Starting /dee2/code/volunteer_pipeline.sh SRR3208029 current disk space = 3049778679808 free memory = 1470933196 SRR3208029 SRAfilesize c419dc7f3f70c0d4577070729a81cb1f SRR3208029.sra SRR3208029.sra file validated SRR3208029 is single end SRR3208029 is conventional basespace SRR3208029 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208029_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.81125 33.0 33.0 33.0 33.0 33.0 2 32.12725 33.0 33.0 33.0 33.0 33.0 3 32.145 33.0 33.0 33.0 33.0 33.0 4 32.281 33.0 33.0 33.0 33.0 33.0 5 32.27625 33.0 33.0 33.0 33.0 33.0 6 35.94525 37.0 37.0 37.0 37.0 37.0 7 36.05425 37.0 37.0 37.0 37.0 37.0 8 36.08925 37.0 37.0 37.0 37.0 37.0 9 36.14275 37.0 37.0 37.0 37.0 37.0 10-11 36.077875 37.0 37.0 37.0 37.0 37.0 12-13 36.16925 37.0 37.0 37.0 37.0 37.0 14-15 36.10724999999999 37.0 37.0 37.0 37.0 37.0 16-17 36.086375000000004 37.0 37.0 37.0 37.0 37.0 18-19 36.163 37.0 37.0 37.0 37.0 37.0 20-21 36.11725 37.0 37.0 37.0 37.0 37.0 22-23 36.10175 37.0 37.0 37.0 37.0 37.0 24-25 36.06925 37.0 37.0 37.0 37.0 37.0 26-27 35.945499999999996 37.0 37.0 37.0 37.0 37.0 28-29 36.08125 37.0 37.0 37.0 37.0 37.0 30-31 36.11925 37.0 37.0 37.0 37.0 37.0 32-33 36.08025 37.0 37.0 37.0 37.0 37.0 34-35 36.106125000000006 37.0 37.0 37.0 37.0 37.0 36-37 36.1215 37.0 37.0 37.0 37.0 37.0 38-39 36.144999999999996 37.0 37.0 37.0 37.0 37.0 40-41 36.12575 37.0 37.0 37.0 37.0 37.0 42-43 36.138374999999996 37.0 37.0 37.0 37.0 37.0 44-45 36.141375 37.0 37.0 37.0 37.0 37.0 46-47 36.191625 37.0 37.0 37.0 37.0 37.0 48-49 36.1435 37.0 37.0 37.0 37.0 37.0 50-51 36.111625000000004 37.0 37.0 37.0 37.0 37.0 52-53 36.062 37.0 37.0 37.0 37.0 37.0 54-55 36.095875 37.0 37.0 37.0 37.0 37.0 56-57 36.089625 37.0 37.0 37.0 37.0 37.0 58-59 36.024125 37.0 37.0 37.0 37.0 37.0 60-61 36.09425 37.0 37.0 37.0 37.0 37.0 62-63 36.049875 37.0 37.0 37.0 37.0 37.0 64-65 36.040375 37.0 37.0 37.0 37.0 37.0 66-67 35.958 37.0 37.0 37.0 37.0 37.0 68-69 35.94775 37.0 37.0 37.0 37.0 37.0 70-71 35.83325 37.0 37.0 37.0 37.0 37.0 72-73 35.794375 37.0 37.0 37.0 37.0 37.0 74-75 35.79325 37.0 37.0 37.0 37.0 37.0 76-77 35.420625 37.0 37.0 37.0 37.0 37.0 78-79 35.322 37.0 37.0 37.0 37.0 37.0 80-81 35.343 37.0 37.0 37.0 37.0 37.0 82-83 35.32875 37.0 37.0 37.0 37.0 37.0 84-85 35.351625 37.0 37.0 37.0 37.0 37.0 86-87 35.368624999999994 37.0 37.0 37.0 37.0 37.0 88-89 35.30575 37.0 37.0 37.0 37.0 37.0 90-91 35.27375 37.0 37.0 37.0 37.0 37.0 92-93 35.222375 37.0 37.0 37.0 37.0 37.0 94-95 35.245625000000004 37.0 37.0 37.0 37.0 37.0 96-97 35.14125 37.0 37.0 37.0 37.0 37.0 98-99 35.259375000000006 37.0 37.0 37.0 37.0 37.0 100-101 35.241125 37.0 37.0 37.0 37.0 37.0 102-103 35.200500000000005 37.0 37.0 37.0 35.0 37.0 104-105 35.244375 37.0 37.0 37.0 37.0 37.0 106-107 35.16875 37.0 37.0 37.0 35.0 37.0 108-109 35.1315 37.0 37.0 37.0 33.0 37.0 110-111 35.064625 37.0 37.0 37.0 33.0 37.0 112-113 35.06225 37.0 37.0 37.0 33.0 37.0 114-115 35.02525 37.0 37.0 37.0 33.0 37.0 116-117 35.02275 37.0 37.0 37.0 33.0 37.0 118-119 34.948375 37.0 37.0 37.0 33.0 37.0 120-121 34.904624999999996 37.0 37.0 37.0 33.0 37.0 122-123 34.718999999999994 37.0 37.0 37.0 33.0 37.0 124-125 33.410124999999994 37.0 35.0 37.0 17.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 32.0 3 1.0 4 1.0 5 0.0 6 3.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 4.0 14 1.0 15 1.0 16 5.0 17 2.0 18 8.0 19 5.0 20 10.0 21 6.0 22 31.0 23 14.0 24 3.0 25 6.0 26 7.0 27 13.0 28 23.0 29 25.0 30 32.0 31 47.0 32 56.0 33 76.0 34 131.0 35 257.0 36 3199.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.222503160556258 15.27180783817952 15.52465233881163 44.98103666245259 2 19.55 22.8 37.075 20.575 3 20.75 25.224999999999998 28.599999999999998 25.424999999999997 4 23.525 29.2 21.475 25.8 5 26.075 32.725 22.85 18.35 6 21.0 36.125 23.45 19.425 7 18.525 20.4 41.775 19.3 8 18.65 24.474999999999998 30.975 25.900000000000002 9 22.05 22.85 31.624999999999996 23.474999999999998 10-11 23.05 34.0875 22.0 20.8625 12-13 21.05 27.275 28.225 23.45 14-15 20.724999999999998 27.962500000000002 28.487499999999997 22.825 16-17 22.725 27.450000000000003 26.887499999999996 22.9375 18-19 21.349999999999998 28.487499999999997 27.1375 23.025000000000002 20-21 21.7 28.249999999999996 27.675 22.375 22-23 21.4375 29.8875 26.5625 22.112499999999997 24-25 21.675 27.275 28.462500000000002 22.5875 26-27 19.825 27.675 28.1875 24.3125 28-29 22.1 28.5625 27.6125 21.725 30-31 21.05 27.4125 29.025000000000002 22.5125 32-33 19.7375 28.712500000000002 27.462500000000002 24.087500000000002 34-35 20.4625 28.237499999999997 28.287499999999998 23.0125 36-37 22.3125 26.200000000000003 28.95 22.537499999999998 38-39 21.3625 28.287499999999998 27.6625 22.6875 40-41 22.400000000000002 29.425 25.8 22.375 42-43 21.875 28.275 28.449999999999996 21.4 44-45 21.3125 27.925 27.925 22.8375 46-47 22.4625 27.55 27.1 22.8875 48-49 20.8125 29.1375 28.212500000000002 21.837500000000002 50-51 21.925 29.15 27.500000000000004 21.425 52-53 21.637500000000003 27.775 27.487499999999997 23.1 54-55 23.5375 27.212500000000002 27.675 21.575 56-57 21.625 28.287499999999998 27.6125 22.475 58-59 21.8125 28.212500000000002 28.199999999999996 21.775 60-61 22.35 27.8375 27.237499999999997 22.575 62-63 21.3875 27.275 28.175 23.1625 64-65 22.490311288911112 27.278409801225152 28.216027003375423 22.015251906488313 66-67 21.587500000000002 29.95 27.1625 21.3 68-69 21.152644080510065 29.641205150643827 28.166020752594072 21.040130016252032 70-71 21.575 29.5 27.650000000000002 21.275 72-73 22.125 29.349999999999998 27.037499999999998 21.4875 74-75 22.0 29.762499999999996 26.974999999999998 21.2625 76-77 22.052756594574323 29.353669208651077 27.078384798099762 21.515189398674835 78-79 22.2430607651913 28.469617404351087 27.481870467616904 21.80545136284071 80-81 21.92346173086543 28.83941970985493 28.01400700350175 21.223111555777887 82-83 21.605401350337583 28.644661165291325 27.53188297074269 22.218054513628406 84-85 21.715214401800225 28.42855356919615 28.403550443805475 21.45268158519815 86-87 22.35 28.449999999999996 27.8125 21.3875 88-89 22.45 27.950000000000003 27.900000000000002 21.7 90-91 22.55 28.212500000000002 27.825 21.4125 92-93 21.1125 28.3875 27.9125 22.5875 94-95 22.900000000000002 29.012500000000003 26.2625 21.825 96-97 22.2 27.1 28.1875 22.5125 98-99 23.1875 28.225 27.450000000000003 21.1375 100-101 23.0125 27.900000000000002 28.3625 20.724999999999998 102-103 23.4375 27.800000000000004 27.5875 21.175 104-105 22.7 28.012500000000003 27.175 22.112499999999997 106-107 23.1125 28.787499999999998 26.2875 21.8125 108-109 22.775000000000002 28.8375 27.1 21.2875 110-111 22.6875 28.6125 26.637499999999996 22.0625 112-113 22.375 28.3375 26.987499999999997 22.3 114-115 22.8875 28.0875 26.424999999999997 22.6 116-117 23.2375 28.299999999999997 26.887499999999996 21.575 118-119 22.6375 28.9375 26.2125 22.2125 120-121 22.8875 28.9125 26.187500000000004 22.0125 122-123 22.6 29.6375 26.4625 21.3 124-125 23.1875 28.375 25.974999999999998 22.4625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 0.5 22 0.0 23 1.0 24 3.0 25 4.0 26 3.5 27 4.5 28 8.5 29 15.5 30 21.5 31 23.0 32 40.0 33 64.0 34 67.0 35 74.0 36 95.0 37 110.5 38 137.0 39 163.5 40 190.0 41 207.5 42 239.0 43 252.5 44 257.0 45 272.5 46 267.5 47 252.5 48 227.5 49 191.0 50 141.0 51 114.5 52 104.5 53 88.5 54 64.5 55 56.5 56 47.0 57 32.5 58 25.0 59 22.5 60 20.5 61 13.0 62 11.0 63 12.0 64 9.0 65 6.0 66 3.5 67 5.0 68 6.5 69 5.0 70 4.0 71 3.0 72 2.0 73 1.5 74 1.5 75 1.5 76 1.0 77 1.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0125 66-67 0.0 68-69 0.0125 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0125 78-79 0.025 80-81 0.05 82-83 0.025 84-85 0.0125 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.61498973305955 97.02499999999999 2 0.28234086242299794 0.5499999999999999 3 0.051334702258726904 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025667351129363452 0.5 >50 0.025667351129363452 1.775 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTAT 71 1.775 TruSeq Adapter, Index 15 (97% over 40bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTA 20 0.5 TruSeq Adapter, Index 15 (97% over 40bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.55 0.0 0.0 0.0 0.0 2 0.575 0.0 0.0 0.0 0.0 3 0.575 0.0 0.0 0.0 0.0 4 0.575 0.0 0.0 0.0 0.0 5 0.575 0.0 0.0 0.0 0.0 6 0.575 0.0 0.0 0.0 0.0 7 0.575 0.0 0.0 0.0 0.0 8 0.575 0.0 0.0 0.0 0.0 9 0.575 0.0 0.0 0.0 0.0 10-11 0.575 0.0 0.0 0.0 0.0 12-13 0.575 0.0 0.0 0.0 0.0 14-15 0.575 0.0 0.0 0.0 0.0 16-17 0.575 0.0 0.0 0.0 0.0 18-19 0.575 0.0 0.0 0.0 0.0 20-21 0.575 0.0 0.0 0.0 0.0 22-23 0.575 0.0 0.0 0.0 0.0 24-25 0.575 0.0 0.0 0.0 0.0 26-27 0.575 0.0 0.0 0.0 0.0 28-29 0.575 0.0 0.0 0.0 0.0 30-31 0.6 0.0 0.0 0.0 0.0 32-33 0.6 0.0 0.0 0.0 0.0 34-35 0.6 0.0 0.0 0.0 0.0 36-37 0.6 0.0 0.0 0.0 0.0 38-39 0.6 0.0 0.0 0.0 0.0 40-41 0.6 0.0 0.0 0.0 0.0 42-43 0.6 0.0 0.0 0.0 0.0 44-45 0.6 0.0 0.0 0.0 0.0 46-47 0.6 0.0 0.0 0.0 0.0 48-49 0.6 0.0 0.0 0.0 0.0 50-51 0.6 0.0 0.0 0.0 0.0 52-53 0.6 0.0 0.0 0.0 0.0 54-55 0.6 0.0 0.0 0.0 0.0 56-57 0.6 0.0 0.0 0.0 0.0 58-59 0.6375 0.0 0.0 0.0 0.0 60-61 0.6625000000000001 0.0 0.0 0.0 0.0 62-63 0.675 0.0 0.0 0.0 0.0 64-65 0.6875 0.0 0.0 0.0 0.0 66-67 0.7 0.0 0.0 0.0 0.0 68-69 0.7 0.0 0.0 0.0 0.0 70-71 0.7124999999999999 0.0 0.0 0.0 0.0 72-73 0.725 0.0 0.0 0.0 0.0 74-75 0.725 0.0 0.0 0.0 0.0 76-77 0.7375 0.0 0.0 0.0 0.0 78-79 0.75 0.0 0.0 0.0 0.0 80-81 0.7875000000000001 0.0 0.0 0.0 0.0 82-83 0.8125 0.0 0.0 0.0 0.0 84-85 0.825 0.0 0.0 0.0 0.0 86-87 0.8374999999999999 0.0 0.0 0.0 0.0 88-89 0.9 0.0 0.0 0.0 0.0 90-91 0.975 0.0 0.0 0.0 0.0 92-93 1.1375000000000002 0.0 0.0 0.0 0.0 94-95 1.3125 0.0 0.0 0.0 0.0 96-97 1.5625 0.0 0.0 0.0 0.0 98-99 1.85 0.0 0.0 0.0 0.0 100-101 2.2249999999999996 0.0 0.0 0.0 0.0 102-103 2.475 0.0 0.0 0.0 0.0 104-105 2.975 0.0 0.0 0.0 0.0 106-107 3.525 0.0 0.0 0.0 0.0 108-109 4.025 0.0 0.0 0.0 0.0 110-111 4.737500000000001 0.0 0.0 0.0 0.0 112-113 5.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 520250 spots for SRR3208029.sra Written 520250 spots for SRR3208029.sra Read 520250 spots for SRR3208029.sra Written 520250 spots for SRR3208029.sra Read 520250 spots for SRR3208029.sra Written 520250 spots for SRR3208029.sra Read 520250 spots for SRR3208029.sra Written 520250 spots for SRR3208029.sra Read 520250 spots for SRR3208029.sra Written 520250 spots for SRR3208029.sra Read 520250 spots for SRR3208029.sra Written 520250 spots for SRR3208029.sra Read 520250 spots for SRR3208029.sra Written 520250 spots for SRR3208029.sra Read 520250 spots for SRR3208029.sra Written 520250 spots for SRR3208029.sra Read 520250 spots for SRR3208029.sra Written 520250 spots for SRR3208029.sra Read 520250 spots for SRR3208029.sra Written 520250 spots for SRR3208029.sra Read 520250 spots for SRR3208029.sra Written 520250 spots for SRR3208029.sra Read 520250 spots for SRR3208029.sra Written 520250 spots for SRR3208029.sra Read 520250 spots for SRR3208029.sra Written 520250 spots for SRR3208029.sra Read 520250 spots for SRR3208029.sra Written 520250 spots for SRR3208029.sra Read 520250 spots for SRR3208029.sra Written 520250 spots for SRR3208029.sra Read 520250 spots for SRR3208029.sra Written 520250 spots for SRR3208029.sra Read 520250 spots for SRR3208029.sra Written 520250 spots for SRR3208029.sra Read 520250 spots for SRR3208029.sra Written 520250 spots for SRR3208029.sra Read 520255 spots for SRR3208029.sra Written 520255 spots for SRR3208029.sra Read 520250 spots for SRR3208029.sra Written 520250 spots for SRR3208029.sra SRR ids: ['SRR3208029.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j_1iqlvw SRR3208029.sra spots: 10405005 blocks: [[1, 520250], [520251, 1040500], [1040501, 1560750], [1560751, 2081000], [2081001, 2601250], [2601251, 3121500], [3121501, 3641750], [3641751, 4162000], [4162001, 4682250], [4682251, 5202500], [5202501, 5722750], [5722751, 6243000], [6243001, 6763250], [6763251, 7283500], [7283501, 7803750], [7803751, 8324000], [8324001, 8844250], [8844251, 9364500], [9364501, 9884750], [9884751, 10405005]] SRR3208029 file size 3327079 SRR3208029 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208029 SRR3208029_1.fastq Input file: SRR3208029_1.fastq trimmed: SRR3208029-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 02:05:37 2025 >> started Wed Feb 12 02:05:45 2025 >> done (8.406s) 10405005 reads processed; of these: 12103 ( 0.12%) short reads filtered out after trimming by size control 317738 ( 3.05%) empty reads filtered out after trimming by size control 10075164 (96.83%) reads available; of these: 1130839 (11.22%) trimmed reads available after processing 8944325 (88.78%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 413 0.00% 19 444 0.00% 20 539 0.01% 21 432 0.00% 22 482 0.00% 23 508 0.01% 24 579 0.01% 25 652 0.01% 26 679 0.01% 27 632 0.01% 28 729 0.01% 29 783 0.01% 30 963 0.01% 31 948 0.01% 32 885 0.01% 33 951 0.01% 34 644 0.01% 35 614 0.01% 36 624 0.01% 37 666 0.01% 38 659 0.01% 39 729 0.01% 40 1214 0.01% 41 703 0.01% 42 695 0.01% 43 769 0.01% 44 690 0.01% 45 670 0.01% 46 723 0.01% 47 725 0.01% 48 682 0.01% 49 753 0.01% 50 791 0.01% 51 852 0.01% 52 827 0.01% 53 887 0.01% 54 844 0.01% 55 871 0.01% 56 881 0.01% 57 942 0.01% 58 1039 0.01% 59 1038 0.01% 60 1084 0.01% 61 1124 0.01% 62 1207 0.01% 63 1292 0.01% 64 1948 0.02% 65 14404 0.14% 66 2717 0.03% 67 1442 0.01% 68 1479 0.01% 69 1537 0.02% 70 1583 0.02% 71 1569 0.02% 72 1794 0.02% 73 1783 0.02% 74 2496 0.02% 75 3912 0.04% 76 5666 0.06% 77 3046 0.03% 78 2303 0.02% 79 2292 0.02% 80 2609 0.03% 81 2874 0.03% 82 3242 0.03% 83 3498 0.03% 84 3640 0.04% 85 4003 0.04% 86 4288 0.04% 87 4679 0.05% 88 5099 0.05% 89 5833 0.06% 90 6622 0.07% 91 8318 0.08% 92 8685 0.09% 93 9413 0.09% 94 1619 0.02% 95 1666 0.02% 96 1855 0.02% 97 1837 0.02% 98 1984 0.02% 99 2174 0.02% 100 2275 0.02% 101 2562 0.03% 102 2720 0.03% 103 2859 0.03% 104 2697 0.03% 105 2972 0.03% 106 3116 0.03% 107 3192 0.03% 108 3682 0.04% 109 4030 0.04% 110 4442 0.04% 111 4791 0.05% 112 5579 0.06% 113 6383 0.06% 114 7342 0.07% 115 8308 0.08% 116 9662 0.10% 117 11733 0.12% 118 14793 0.15% 119 18907 0.19% 120 25114 0.25% 121 35022 0.35% 122 57077 0.57% 123 121771 1.21% 124 600043 5.96% 125 8944325 88.78% 10075164 reads passed initial QC criterion=sequence-density sequence-density=4.51 sequence-density-rank=1 fanout-score=54.33 fanout-score-rank=1 prefix-density=6.13 prefix-fanout=40.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=4.51 sequence-density-rank=1 fanout-score=54.33 fanout-score-rank=1 prefix-density=6.13 prefix-fanout=40.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR3208029 - Input file: STDIN trimmed: SRR3208029-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 02:06:17 2025 >> started Wed Feb 12 02:06:26 2025 >> done (9.072s) 6045099 reads processed; of these: 294 ( 0.00%) short reads filtered out after trimming by size control 17602 ( 0.29%) empty reads filtered out after trimming by size control 6027203 (99.70%) reads available; of these: 826233 (13.71%) trimmed reads available after processing 5200970 (86.29%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 243 0.00% 19 270 0.00% 20 349 0.01% 21 261 0.00% 22 304 0.01% 23 302 0.01% 24 345 0.01% 25 406 0.01% 26 415 0.01% 27 371 0.01% 28 428 0.01% 29 460 0.01% 30 592 0.01% 31 590 0.01% 32 536 0.01% 33 701 0.01% 34 399 0.01% 35 360 0.01% 36 380 0.01% 37 395 0.01% 38 410 0.01% 39 453 0.01% 40 922 0.02% 41 419 0.01% 42 412 0.01% 43 438 0.01% 44 404 0.01% 45 416 0.01% 46 466 0.01% 47 433 0.01% 48 389 0.01% 49 462 0.01% 50 486 0.01% 51 487 0.01% 52 479 0.01% 53 490 0.01% 54 511 0.01% 55 519 0.01% 56 545 0.01% 57 535 0.01% 58 618 0.01% 59 591 0.01% 60 652 0.01% 61 659 0.01% 62 652 0.01% 63 668 0.01% 64 680 0.01% 65 686 0.01% 66 692 0.01% 67 760 0.01% 68 823 0.01% 69 861 0.01% 70 922 0.02% 71 882 0.01% 72 989 0.02% 73 917 0.02% 74 1010 0.02% 75 983 0.02% 76 1070 0.02% 77 1151 0.02% 78 1258 0.02% 79 1333 0.02% 80 1536 0.03% 81 1680 0.03% 82 1926 0.03% 83 2118 0.04% 84 2225 0.04% 85 2404 0.04% 86 2567 0.04% 87 2792 0.05% 88 3138 0.05% 89 3492 0.06% 90 3869 0.06% 91 4545 0.08% 92 5045 0.08% 93 5697 0.09% 94 6451 0.11% 95 7044 0.12% 96 7559 0.13% 97 8245 0.14% 98 9113 0.15% 99 10381 0.17% 100 11489 0.19% 101 13176 0.22% 102 14854 0.25% 103 16712 0.28% 104 18031 0.30% 105 19144 0.32% 106 20253 0.34% 107 21104 0.35% 108 22807 0.38% 109 24569 0.41% 110 26700 0.44% 111 29635 0.49% 112 32773 0.54% 113 35721 0.59% 114 38543 0.64% 115 40505 0.67% 116 42228 0.70% 117 44359 0.74% 118 47055 0.78% 119 51912 0.86% 120 62542 1.04% 121 91555 1.52% 122 186436 3.09% 123 64855 1.08% 124 321801 5.34% 125 4599977 76.32% criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=3.01 fanout-score-rank=28 prefix-density=0.08 prefix-fanout=2.9 sequence=GGAAAGACCATCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=13 fanout-score=266.71 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=28.8 sequence=AAGAAGAAGAAA Started job on | Feb 12 02:06:51 Started mapping on | Feb 12 02:06:52 Finished on | Feb 12 02:07:12 Mapping speed, Million of reads per hour | 1810.31 Number of input reads | 10057268 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 9173718 Uniquely mapped reads % | 91.21% Average mapped length | 122.41 Number of splices: Total | 3375317 Number of splices: Annotated (sjdb) | 3289147 Number of splices: GT/AG | 3316014 Number of splices: GC/AG | 48127 Number of splices: AT/AC | 3979 Number of splices: Non-canonical | 7197 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 1.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 260889 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 232614 % of reads mapped to too many loci | 2.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.87% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 622661 622661 622661 N_multimapping 260889 260889 260889 N_noFeature 512607 4816925 4817388 N_ambiguous 92996 20616 20558 UnstrandedReadsAssigned:8568115 PositiveStrandReadsAssigned:4336177 NegativeStrandReadsAssigned:4335772 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208029 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208029-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,057,268 reads, 8,960,841 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52401 SRR3208029.ke.tsv 34699 SRR3208029.se.tsv 87100 total ==> SRR3208029.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1102 85.1479 Potri.005G024800.1.v4.1 1035 936 2683 425.023 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 291.778 15.2121 Potri.016G087400.1.v4.1 270 171 257 222.846 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 142.719 12.6414 Potri.012G127500.1.v4.1 977 878 5382 908.901 ==> SRR3208029.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 46 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 132 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR3208029 completed mapping pipeline successfully