Starting /dee2/code/volunteer_pipeline.sh SRR3208031 current disk space = 2823839899648 free memory = 1579443336 SRR3208031 SRAfilesize c9fb33ca3175112ca06285ab7e4f2ff5 SRR3208031.sra SRR3208031.sra file validated SRR3208031 is single end SRR3208031 is conventional basespace SRR3208031 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208031_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.57325 33.0 33.0 33.0 33.0 33.0 2 32.17325 33.0 33.0 33.0 33.0 33.0 3 32.20975 33.0 33.0 33.0 33.0 33.0 4 32.2945 33.0 33.0 33.0 33.0 33.0 5 32.385 33.0 33.0 33.0 33.0 33.0 6 36.14825 37.0 37.0 37.0 37.0 37.0 7 36.237 37.0 37.0 37.0 37.0 37.0 8 36.271 37.0 37.0 37.0 37.0 37.0 9 36.334 37.0 37.0 37.0 37.0 37.0 10-11 36.277625 37.0 37.0 37.0 37.0 37.0 12-13 36.283125 37.0 37.0 37.0 37.0 37.0 14-15 36.246875 37.0 37.0 37.0 37.0 37.0 16-17 36.235625 37.0 37.0 37.0 37.0 37.0 18-19 36.30375 37.0 37.0 37.0 37.0 37.0 20-21 36.3215 37.0 37.0 37.0 37.0 37.0 22-23 36.326625 37.0 37.0 37.0 37.0 37.0 24-25 36.27275 37.0 37.0 37.0 37.0 37.0 26-27 36.047250000000005 37.0 37.0 37.0 37.0 37.0 28-29 36.250125 37.0 37.0 37.0 37.0 37.0 30-31 36.237375 37.0 37.0 37.0 37.0 37.0 32-33 36.315 37.0 37.0 37.0 37.0 37.0 34-35 36.353375 37.0 37.0 37.0 37.0 37.0 36-37 36.260374999999996 37.0 37.0 37.0 37.0 37.0 38-39 36.267375 37.0 37.0 37.0 37.0 37.0 40-41 36.28075 37.0 37.0 37.0 37.0 37.0 42-43 36.309375 37.0 37.0 37.0 37.0 37.0 44-45 36.30225 37.0 37.0 37.0 37.0 37.0 46-47 36.286875 37.0 37.0 37.0 37.0 37.0 48-49 36.2805 37.0 37.0 37.0 37.0 37.0 50-51 36.334 37.0 37.0 37.0 37.0 37.0 52-53 36.22125 37.0 37.0 37.0 37.0 37.0 54-55 36.27825 37.0 37.0 37.0 37.0 37.0 56-57 36.30175 37.0 37.0 37.0 37.0 37.0 58-59 36.2715 37.0 37.0 37.0 37.0 37.0 60-61 36.32425 37.0 37.0 37.0 37.0 37.0 62-63 36.285 37.0 37.0 37.0 37.0 37.0 64-65 36.278375 37.0 37.0 37.0 37.0 37.0 66-67 36.297375 37.0 37.0 37.0 37.0 37.0 68-69 36.260999999999996 37.0 37.0 37.0 37.0 37.0 70-71 36.250875 37.0 37.0 37.0 37.0 37.0 72-73 36.229375000000005 37.0 37.0 37.0 37.0 37.0 74-75 36.12225 37.0 37.0 37.0 37.0 37.0 76-77 35.950125 37.0 37.0 37.0 37.0 37.0 78-79 35.990375 37.0 37.0 37.0 37.0 37.0 80-81 35.980000000000004 37.0 37.0 37.0 37.0 37.0 82-83 36.009375 37.0 37.0 37.0 37.0 37.0 84-85 35.9875 37.0 37.0 37.0 37.0 37.0 86-87 35.921625 37.0 37.0 37.0 37.0 37.0 88-89 35.891000000000005 37.0 37.0 37.0 37.0 37.0 90-91 35.89525 37.0 37.0 37.0 37.0 37.0 92-93 35.889125 37.0 37.0 37.0 37.0 37.0 94-95 35.897875 37.0 37.0 37.0 37.0 37.0 96-97 35.86725 37.0 37.0 37.0 37.0 37.0 98-99 35.772999999999996 37.0 37.0 37.0 37.0 37.0 100-101 35.867625000000004 37.0 37.0 37.0 37.0 37.0 102-103 35.765625 37.0 37.0 37.0 37.0 37.0 104-105 35.817375 37.0 37.0 37.0 37.0 37.0 106-107 35.768249999999995 37.0 37.0 37.0 37.0 37.0 108-109 35.78075 37.0 37.0 37.0 37.0 37.0 110-111 35.733125 37.0 37.0 37.0 37.0 37.0 112-113 35.689 37.0 37.0 37.0 37.0 37.0 114-115 35.6165 37.0 37.0 37.0 37.0 37.0 116-117 35.548875 37.0 37.0 37.0 37.0 37.0 118-119 35.571875000000006 37.0 37.0 37.0 37.0 37.0 120-121 35.480625 37.0 37.0 37.0 37.0 37.0 122-123 35.42075 37.0 37.0 37.0 37.0 37.0 124-125 33.986 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 1.0 4 0.0 5 0.0 6 0.0 7 2.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 1.0 18 3.0 19 5.0 20 5.0 21 1.0 22 18.0 23 7.0 24 6.0 25 7.0 26 6.0 27 14.0 28 17.0 29 26.0 30 26.0 31 38.0 32 66.0 33 84.0 34 139.0 35 272.0 36 3242.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.104416645391883 14.832780188920092 13.735001276487107 48.32780188920091 2 18.425 21.224999999999998 40.300000000000004 20.05 3 20.375 24.45 28.825 26.35 4 23.799999999999997 29.849999999999998 21.775 24.575 5 26.650000000000002 32.75 23.7 16.900000000000002 6 18.725 36.449999999999996 25.374999999999996 19.45 7 17.125 18.575 44.875 19.425 8 17.7 23.525 31.474999999999998 27.3 9 19.775000000000002 23.599999999999998 32.65 23.974999999999998 10-11 22.45 33.9375 22.7375 20.875 12-13 20.25 26.337500000000002 30.075000000000003 23.3375 14-15 20.3875 28.287499999999998 28.7375 22.5875 16-17 22.55 27.675 28.212500000000002 21.5625 18-19 21.475 27.800000000000004 28.1375 22.5875 20-21 21.987499999999997 27.9375 28.175 21.9 22-23 21.375 28.9375 27.900000000000002 21.7875 24-25 22.05 28.1375 26.937499999999996 22.875 26-27 20.8875 28.675 27.575 22.8625 28-29 21.224999999999998 28.537499999999998 28.525 21.712500000000002 30-31 20.9875 28.3875 28.000000000000004 22.625 32-33 21.125 29.212500000000002 27.6625 22.0 34-35 22.5125 28.037499999999998 27.4125 22.037499999999998 36-37 21.087500000000002 28.7 27.712500000000002 22.5 38-39 22.425 28.1125 27.250000000000004 22.2125 40-41 22.05 28.175 27.437499999999996 22.3375 42-43 21.9375 28.3625 27.987499999999997 21.712500000000002 44-45 22.3375 27.3125 28.237499999999997 22.112499999999997 46-47 21.3 27.2625 28.4 23.0375 48-49 21.775 27.900000000000002 28.999999999999996 21.325 50-51 22.0125 28.525 27.3625 22.1 52-53 22.287499999999998 28.4375 27.212500000000002 22.0625 54-55 21.3875 28.025 28.375 22.2125 56-57 21.212500000000002 28.5625 28.8625 21.3625 58-59 21.7 28.050000000000004 27.962500000000002 22.287499999999998 60-61 21.85 27.750000000000004 28.975 21.425 62-63 21.8875 28.125 28.212500000000002 21.775 64-65 21.965245655706962 28.491061382672832 28.491061382672832 21.052631578947366 66-67 22.0125 28.199999999999996 27.900000000000002 21.8875 68-69 21.852731591448933 29.51618952369046 27.47843480435054 21.152644080510065 70-71 21.525 28.65 28.675 21.15 72-73 21.015126890861357 28.753594199274907 28.141017627203404 22.090261282660332 74-75 20.9875 29.7 27.1125 22.2 76-77 22.490311288911112 28.62857857232154 27.465933241655204 21.41517689711214 78-79 21.61790447611903 28.232058014503625 28.057014253563388 22.093023255813954 80-81 21.96098049024512 27.738869434717362 28.639319659829916 21.660830415207606 82-83 21.8304576144036 28.557139284821204 28.457114278569644 21.155288822205552 84-85 22.565320665083135 27.86598324790599 27.740967620952617 21.827728466058257 86-87 21.8625 28.4 28.075 21.6625 88-89 22.9875 27.287499999999998 28.4375 21.2875 90-91 21.825 28.212500000000002 27.400000000000002 22.5625 92-93 21.762500000000003 28.075 28.537499999999998 21.625 94-95 21.4875 28.675 27.725 22.112499999999997 96-97 22.075 28.3125 27.85 21.762500000000003 98-99 21.45 27.962500000000002 28.525 22.0625 100-101 22.625 28.549999999999997 28.050000000000004 20.775 102-103 22.5875 27.825 27.212500000000002 22.375 104-105 21.975 29.362500000000004 27.537499999999998 21.125 106-107 22.8625 28.675 26.7125 21.75 108-109 22.840355044380548 28.528566070758842 27.128391048881113 21.502687835979497 110-111 22.25 28.6125 27.3 21.837500000000002 112-113 22.525000000000002 29.675 27.1375 20.6625 114-115 23.07788473559195 29.1911488936117 26.115764470558823 21.61520190023753 116-117 22.452806600825102 29.84123015376922 26.303287910988875 21.402675334416802 118-119 23.225 28.575 26.825 21.375 120-121 24.1625 29.849999999999998 24.925 21.0625 122-123 23.325000000000003 29.4 25.7625 21.512500000000003 124-125 23.9 29.349999999999998 24.962500000000002 21.7875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.5 22 1.0 23 2.0 24 3.5 25 3.0 26 2.5 27 5.0 28 9.5 29 15.5 30 18.5 31 25.5 32 39.5 33 53.5 34 66.0 35 80.5 36 95.5 37 117.5 38 152.0 39 182.5 40 195.0 41 207.0 42 233.0 43 255.0 44 269.0 45 270.5 46 277.5 47 254.0 48 216.0 49 187.5 50 149.5 51 121.0 52 101.0 53 89.0 54 68.5 55 55.5 56 42.0 57 24.5 58 19.0 59 17.5 60 15.5 61 12.0 62 8.5 63 6.5 64 4.5 65 4.5 66 4.0 67 1.0 68 1.0 69 3.0 70 3.0 71 2.5 72 2.0 73 1.0 74 0.5 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0125 66-67 0.0 68-69 0.0125 70-71 0.0 72-73 0.0125 74-75 0.0 76-77 0.0125 78-79 0.025 80-81 0.05 82-83 0.025 84-85 0.0125 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0125 110-111 0.0 112-113 0.0 114-115 0.0125 116-117 0.0125 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74785678265255 98.9 2 0.2017145738779627 0.4 3 0.02521432173474534 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02521432173474534 0.625 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTAT 25 0.625 TruSeq Adapter, Index 18 (97% over 40bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.0875 0.0 0.0 0.0 0.0 50-51 0.1125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.8625 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.2625 0.0 0.0 0.0 0.0 98-99 1.5375 0.0 0.0 0.0 0.0 100-101 1.975 0.0 0.0 0.0 0.0 102-103 2.5999999999999996 0.0 0.0 0.0 0.0 104-105 3.25 0.0 0.0 0.0 0.0 106-107 4.0125 0.0 0.0 0.0 0.0 108-109 4.8875 0.0 0.0 0.0 0.0 110-111 5.699999999999999 0.0 0.0 0.0 0.0 112-113 6.737500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1214287 spots for SRR3208031.sra Written 1214287 spots for SRR3208031.sra Read 1214287 spots for SRR3208031.sra Written 1214287 spots for SRR3208031.sra Read 1214287 spots for SRR3208031.sra Written 1214287 spots for SRR3208031.sra Read 1214287 spots for SRR3208031.sra Written 1214287 spots for SRR3208031.sra Read 1214287 spots for SRR3208031.sra Written 1214287 spots for SRR3208031.sra Read 1214287 spots for SRR3208031.sra Written 1214287 spots for SRR3208031.sra Read 1214287 spots for SRR3208031.sra Written 1214287 spots for SRR3208031.sra Read 1214287 spots for SRR3208031.sra Written 1214287 spots for SRR3208031.sra Read 1214287 spots for SRR3208031.sra Written 1214287 spots for SRR3208031.sra Read 1214287 spots for SRR3208031.sra Written 1214287 spots for SRR3208031.sra Read 1214287 spots for SRR3208031.sra Written 1214287 spots for SRR3208031.sra Read 1214287 spots for SRR3208031.sra Written 1214287 spots for SRR3208031.sra Read 1214287 spots for SRR3208031.sra Written 1214287 spots for SRR3208031.sra Read 1214287 spots for SRR3208031.sra Written 1214287 spots for SRR3208031.sra Read 1214287 spots for SRR3208031.sra Written 1214287 spots for SRR3208031.sra Read 1214287 spots for SRR3208031.sra Written 1214287 spots for SRR3208031.sra Read 1214287 spots for SRR3208031.sra Written 1214287 spots for SRR3208031.sra Read 1214290 spots for SRR3208031.sra Written 1214290 spots for SRR3208031.sra Read 1214287 spots for SRR3208031.sra Written 1214287 spots for SRR3208031.sra Read 1214287 spots for SRR3208031.sra Written 1214287 spots for SRR3208031.sra SRR ids: ['SRR3208031.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y7l7et9i SRR3208031.sra spots: 24285743 blocks: [[1, 1214287], [1214288, 2428574], [2428575, 3642861], [3642862, 4857148], [4857149, 6071435], [6071436, 7285722], [7285723, 8500009], [8500010, 9714296], [9714297, 10928583], [10928584, 12142870], [12142871, 13357157], [13357158, 14571444], [14571445, 15785731], [15785732, 17000018], [17000019, 18214305], [18214306, 19428592], [19428593, 20642879], [20642880, 21857166], [21857167, 23071453], [23071454, 24285743]] SRR3208031 file size 7780042 SRR3208031 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208031 SRR3208031_1.fastq Input file: SRR3208031_1.fastq trimmed: SRR3208031-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Apr 10 12:50:15 2025 >> started Thu Apr 10 12:50:29 2025 >> done (13.783s) 24285743 reads processed; of these: 20661 ( 0.09%) short reads filtered out after trimming by size control 234776 ( 0.97%) empty reads filtered out after trimming by size control 24030306 (98.95%) reads available; of these: 2765724 (11.51%) trimmed reads available after processing 21264582 (88.49%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 744 0.00% 19 833 0.00% 20 895 0.00% 21 871 0.00% 22 1029 0.00% 23 1016 0.00% 24 1198 0.00% 25 1461 0.01% 26 1393 0.01% 27 1273 0.01% 28 1359 0.01% 29 1487 0.01% 30 1995 0.01% 31 1776 0.01% 32 1297 0.01% 33 1234 0.01% 34 1172 0.00% 35 1259 0.01% 36 1262 0.01% 37 1279 0.01% 38 1343 0.01% 39 1300 0.01% 40 1392 0.01% 41 1291 0.01% 42 1353 0.01% 43 1344 0.01% 44 1341 0.01% 45 1440 0.01% 46 1420 0.01% 47 1488 0.01% 48 1440 0.01% 49 1537 0.01% 50 1505 0.01% 51 1610 0.01% 52 1595 0.01% 53 1696 0.01% 54 1619 0.01% 55 1721 0.01% 56 1782 0.01% 57 1909 0.01% 58 2010 0.01% 59 2074 0.01% 60 2226 0.01% 61 2305 0.01% 62 2448 0.01% 63 2429 0.01% 64 2789 0.01% 65 4467 0.02% 66 2962 0.01% 67 2766 0.01% 68 2844 0.01% 69 3076 0.01% 70 3424 0.01% 71 3646 0.02% 72 4050 0.02% 73 4258 0.02% 74 4881 0.02% 75 5707 0.02% 76 6532 0.03% 77 6059 0.03% 78 5753 0.02% 79 6405 0.03% 80 7215 0.03% 81 8444 0.04% 82 9514 0.04% 83 10832 0.05% 84 11724 0.05% 85 12811 0.05% 86 13885 0.06% 87 15072 0.06% 88 17063 0.07% 89 19956 0.08% 90 22660 0.09% 91 26240 0.11% 92 30272 0.13% 93 33758 0.14% 94 3602 0.01% 95 3807 0.02% 96 3974 0.02% 97 4188 0.02% 98 4539 0.02% 99 4863 0.02% 100 5234 0.02% 101 5873 0.02% 102 6157 0.03% 103 6399 0.03% 104 6019 0.03% 105 6887 0.03% 106 6865 0.03% 107 7525 0.03% 108 8403 0.03% 109 9277 0.04% 110 10051 0.04% 111 11328 0.05% 112 12956 0.05% 113 15146 0.06% 114 17088 0.07% 115 19701 0.08% 116 23094 0.10% 117 28108 0.12% 118 35742 0.15% 119 45686 0.19% 120 62049 0.26% 121 85312 0.36% 122 141583 0.59% 123 307154 1.28% 124 1479598 6.16% 125 21264582 88.49% 24030306 reads passed initial QC criterion=sequence-density sequence-density=6.22 sequence-density-rank=1 fanout-score=45.73 fanout-score-rank=1 prefix-density=8.24 prefix-fanout=34.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA criterion=fanout-score sequence-density=6.22 sequence-density-rank=1 fanout-score=45.73 fanout-score-rank=1 prefix-density=8.24 prefix-fanout=34.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA -o SRR3208031 - Input file: STDIN trimmed: SRR3208031-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Thu Apr 10 12:51:28 2025 >> started Thu Apr 10 12:51:46 2025 >> done (18.217s) 17164504 reads processed; of these: 353 ( 0.00%) short reads filtered out after trimming by size control 6516 ( 0.04%) empty reads filtered out after trimming by size control 17157635 (99.96%) reads available; of these: 2852206 (16.62%) trimmed reads available after processing 14305429 (83.38%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 558 0.00% 19 613 0.00% 20 655 0.00% 21 636 0.00% 22 733 0.00% 23 722 0.00% 24 868 0.01% 25 1066 0.01% 26 965 0.01% 27 911 0.01% 28 956 0.01% 29 1066 0.01% 30 1452 0.01% 31 1253 0.01% 32 921 0.01% 33 888 0.01% 34 844 0.00% 35 925 0.01% 36 919 0.01% 37 928 0.01% 38 970 0.01% 39 925 0.01% 40 1008 0.01% 41 938 0.01% 42 970 0.01% 43 981 0.01% 44 934 0.01% 45 1057 0.01% 46 1045 0.01% 47 1040 0.01% 48 1024 0.01% 49 1112 0.01% 50 1087 0.01% 51 1184 0.01% 52 1137 0.01% 53 1212 0.01% 54 1111 0.01% 55 1215 0.01% 56 1288 0.01% 57 1356 0.01% 58 1465 0.01% 59 1453 0.01% 60 1644 0.01% 61 1670 0.01% 62 1708 0.01% 63 1704 0.01% 64 1736 0.01% 65 1790 0.01% 66 1878 0.01% 67 1982 0.01% 68 1976 0.01% 69 2229 0.01% 70 2405 0.01% 71 2528 0.01% 72 2860 0.02% 73 2942 0.02% 74 3116 0.02% 75 3101 0.02% 76 3467 0.02% 77 3745 0.02% 78 4043 0.02% 79 4611 0.03% 80 5160 0.03% 81 6003 0.03% 82 6890 0.04% 83 7718 0.04% 84 8364 0.05% 85 9177 0.05% 86 9988 0.06% 87 11022 0.06% 88 12205 0.07% 89 14391 0.08% 90 16270 0.09% 91 18498 0.11% 92 21385 0.12% 93 24276 0.14% 94 27250 0.16% 95 29408 0.17% 96 31539 0.18% 97 34121 0.20% 98 37748 0.22% 99 41368 0.24% 100 47053 0.27% 101 53114 0.31% 102 59528 0.35% 103 65838 0.38% 104 70120 0.41% 105 75370 0.44% 106 77146 0.45% 107 81263 0.47% 108 84922 0.49% 109 90589 0.53% 110 97631 0.57% 111 105419 0.61% 112 115730 0.67% 113 124697 0.73% 114 132115 0.77% 115 138263 0.81% 116 141441 0.82% 117 145772 0.85% 118 151917 0.89% 119 164388 0.96% 120 196313 1.14% 121 274099 1.60% 122 540875 3.15% 123 190951 1.11% 124 918090 5.35% 125 12548684 73.14% criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=47.40 fanout-score-rank=11 prefix-density=0.24 prefix-fanout=13.0 sequence=CACCACCACCATGGGCTCCCCAGCCACC criterion=fanout-score sequence-density=0.05 sequence-density-rank=16 fanout-score=334.12 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=31.0 sequence=TTCTTCTTCTTT Started job on | Apr 10 12:52:37 Started mapping on | Apr 10 12:52:37 Finished on | Apr 10 12:53:07 Mapping speed, Million of reads per hour | 2882.81 Number of input reads | 24023437 Average input read length | 122 UNIQUE READS: Uniquely mapped reads number | 22705498 Uniquely mapped reads % | 94.51% Average mapped length | 121.85 Number of splices: Total | 8541264 Number of splices: Annotated (sjdb) | 8365692 Number of splices: GT/AG | 8408044 Number of splices: GC/AG | 109058 Number of splices: AT/AC | 8437 Number of splices: Non-canonical | 15725 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.13 Insertion rate per base | 0.02% Insertion average length | 1.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 466777 % of reads mapped to multiple loci | 1.94% Number of reads mapped to too many loci | 437570 % of reads mapped to too many loci | 1.82% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.71% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 851162 851162 851162 N_multimapping 466777 466777 466777 N_noFeature 1056971 11776801 11832718 N_ambiguous 236876 41803 42549 UnstrandedReadsAssigned:21411651 PositiveStrandReadsAssigned:10886894 NegativeStrandReadsAssigned:10830231 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=122 echo kmer=117 SRR3208031 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208031-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,023,437 reads, 22,195,694 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,060 rounds 52401 SRR3208031.ke.tsv 34699 SRR3208031.se.tsv 87100 total ==> SRR3208031.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 717 24.5532 Potri.005G024800.1.v4.1 1035 936 131 9.19728 Potri.004G059700.1.v4.1 961 862 12 0.914825 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 430.558 9.94868 Potri.016G087400.1.v4.1 270 171 948 364.314 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 98 3.84711 Potri.012G127500.1.v4.1 977 878 3582 268.099 ==> SRR3208031.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2141 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 438 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 51 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR3208031 completed mapping pipeline successfully