Starting /dee2/code/volunteer_pipeline.sh SRR3208028 current disk space = 3049216405504 free memory = 1579566048 SRR3208028 SRAfilesize 9d858699cb97978b4871ae8b40295928 SRR3208028.sra SRR3208028.sra file validated SRR3208028 is single end SRR3208028 is conventional basespace SRR3208028 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208028_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4135 33.0 33.0 33.0 33.0 33.0 2 32.14925 33.0 33.0 33.0 33.0 33.0 3 32.0145 33.0 33.0 33.0 33.0 33.0 4 32.20625 33.0 33.0 33.0 33.0 33.0 5 32.311 33.0 33.0 33.0 33.0 33.0 6 35.9275 37.0 37.0 37.0 37.0 37.0 7 36.18075 37.0 37.0 37.0 37.0 37.0 8 36.1935 37.0 37.0 37.0 37.0 37.0 9 36.17325 37.0 37.0 37.0 37.0 37.0 10-11 36.157 37.0 37.0 37.0 37.0 37.0 12-13 36.21925 37.0 37.0 37.0 37.0 37.0 14-15 36.144375 37.0 37.0 37.0 37.0 37.0 16-17 36.194500000000005 37.0 37.0 37.0 37.0 37.0 18-19 36.221625 37.0 37.0 37.0 37.0 37.0 20-21 36.210750000000004 37.0 37.0 37.0 37.0 37.0 22-23 36.15475 37.0 37.0 37.0 37.0 37.0 24-25 36.138999999999996 37.0 37.0 37.0 37.0 37.0 26-27 35.897875 37.0 37.0 37.0 37.0 37.0 28-29 36.097624999999994 37.0 37.0 37.0 37.0 37.0 30-31 36.112375 37.0 37.0 37.0 37.0 37.0 32-33 36.154875000000004 37.0 37.0 37.0 37.0 37.0 34-35 36.174499999999995 37.0 37.0 37.0 37.0 37.0 36-37 36.154375 37.0 37.0 37.0 37.0 37.0 38-39 36.155125 37.0 37.0 37.0 37.0 37.0 40-41 36.130624999999995 37.0 37.0 37.0 37.0 37.0 42-43 36.148875000000004 37.0 37.0 37.0 37.0 37.0 44-45 36.101375000000004 37.0 37.0 37.0 37.0 37.0 46-47 36.123625 37.0 37.0 37.0 37.0 37.0 48-49 36.17225 37.0 37.0 37.0 37.0 37.0 50-51 36.242625000000004 37.0 37.0 37.0 37.0 37.0 52-53 36.09425 37.0 37.0 37.0 37.0 37.0 54-55 36.12175 37.0 37.0 37.0 37.0 37.0 56-57 36.14775 37.0 37.0 37.0 37.0 37.0 58-59 36.107 37.0 37.0 37.0 37.0 37.0 60-61 36.1155 37.0 37.0 37.0 37.0 37.0 62-63 36.117625000000004 37.0 37.0 37.0 37.0 37.0 64-65 36.135125 37.0 37.0 37.0 37.0 37.0 66-67 36.145125 37.0 37.0 37.0 37.0 37.0 68-69 36.1315 37.0 37.0 37.0 37.0 37.0 70-71 36.1325 37.0 37.0 37.0 37.0 37.0 72-73 36.111000000000004 37.0 37.0 37.0 37.0 37.0 74-75 36.08 37.0 37.0 37.0 37.0 37.0 76-77 35.997249999999994 37.0 37.0 37.0 37.0 37.0 78-79 35.969875 37.0 37.0 37.0 37.0 37.0 80-81 35.866875 37.0 37.0 37.0 37.0 37.0 82-83 35.93675 37.0 37.0 37.0 37.0 37.0 84-85 35.906875 37.0 37.0 37.0 37.0 37.0 86-87 35.96275 37.0 37.0 37.0 37.0 37.0 88-89 35.912875 37.0 37.0 37.0 37.0 37.0 90-91 35.906625000000005 37.0 37.0 37.0 37.0 37.0 92-93 35.835875 37.0 37.0 37.0 37.0 37.0 94-95 35.75175 37.0 37.0 37.0 37.0 37.0 96-97 35.716499999999996 37.0 37.0 37.0 37.0 37.0 98-99 35.733625 37.0 37.0 37.0 37.0 37.0 100-101 35.752375 37.0 37.0 37.0 37.0 37.0 102-103 35.65925 37.0 37.0 37.0 37.0 37.0 104-105 35.653 37.0 37.0 37.0 37.0 37.0 106-107 35.621375 37.0 37.0 37.0 37.0 37.0 108-109 35.676375 37.0 37.0 37.0 37.0 37.0 110-111 35.60125 37.0 37.0 37.0 37.0 37.0 112-113 35.701375 37.0 37.0 37.0 37.0 37.0 114-115 35.584 37.0 37.0 37.0 37.0 37.0 116-117 35.570875 37.0 37.0 37.0 37.0 37.0 118-119 35.480375 37.0 37.0 37.0 35.0 37.0 120-121 35.439125000000004 37.0 37.0 37.0 37.0 37.0 122-123 35.40275 37.0 37.0 37.0 37.0 37.0 124-125 33.867999999999995 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 3.0 4 0.0 5 2.0 6 1.0 7 1.0 8 0.0 9 2.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 1.0 16 2.0 17 1.0 18 0.0 19 1.0 20 3.0 21 4.0 22 7.0 23 5.0 24 6.0 25 10.0 26 8.0 27 10.0 28 20.0 29 25.0 30 37.0 31 59.0 32 61.0 33 88.0 34 137.0 35 259.0 36 3225.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.20795892169448 14.762516046213095 13.632862644415919 49.39666238767651 2 19.05 20.599999999999998 40.475 19.875 3 21.325 24.975 27.650000000000002 26.05 4 22.7 31.45 22.15 23.7 5 25.474999999999998 33.2 23.225 18.099999999999998 6 19.825 36.3 24.7 19.175 7 17.8 19.2 43.05 19.950000000000003 8 19.975 24.95 29.475 25.6 9 20.175 23.175 32.15 24.5 10-11 23.150000000000002 33.1625 22.05 21.637500000000003 12-13 20.974999999999998 26.7625 29.75 22.5125 14-15 21.45 27.825 27.737499999999997 22.9875 16-17 21.762500000000003 28.0625 28.037499999999998 22.1375 18-19 22.0625 27.9375 27.650000000000002 22.35 20-21 22.3 28.3875 27.450000000000003 21.8625 22-23 23.275000000000002 28.799999999999997 25.8125 22.112499999999997 24-25 20.7625 28.512500000000003 28.262500000000003 22.4625 26-27 21.475 28.5625 27.8125 22.15 28-29 21.2875 28.725 27.825 22.162499999999998 30-31 21.3875 28.6125 27.5125 22.4875 32-33 21.6875 29.7 26.087500000000002 22.525000000000002 34-35 23.1375 27.962500000000002 26.974999999999998 21.925 36-37 21.825 28.4 27.800000000000004 21.975 38-39 22.0125 28.1125 27.6375 22.237499999999997 40-41 22.0125 28.212500000000002 27.85 21.925 42-43 22.0 28.799999999999997 27.6375 21.5625 44-45 21.925 27.712500000000002 28.225 22.1375 46-47 22.425 27.8125 27.9125 21.85 48-49 22.1 27.9125 27.6375 22.35 50-51 21.1375 27.762500000000003 28.5875 22.5125 52-53 22.425 28.299999999999997 27.737499999999997 21.5375 54-55 21.325 28.3625 27.8625 22.45 56-57 21.462500000000002 28.6625 28.0875 21.7875 58-59 21.25 28.275 28.449999999999996 22.025 60-61 21.512500000000003 27.525 28.537499999999998 22.425 62-63 21.825 28.749999999999996 27.9375 21.4875 64-65 22.06525815726966 27.365920740092513 28.028503562945367 22.540317539692463 66-67 21.9375 27.6375 28.15 22.275 68-69 21.265158144768094 28.403550443805475 28.378547318414803 21.952744093011624 70-71 21.9375 28.625 27.9125 21.525 72-73 21.75 27.237499999999997 28.875 22.1375 74-75 22.525000000000002 28.075 28.262500000000003 21.1375 76-77 22.287499999999998 29.225 26.5 21.987499999999997 78-79 21.9777472184023 28.22852856607076 27.778472309038634 22.015251906488313 80-81 22.048524262131068 28.12656328164082 27.738869434717362 22.086043021510758 82-83 22.355588897224308 28.032008002000502 28.044511127781945 21.567891972993248 84-85 22.26528316039505 28.053506688336043 27.86598324790599 21.81522690336292 86-87 22.1375 28.95 27.800000000000004 21.1125 88-89 22.1375 28.787499999999998 27.425 21.65 90-91 22.225 28.1375 27.675 21.9625 92-93 22.3 27.825 28.449999999999996 21.425 94-95 20.95 28.3875 28.6625 22.0 96-97 21.4375 27.987499999999997 28.3875 22.1875 98-99 23.150000000000002 27.625 27.625 21.6 100-101 22.3875 28.000000000000004 27.9125 21.7 102-103 22.3375 28.625 27.625 21.4125 104-105 21.95 28.487499999999997 28.425 21.1375 106-107 22.7125 27.700000000000003 28.125 21.462500000000002 108-109 22.3375 27.950000000000003 27.725 21.987499999999997 110-111 22.475 27.737499999999997 28.175 21.6125 112-113 22.75 28.849999999999998 27.487499999999997 20.9125 114-115 21.6875 29.037499999999998 27.325 21.95 116-117 23.3625 28.6625 26.0375 21.9375 118-119 23.4625 28.4375 26.1 22.0 120-121 23.4625 27.500000000000004 26.700000000000003 22.3375 122-123 23.4375 28.925 26.224999999999998 21.4125 124-125 23.400000000000002 29.312500000000004 25.5625 21.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 2.0 24 3.0 25 4.5 26 5.5 27 9.5 28 9.5 29 12.5 30 25.0 31 29.5 32 34.0 33 45.0 34 59.5 35 70.5 36 88.0 37 115.5 38 137.5 39 147.5 40 192.5 41 242.0 42 233.0 43 236.5 44 272.5 45 293.0 46 283.5 47 234.0 48 198.0 49 189.0 50 160.5 51 143.0 52 113.5 53 85.0 54 71.5 55 55.5 56 42.0 57 27.0 58 22.5 59 19.5 60 14.5 61 14.0 62 12.5 63 8.5 64 8.5 65 5.0 66 1.0 67 2.5 68 4.5 69 4.0 70 3.0 71 1.5 72 0.0 73 0.5 74 1.5 75 2.0 76 1.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0125 66-67 0.0 68-69 0.0125 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0125 80-81 0.05 82-83 0.025 84-85 0.0125 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77403966859151 99.35000000000001 2 0.17574692442882248 0.35000000000000003 3 0.0 0.0 4 0.025106703489831784 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025106703489831784 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTAT 8 0.2 TruSeq Adapter, Index 14 (97% over 44bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10-11 0.125 0.0 0.0 0.0 0.0 12-13 0.125 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.125 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.6000000000000001 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.2875 0.0 0.0 0.0 0.0 102-103 1.875 0.0 0.0 0.0 0.0 104-105 2.3875 0.0 0.0 0.0 0.0 106-107 2.925 0.0 0.0 0.0 0.0 108-109 3.725 0.0 0.0 0.0 0.0 110-111 4.4875 0.0 0.0 0.0 0.0 112-113 5.362500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATATGGA 15 0.004088022 59.4875 64-65 >>END_MODULE Read 1061797 spots for SRR3208028.sra Written 1061797 spots for SRR3208028.sra Read 1061797 spots for SRR3208028.sra Written 1061797 spots for SRR3208028.sra Read 1061797 spots for SRR3208028.sra Written 1061797 spots for SRR3208028.sra Read 1061797 spots for SRR3208028.sra Written 1061797 spots for SRR3208028.sra Read 1061797 spots for SRR3208028.sra Written 1061797 spots for SRR3208028.sra Read 1061797 spots for SRR3208028.sra Written 1061797 spots for SRR3208028.sra Read 1061797 spots for SRR3208028.sra Written 1061797 spots for SRR3208028.sra Read 1061797 spots for SRR3208028.sra Written 1061797 spots for SRR3208028.sra Read 1061797 spots for SRR3208028.sra Written 1061797 spots for SRR3208028.sra Read 1061797 spots for SRR3208028.sra Written 1061797 spots for SRR3208028.sra Read 1061797 spots for SRR3208028.sra Written 1061797 spots for SRR3208028.sra Read 1061797 spots for SRR3208028.sra Written 1061797 spots for SRR3208028.sra Read 1061797 spots for SRR3208028.sra Written 1061797 spots for SRR3208028.sra Read 1061798 spots for SRR3208028.sra Written 1061798 spots for SRR3208028.sra Read 1061797 spots for SRR3208028.sra Written 1061797 spots for SRR3208028.sra Read 1061797 spots for SRR3208028.sra Written 1061797 spots for SRR3208028.sra Read 1061797 spots for SRR3208028.sra Written 1061797 spots for SRR3208028.sra Read 1061797 spots for SRR3208028.sra Written 1061797 spots for SRR3208028.sra Read 1061797 spots for SRR3208028.sra Written 1061797 spots for SRR3208028.sra Read 1061797 spots for SRR3208028.sra Written 1061797 spots for SRR3208028.sra SRR ids: ['SRR3208028.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z6rwsdhg SRR3208028.sra spots: 21235941 blocks: [[1, 1061797], [1061798, 2123594], [2123595, 3185391], [3185392, 4247188], [4247189, 5308985], [5308986, 6370782], [6370783, 7432579], [7432580, 8494376], [8494377, 9556173], [9556174, 10617970], [10617971, 11679767], [11679768, 12741564], [12741565, 13803361], [13803362, 14865158], [14865159, 15926955], [15926956, 16988752], [16988753, 18050549], [18050550, 19112346], [19112347, 20174143], [20174144, 21235941]] SRR3208028 file size 6801661 SRR3208028 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208028 SRR3208028_1.fastq Input file: SRR3208028_1.fastq trimmed: SRR3208028-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 02:34:01 2025 >> started Wed Feb 12 02:34:16 2025 >> done (15.739s) 21235941 reads processed; of these: 14931 ( 0.07%) short reads filtered out after trimming by size control 104491 ( 0.49%) empty reads filtered out after trimming by size control 21116519 (99.44%) reads available; of these: 2361818 (11.18%) trimmed reads available after processing 18754701 (88.82%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 635 0.00% 19 662 0.00% 20 1079 0.01% 21 769 0.00% 22 817 0.00% 23 924 0.00% 24 1099 0.01% 25 1229 0.01% 26 1197 0.01% 27 1088 0.01% 28 1251 0.01% 29 1306 0.01% 30 1734 0.01% 31 1768 0.01% 32 1159 0.01% 33 1041 0.00% 34 1071 0.01% 35 1124 0.01% 36 1136 0.01% 37 1097 0.01% 38 1126 0.01% 39 1166 0.01% 40 1210 0.01% 41 1145 0.01% 42 1160 0.01% 43 1172 0.01% 44 1242 0.01% 45 1229 0.01% 46 1195 0.01% 47 1274 0.01% 48 1235 0.01% 49 1371 0.01% 50 1390 0.01% 51 1432 0.01% 52 1360 0.01% 53 1487 0.01% 54 1497 0.01% 55 1576 0.01% 56 1623 0.01% 57 1571 0.01% 58 1682 0.01% 59 1723 0.01% 60 1828 0.01% 61 1907 0.01% 62 2023 0.01% 63 1991 0.01% 64 2032 0.01% 65 2342 0.01% 66 2174 0.01% 67 2028 0.01% 68 2222 0.01% 69 2436 0.01% 70 2424 0.01% 71 2709 0.01% 72 2738 0.01% 73 2908 0.01% 74 3236 0.02% 75 3543 0.02% 76 4096 0.02% 77 3683 0.02% 78 3777 0.02% 79 4273 0.02% 80 4569 0.02% 81 5125 0.02% 82 5772 0.03% 83 6283 0.03% 84 6840 0.03% 85 7598 0.04% 86 8117 0.04% 87 8536 0.04% 88 9883 0.05% 89 11147 0.05% 90 12800 0.06% 91 14750 0.07% 92 16780 0.08% 93 18773 0.09% 94 3396 0.02% 95 3390 0.02% 96 3643 0.02% 97 3833 0.02% 98 4026 0.02% 99 4288 0.02% 100 4604 0.02% 101 5371 0.03% 102 5335 0.03% 103 5786 0.03% 104 5511 0.03% 105 5746 0.03% 106 6240 0.03% 107 6722 0.03% 108 7461 0.04% 109 8165 0.04% 110 9091 0.04% 111 10273 0.05% 112 11701 0.06% 113 13253 0.06% 114 15141 0.07% 115 17932 0.08% 116 20558 0.10% 117 25015 0.12% 118 31416 0.15% 119 41295 0.20% 120 54950 0.26% 121 76203 0.36% 122 125323 0.59% 123 271882 1.29% 124 1310873 6.21% 125 18754701 88.82% 21116519 reads passed initial QC criterion=sequence-density sequence-density=4.47 sequence-density-rank=1 fanout-score=50.27 fanout-score-rank=1 prefix-density=6.10 prefix-fanout=36.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=4.47 sequence-density-rank=1 fanout-score=50.27 fanout-score-rank=1 prefix-density=6.10 prefix-fanout=36.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAA -o SRR3208028 - Input file: STDIN trimmed: SRR3208028-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 02:35:04 2025 >> started Wed Feb 12 02:35:17 2025 >> done (13.098s) 12669912 reads processed; of these: 139 ( 0.00%) short reads filtered out after trimming by size control 1585 ( 0.01%) empty reads filtered out after trimming by size control 12668188 (99.99%) reads available; of these: 1741090 (13.74%) trimmed reads available after processing 10927098 (86.26%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 384 0.00% 19 404 0.00% 20 702 0.01% 21 475 0.00% 22 497 0.00% 23 562 0.00% 24 673 0.01% 25 728 0.01% 26 738 0.01% 27 654 0.01% 28 745 0.01% 29 762 0.01% 30 1012 0.01% 31 1072 0.01% 32 697 0.01% 33 626 0.00% 34 640 0.01% 35 684 0.01% 36 662 0.01% 37 617 0.00% 38 693 0.01% 39 713 0.01% 40 719 0.01% 41 699 0.01% 42 717 0.01% 43 727 0.01% 44 712 0.01% 45 731 0.01% 46 693 0.01% 47 769 0.01% 48 764 0.01% 49 825 0.01% 50 855 0.01% 51 838 0.01% 52 801 0.01% 53 865 0.01% 54 921 0.01% 55 946 0.01% 56 976 0.01% 57 931 0.01% 58 999 0.01% 59 1066 0.01% 60 1070 0.01% 61 1152 0.01% 62 1218 0.01% 63 1202 0.01% 64 1206 0.01% 65 1249 0.01% 66 1272 0.01% 67 1236 0.01% 68 1336 0.01% 69 1450 0.01% 70 1460 0.01% 71 1593 0.01% 72 1664 0.01% 73 1728 0.01% 74 1819 0.01% 75 1805 0.01% 76 2012 0.02% 77 2085 0.02% 78 2239 0.02% 79 2615 0.02% 80 2771 0.02% 81 3107 0.02% 82 3492 0.03% 83 3699 0.03% 84 4074 0.03% 85 4539 0.04% 86 4860 0.04% 87 5230 0.04% 88 6037 0.05% 89 6768 0.05% 90 7659 0.06% 91 8784 0.07% 92 10049 0.08% 93 11361 0.09% 94 12988 0.10% 95 14391 0.11% 96 15357 0.12% 97 16579 0.13% 98 18638 0.15% 99 20832 0.16% 100 23736 0.19% 101 27354 0.22% 102 30786 0.24% 103 35050 0.28% 104 37709 0.30% 105 40477 0.32% 106 42392 0.33% 107 45290 0.36% 108 48002 0.38% 109 52123 0.41% 110 57551 0.45% 111 63043 0.50% 112 69638 0.55% 113 76182 0.60% 114 81830 0.65% 115 86820 0.69% 116 90557 0.71% 117 94060 0.74% 118 99762 0.79% 119 109902 0.87% 120 135169 1.07% 121 193510 1.53% 122 395414 3.12% 123 145689 1.15% 124 700049 5.53% 125 9642173 76.11% criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=4.77 fanout-score-rank=19 prefix-density=0.13 prefix-fanout=3.1 sequence=TTCAACCAAGCGCG criterion=fanout-score sequence-density=0.05 sequence-density-rank=10 fanout-score=231.61 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=25.4 sequence=AAGAAGAAGAAA Started job on | Feb 12 02:35:45 Started mapping on | Feb 12 02:35:45 Finished on | Feb 12 02:36:20 Mapping speed, Million of reads per hour | 2171.81 Number of input reads | 21114795 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 19311332 Uniquely mapped reads % | 91.46% Average mapped length | 122.50 Number of splices: Total | 7050749 Number of splices: Annotated (sjdb) | 6914715 Number of splices: GT/AG | 6941625 Number of splices: GC/AG | 88279 Number of splices: AT/AC | 7489 Number of splices: Non-canonical | 13356 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.15 Insertion rate per base | 0.02% Insertion average length | 1.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 437352 % of reads mapped to multiple loci | 2.07% Number of reads mapped to too many loci | 802711 % of reads mapped to too many loci | 3.80% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.66% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1366111 1366111 1366111 N_multimapping 437352 437352 437352 N_noFeature 765996 9962523 9972119 N_ambiguous 210393 33826 34264 UnstrandedReadsAssigned:18334943 PositiveStrandReadsAssigned:9314983 NegativeStrandReadsAssigned:9304949 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208028 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208028-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,114,795 reads, 19,414,469 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,126 rounds 52401 SRR3208028.ke.tsv 34699 SRR3208028.se.tsv 87100 total ==> SRR3208028.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 529 18.8487 Potri.005G024800.1.v4.1 1035 936 148 10.8115 Potri.004G059700.1.v4.1 961 862 47 3.72813 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 344.277 8.27711 Potri.016G087400.1.v4.1 270 171 915 365.869 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 78 3.18596 Potri.012G127500.1.v4.1 977 878 4192 326.458 ==> SRR3208028.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1956 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 410 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 43 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR3208028 completed mapping pipeline successfully