024 0.01% 72 2254 0.01% 73 2295 0.01% 74 2460 0.01% 75 2676 0.01% 76 2868 0.02% 77 2882 0.02% 78 2915 0.02% 79 3335 0.02% 80 3592 0.02% 81 4047 0.02% 82 4477 0.02% 83 4744 0.03% 84 5314 0.03% 85 5795 0.03% 86 6263 0.03% 87 6828 0.04% 88 7556 0.04% 89 8634 0.05% 90 9895 0.05% 91 11502 0.06% 92 13210 0.07% 93 14868 0.08% 94 2680 0.01% 95 2818 0.02% 96 3038 0.02% 97 3051 0.02% 98 3380 0.02% 99 3589 0.02% 100 3803 0.02% 101 4385 0.02% 102 4620 0.03% 103 4958 0.03% 104 4425 0.02% 105 4992 0.03% 106 5078 0.03% 107 5488 0.03% 108 6083 0.03% 109 6831 0.04% 110 7478 0.04% 111 8525 0.05% 112 9645 0.05% 113 10963 0.06% 114 12842 0.07% 115 14582 0.08% 116 17329 0.09% 117 20883 0.11% 118 26674 0.14% 119 34506 0.19% 120 46344 0.25% 121 64795 0.35% 122 106391 0.58% 123 231540 1.26% 124 1125488 6.12% 125 16406988 89.15% 18404448 reads passed initial QC criterion=sequence-density sequence-density=4.01 sequence-density-rank=1 fanout-score=52.03 fanout-score-rank=1 prefix-density=5.52 prefix-fanout=37.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=fanout-score sequence-density=4.01 sequence-density-rank=1 fanout-score=52.03 fanout-score-rank=1 prefix-density=5.52 prefix-fanout=37.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAA -o SRR3208027 - Input file: STDIN trimmed: SRR3208027-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 01:56:32 2025 >> started Wed Feb 12 01:56:44 2025 >> done (12.224s) 11042669 reads processed; of these: 154 ( 0.00%) short reads filtered out after trimming by size control 705 ( 0.01%) empty reads filtered out after trimming by size control 11041810 (99.99%) reads available; of these: 1409344 (12.76%) trimmed reads available after processing 9632466 (87.24%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 334 0.00% 19 327 0.00% 20 434 0.00% 21 366 0.00% 22 418 0.00% 23 432 0.00% 24 511 0.00% 25 596 0.01% 26 718 0.01% 27 573 0.01% 28 582 0.01% 29 626 0.01% 30 800 0.01% 31 740 0.01% 32 563 0.01% 33 523 0.00% 34 496 0.00% 35 533 0.00% 36 566 0.01% 37 565 0.01% 38 595 0.01% 39 548 0.00% 40 554 0.01% 41 582 0.01% 42 604 0.01% 43 585 0.01% 44 591 0.01% 45 589 0.01% 46 645 0.01% 47 617 0.01% 48 663 0.01% 49 627 0.01% 50 721 0.01% 51 693 0.01% 52 649 0.01% 53 669 0.01% 54 717 0.01% 55 708 0.01% 56 718 0.01% 57 843 0.01% 58 775 0.01% 59 856 0.01% 60 884 0.01% 61 911 0.01% 62 1000 0.01% 63 893 0.01% 64 953 0.01% 65 954 0.01% 66 960 0.01% 67 1003 0.01% 68 1076 0.01% 69 1153 0.01% 70 1156 0.01% 71 1210 0.01% 72 1346 0.01% 73 1388 0.01% 74 1450 0.01% 75 1470 0.01% 76 1541 0.01% 77 1636 0.01% 78 1738 0.02% 79 1993 0.02% 80 2148 0.02% 81 2452 0.02% 82 2689 0.02% 83 2830 0.03% 84 3239 0.03% 85 3521 0.03% 86 3781 0.03% 87 4087 0.04% 88 4546 0.04% 89 5193 0.05% 90 5933 0.05% 91 6813 0.06% 92 7818 0.07% 93 9017 0.08% 94 10210 0.09% 95 11085 0.10% 96 12071 0.11% 97 12975 0.12% 98 14533 0.13% 99 16365 0.15% 100 18726 0.17% 101 21187 0.19% 102 24228 0.22% 103 27781 0.25% 104 29756 0.27% 105 31996 0.29% 106 33314 0.30% 107 35278 0.32% 108 37659 0.34% 109 41083 0.37% 110 44933 0.41% 111 49411 0.45% 112 55591 0.50% 113 60062 0.54% 114 65850 0.60% 115 69115 0.63% 116 72448 0.66% 117 75837 0.69% 118 81019 0.73% 119 89970 0.81% 120 110823 1.00% 121 164051 1.49% 122 340153 3.08% 123 125293 1.13% 124 609763 5.52% 125 8535210 77.30% criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=43 prefix-density=0.08 prefix-fanout=1.9 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=16 fanout-score=297.70 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=29.1 sequence=CTTCTTCTTCTT Started job on | Feb 12 01:57:27 Started mapping on | Feb 12 01:57:27 Finished on | Feb 12 01:57:51 Mapping speed, Million of reads per hour | 2760.54 Number of input reads | 18403589 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 17286179 Uniquely mapped reads % | 93.93% Average mapped length | 122.65 Number of splices: Total | 6484570 Number of splices: Annotated (sjdb) | 6362120 Number of splices: GT/AG | 6384323 Number of splices: GC/AG | 81975 Number of splices: AT/AC | 6615 Number of splices: Non-canonical | 11657 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.12 Insertion rate per base | 0.02% Insertion average length | 1.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 380126 % of reads mapped to multiple loci | 2.07% Number of reads mapped to too many loci | 422646 % of reads mapped to too many loci | 2.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.70% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 737284 737284 737284 N_multimapping 380126 380126 380126 N_noFeature 685328 8924290 8932243 N_ambiguous 177643 31200 31774 UnstrandedReadsAssigned:16423208 PositiveStrandReadsAssigned:8330689 NegativeStrandReadsAssigned:8322162 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208027 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208027-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,403,589 reads, 17,118,961 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR3208027.ke.tsv 34699 SRR3208027.se.tsv 87100 total ==> SRR3208027.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 506 21.4236 Potri.005G024800.1.v4.1 1035 936 111 9.63527 Potri.004G059700.1.v4.1 961 862 21 1.97938 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 302.095 8.6304 Potri.016G087400.1.v4.1 270 171 832 395.316 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 53 2.57239 Potri.012G127500.1.v4.1 977 878 3172 293.532 ==> SRR3208027.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1967 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 298 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 24 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR3208027 completed mapping pipeline successfully