Starting /dee2/code/volunteer_pipeline.sh SRR3208032 current disk space = 3049127907328 free memory = 1298164504 SRR3208032 SRAfilesize ef553ca0ad5e61cff406459dc3f8064f SRR3208032.sra SRR3208032.sra file validated SRR3208032 is single end SRR3208032 is conventional basespace SRR3208032 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208032_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.43675 33.0 33.0 33.0 33.0 33.0 2 32.08975 33.0 33.0 33.0 33.0 33.0 3 32.069 33.0 33.0 33.0 33.0 33.0 4 32.2975 33.0 33.0 33.0 33.0 33.0 5 32.3215 33.0 33.0 33.0 33.0 33.0 6 36.04225 37.0 37.0 37.0 37.0 37.0 7 36.224 37.0 37.0 37.0 37.0 37.0 8 36.26675 37.0 37.0 37.0 37.0 37.0 9 36.34925 37.0 37.0 37.0 37.0 37.0 10-11 36.31375 37.0 37.0 37.0 37.0 37.0 12-13 36.306875000000005 37.0 37.0 37.0 37.0 37.0 14-15 36.204 37.0 37.0 37.0 37.0 37.0 16-17 36.243875 37.0 37.0 37.0 37.0 37.0 18-19 36.339875 37.0 37.0 37.0 37.0 37.0 20-21 36.284499999999994 37.0 37.0 37.0 37.0 37.0 22-23 36.26325 37.0 37.0 37.0 37.0 37.0 24-25 36.203875 37.0 37.0 37.0 37.0 37.0 26-27 36.047375 37.0 37.0 37.0 37.0 37.0 28-29 36.250125 37.0 37.0 37.0 37.0 37.0 30-31 36.22975 37.0 37.0 37.0 37.0 37.0 32-33 36.22625 37.0 37.0 37.0 37.0 37.0 34-35 36.240375 37.0 37.0 37.0 37.0 37.0 36-37 36.214625 37.0 37.0 37.0 37.0 37.0 38-39 36.26049999999999 37.0 37.0 37.0 37.0 37.0 40-41 36.2635 37.0 37.0 37.0 37.0 37.0 42-43 36.28337500000001 37.0 37.0 37.0 37.0 37.0 44-45 36.241125 37.0 37.0 37.0 37.0 37.0 46-47 36.316874999999996 37.0 37.0 37.0 37.0 37.0 48-49 36.278875 37.0 37.0 37.0 37.0 37.0 50-51 36.301 37.0 37.0 37.0 37.0 37.0 52-53 36.16675 37.0 37.0 37.0 37.0 37.0 54-55 36.223875 37.0 37.0 37.0 37.0 37.0 56-57 36.254125 37.0 37.0 37.0 37.0 37.0 58-59 36.23175 37.0 37.0 37.0 37.0 37.0 60-61 36.198875 37.0 37.0 37.0 37.0 37.0 62-63 36.240875 37.0 37.0 37.0 37.0 37.0 64-65 36.19225 37.0 37.0 37.0 37.0 37.0 66-67 36.174375 37.0 37.0 37.0 37.0 37.0 68-69 36.215374999999995 37.0 37.0 37.0 37.0 37.0 70-71 36.162125 37.0 37.0 37.0 37.0 37.0 72-73 36.169250000000005 37.0 37.0 37.0 37.0 37.0 74-75 36.147875 37.0 37.0 37.0 37.0 37.0 76-77 36.141125 37.0 37.0 37.0 37.0 37.0 78-79 36.101749999999996 37.0 37.0 37.0 37.0 37.0 80-81 36.067499999999995 37.0 37.0 37.0 37.0 37.0 82-83 36.087 37.0 37.0 37.0 37.0 37.0 84-85 36.075125 37.0 37.0 37.0 37.0 37.0 86-87 36.128 37.0 37.0 37.0 37.0 37.0 88-89 36.015875 37.0 37.0 37.0 37.0 37.0 90-91 36.075625 37.0 37.0 37.0 37.0 37.0 92-93 36.027625 37.0 37.0 37.0 37.0 37.0 94-95 35.925875000000005 37.0 37.0 37.0 37.0 37.0 96-97 35.934875000000005 37.0 37.0 37.0 37.0 37.0 98-99 35.922125 37.0 37.0 37.0 37.0 37.0 100-101 35.912125 37.0 37.0 37.0 37.0 37.0 102-103 35.91575 37.0 37.0 37.0 37.0 37.0 104-105 35.9075 37.0 37.0 37.0 37.0 37.0 106-107 35.94875 37.0 37.0 37.0 37.0 37.0 108-109 35.887625 37.0 37.0 37.0 37.0 37.0 110-111 35.843 37.0 37.0 37.0 37.0 37.0 112-113 35.850625 37.0 37.0 37.0 37.0 37.0 114-115 35.743750000000006 37.0 37.0 37.0 37.0 37.0 116-117 35.658874999999995 37.0 37.0 37.0 37.0 37.0 118-119 35.669624999999996 37.0 37.0 37.0 37.0 37.0 120-121 35.591125000000005 37.0 37.0 37.0 37.0 37.0 122-123 35.55425 37.0 37.0 37.0 37.0 37.0 124-125 34.1295 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 1.0 4 0.0 5 1.0 6 0.0 7 0.0 8 1.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 2.0 15 1.0 16 0.0 17 2.0 18 1.0 19 2.0 20 0.0 21 2.0 22 2.0 23 5.0 24 4.0 25 6.0 26 10.0 27 12.0 28 24.0 29 28.0 30 35.0 31 40.0 32 56.0 33 90.0 34 134.0 35 281.0 36 3242.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.443504996156804 16.52574942352037 14.347937483986678 45.68280809633615 2 20.375 21.175 39.525 18.925 3 22.35 24.575 27.750000000000004 25.324999999999996 4 25.324999999999996 30.125 21.025 23.525 5 24.474999999999998 34.425 23.05 18.05 6 20.05 36.15 24.175 19.625 7 16.925 19.175 44.55 19.35 8 19.025 23.9 30.275000000000002 26.8 9 20.674999999999997 22.925 31.525 24.875 10-11 22.675 33.387499999999996 22.475 21.462500000000002 12-13 21.1125 25.7 29.6875 23.5 14-15 21.625 27.1625 28.375 22.8375 16-17 21.8625 27.8625 27.6125 22.662499999999998 18-19 22.900000000000002 27.925 27.275 21.9 20-21 21.875 28.449999999999996 27.6 22.075 22-23 22.1875 28.625 27.125 22.0625 24-25 21.6875 27.750000000000004 28.037499999999998 22.525000000000002 26-27 20.9875 28.375 28.4125 22.225 28-29 22.275 28.050000000000004 28.000000000000004 21.675 30-31 21.9375 28.3875 27.462500000000002 22.2125 32-33 21.762500000000003 29.049999999999997 26.987499999999997 22.2 34-35 21.6875 28.575 27.650000000000002 22.0875 36-37 21.775 28.037499999999998 27.700000000000003 22.4875 38-39 22.175 28.6625 28.1125 21.05 40-41 22.412499999999998 27.3625 28.349999999999998 21.875 42-43 22.075 27.737499999999997 28.1625 22.025 44-45 22.0875 28.6125 27.287499999999998 22.0125 46-47 21.675 28.1125 28.125 22.0875 48-49 21.85 28.1375 28.425 21.587500000000002 50-51 22.400000000000002 26.937499999999996 28.212500000000002 22.45 52-53 22.7 27.8375 26.825 22.6375 54-55 22.037499999999998 28.199999999999996 27.425 22.3375 56-57 22.325 27.125 27.875 22.675 58-59 22.237499999999997 27.775 27.625 22.3625 60-61 22.5125 28.712500000000002 27.224999999999998 21.55 62-63 22.25 28.199999999999996 27.437499999999996 22.112499999999997 64-65 21.49018627328416 27.91598949868734 27.97849731216402 22.615326915864483 66-67 21.7875 28.125 27.325 22.7625 68-69 21.77772221527691 28.128516064508062 27.953494186773348 22.14026753344168 70-71 22.662499999999998 28.275 27.6625 21.4 72-73 21.3875 27.750000000000004 28.5875 22.275 74-75 22.425 27.5625 28.3375 21.675 76-77 22.05 28.3625 27.525 22.0625 78-79 21.792948237059264 28.80720180045011 27.59439859964991 21.80545136284071 80-81 21.6635397123202 27.479674796747965 28.442776735459663 22.41400875547217 82-83 22.768192048012004 27.33183295823956 27.656914228557138 22.2430607651913 84-85 22.027753469183647 27.25340667583448 28.51606450806351 22.202775346918365 86-87 21.712500000000002 28.425 27.675 22.1875 88-89 22.725 27.8125 27.6 21.8625 90-91 21.1375 27.800000000000004 29.25 21.8125 92-93 21.925 27.5875 28.499999999999996 21.987499999999997 94-95 22.7625 28.4 26.950000000000003 21.8875 96-97 22.425 28.025 27.037499999999998 22.5125 98-99 22.15 27.8125 28.249999999999996 21.7875 100-101 22.1 28.449999999999996 27.650000000000002 21.8 102-103 22.8 27.075 28.075 22.05 104-105 22.775000000000002 27.6125 28.4375 21.175 106-107 23.025000000000002 27.212500000000002 27.5625 22.2 108-109 22.6875 28.1375 27.800000000000004 21.375 110-111 22.8875 27.775 27.650000000000002 21.6875 112-113 22.662499999999998 28.825 26.85 21.6625 114-115 22.8625 28.175 26.8375 22.125 116-117 22.525000000000002 29.312500000000004 27.175 20.9875 118-119 23.474999999999998 28.287499999999998 26.437500000000004 21.8 120-121 22.9875 28.6125 25.924999999999997 22.475 122-123 22.162499999999998 29.175 26.7625 21.9 124-125 23.3625 28.275 26.900000000000002 21.462500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 3.0 26 4.5 27 6.0 28 10.5 29 11.5 30 15.5 31 23.5 32 38.0 33 49.5 34 53.0 35 77.0 36 93.0 37 90.5 38 118.5 39 165.0 40 205.5 41 226.5 42 247.0 43 261.0 44 256.0 45 255.5 46 270.0 47 259.5 48 227.5 49 198.0 50 167.0 51 140.0 52 113.0 53 92.5 54 62.0 55 44.0 56 37.5 57 32.5 58 25.5 59 19.5 60 16.5 61 11.5 62 12.0 63 12.0 64 9.0 65 5.5 66 2.5 67 1.5 68 4.0 69 4.5 70 2.5 71 3.0 72 2.0 73 3.0 74 3.0 75 1.0 76 2.0 77 1.0 78 1.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.4250000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0125 66-67 0.0 68-69 0.0125 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.025 80-81 0.0625 82-83 0.025 84-85 0.0125 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.0875 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.9624999999999999 0.0 0.0 0.0 0.0 98-99 1.125 0.0 0.0 0.0 0.0 100-101 1.2625 0.0 0.0 0.0 0.0 102-103 1.6 0.0 0.0 0.0 0.0 104-105 1.9875 0.0 0.0 0.0 0.0 106-107 2.625 0.0 0.0 0.0 0.0 108-109 3.425 0.0 0.0 0.0 0.0 110-111 4.0125 0.0 0.0 0.0 0.0 112-113 4.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGAAGA 45 0.008998546 26.43611 116-117 AGATCGG 45 0.008998546 26.43611 112-113 >>END_MODULE Read 966544 spots for SRR3208032.sra Written 966544 spots for SRR3208032.sra Read 966544 spots for SRR3208032.sra Written 966544 spots for SRR3208032.sra Read 966544 spots for SRR3208032.sra Written 966544 spots for SRR3208032.sra Read 966544 spots for SRR3208032.sra Written 966544 spots for SRR3208032.sra Read 966544 spots for SRR3208032.sra Written 966544 spots for SRR3208032.sra Read 966544 spots for SRR3208032.sra Written 966544 spots for SRR3208032.sra Read 966544 spots for SRR3208032.sra Written 966544 spots for SRR3208032.sra Read 966544 spots for SRR3208032.sra Written 966544 spots for SRR3208032.sra Read 966544 spots for SRR3208032.sra Written 966544 spots for SRR3208032.sra Read 966544 spots for SRR3208032.sra Written 966544 spots for SRR3208032.sra Read 966544 spots for SRR3208032.sra Written 966544 spots for SRR3208032.sra Read 966544 spots for SRR3208032.sra Written 966544 spots for SRR3208032.sra Read 966544 spots for SRR3208032.sra Written 966544 spots for SRR3208032.sra Read 966544 spots for SRR3208032.sra Written 966544 spots for SRR3208032.sra Read 966544 spots for SRR3208032.sra Written 966544 spots for SRR3208032.sra Read 966563 spots for SRR3208032.sra Written 966563 spots for SRR3208032.sra Read 966544 spots for SRR3208032.sra Written 966544 spots for SRR3208032.sra Read 966544 spots for SRR3208032.sra Written 966544 spots for SRR3208032.sra Read 966544 spots for SRR3208032.sra Written 966544 spots for SRR3208032.sra Read 966544 spots for SRR3208032.sra Written 966544 spots for SRR3208032.sra SRR ids: ['SRR3208032.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ot4vy9dm SRR3208032.sra spots: 19330899 blocks: [[1, 966544], [966545, 1933088], [1933089, 2899632], [2899633, 3866176], [3866177, 4832720], [4832721, 5799264], [5799265, 6765808], [6765809, 7732352], [7732353, 8698896], [8698897, 9665440], [9665441, 10631984], [10631985, 11598528], [11598529, 12565072], [12565073, 13531616], [13531617, 14498160], [14498161, 15464704], [15464705, 16431248], [16431249, 17397792], [17397793, 18364336], [18364337, 19330899]] SRR3208032 file size 6190523 SRR3208032 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208032 SRR3208032_1.fastq Input file: SRR3208032_1.fastq trimmed: SRR3208032-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 02:40:45 2025 >> started Wed Feb 12 02:40:55 2025 >> done (9.985s) 19330899 reads processed; of these: 14623 ( 0.08%) short reads filtered out after trimming by size control 66153 ( 0.34%) empty reads filtered out after trimming by size control 19250123 (99.58%) reads available; of these: 2069668 (10.75%) trimmed reads available after processing 17180455 (89.25%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 591 0.00% 19 627 0.00% 20 891 0.00% 21 693 0.00% 22 774 0.00% 23 794 0.00% 24 905 0.00% 25 1132 0.01% 26 991 0.01% 27 986 0.01% 28 1013 0.01% 29 1002 0.01% 30 1247 0.01% 31 1151 0.01% 32 972 0.01% 33 907 0.00% 34 903 0.00% 35 972 0.01% 36 962 0.00% 37 950 0.00% 38 1005 0.01% 39 1009 0.01% 40 943 0.00% 41 986 0.01% 42 1057 0.01% 43 1033 0.01% 44 1073 0.01% 45 1057 0.01% 46 1051 0.01% 47 1076 0.01% 48 1105 0.01% 49 1137 0.01% 50 1238 0.01% 51 1195 0.01% 52 1230 0.01% 53 1248 0.01% 54 1296 0.01% 55 1330 0.01% 56 1360 0.01% 57 1387 0.01% 58 1453 0.01% 59 1588 0.01% 60 1632 0.01% 61 1662 0.01% 62 1763 0.01% 63 1705 0.01% 64 1760 0.01% 65 1779 0.01% 66 1821 0.01% 67 1914 0.01% 68 1972 0.01% 69 2210 0.01% 70 2259 0.01% 71 2458 0.01% 72 2411 0.01% 73 2562 0.01% 74 2723 0.01% 75 2900 0.02% 76 3121 0.02% 77 3256 0.02% 78 3389 0.02% 79 3911 0.02% 80 4229 0.02% 81 4521 0.02% 82 5072 0.03% 83 5775 0.03% 84 6080 0.03% 85 6464 0.03% 86 7002 0.04% 87 7689 0.04% 88 8588 0.04% 89 9783 0.05% 90 11004 0.06% 91 12326 0.06% 92 14276 0.07% 93 16027 0.08% 94 2660 0.01% 95 2818 0.01% 96 2983 0.02% 97 3043 0.02% 98 3352 0.02% 99 3624 0.02% 100 3941 0.02% 101 4339 0.02% 102 4529 0.02% 103 4875 0.03% 104 4465 0.02% 105 4979 0.03% 106 5235 0.03% 107 5602 0.03% 108 6212 0.03% 109 6755 0.04% 110 7447 0.04% 111 8385 0.04% 112 9569 0.05% 113 10993 0.06% 114 12850 0.07% 115 14973 0.08% 116 17437 0.09% 117 21158 0.11% 118 26638 0.14% 119 34939 0.18% 120 47198 0.25% 121 65555 0.34% 122 109190 0.57% 123 238211 1.24% 124 1165349 6.05% 125 17180455 89.25% 19250123 reads passed initial QC criterion=sequence-density sequence-density=3.96 sequence-density-rank=1 fanout-score=53.75 fanout-score-rank=1 prefix-density=5.44 prefix-fanout=39.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCTTGAAAAA criterion=fanout-score sequence-density=3.96 sequence-density-rank=1 fanout-score=53.75 fanout-score-rank=1 prefix-density=5.44 prefix-fanout=39.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCTTGAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCTTGAAAAA -o SRR3208032 - Input file: STDIN trimmed: SRR3208032-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 02:41:38 2025 >> started Wed Feb 12 02:41:48 2025 >> done (10.184s) 9625062 reads processed; of these: 148 ( 0.00%) short reads filtered out after trimming by size control 368 ( 0.00%) empty reads filtered out after trimming by size control 9624546 (99.99%) reads available; of these: 1207716 (12.55%) trimmed reads available after processing 8416830 (87.45%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 317 0.00% 19 328 0.00% 20 622 0.01% 21 332 0.00% 22 401 0.00% 23 392 0.00% 24 462 0.00% 25 559 0.01% 26 486 0.01% 27 482 0.01% 28 516 0.01% 29 538 0.01% 30 628 0.01% 31 594 0.01% 32 491 0.01% 33 441 0.00% 34 446 0.00% 35 505 0.01% 36 489 0.01% 37 475 0.00% 38 455 0.00% 39 499 0.01% 40 496 0.01% 41 486 0.01% 42 550 0.01% 43 515 0.01% 44 522 0.01% 45 556 0.01% 46 519 0.01% 47 571 0.01% 48 576 0.01% 49 570 0.01% 50 617 0.01% 51 602 0.01% 52 615 0.01% 53 616 0.01% 54 680 0.01% 55 642 0.01% 56 682 0.01% 57 722 0.01% 58 719 0.01% 59 802 0.01% 60 808 0.01% 61 838 0.01% 62 871 0.01% 63 852 0.01% 64 839 0.01% 65 847 0.01% 66 892 0.01% 67 918 0.01% 68 993 0.01% 69 1108 0.01% 70 1107 0.01% 71 1241 0.01% 72 1219 0.01% 73 1278 0.01% 74 1334 0.01% 75 1367 0.01% 76 1463 0.02% 77 1593 0.02% 78 1641 0.02% 79 1948 0.02% 80 2117 0.02% 81 2243 0.02% 82 2541 0.03% 83 2881 0.03% 84 3019 0.03% 85 3170 0.03% 86 3436 0.04% 87 3881 0.04% 88 4400 0.05% 89 4850 0.05% 90 5532 0.06% 91 6107 0.06% 92 7132 0.07% 93 8019 0.08% 94 8729 0.09% 95 9647 0.10% 96 10369 0.11% 97 11383 0.12% 98 12567 0.13% 99 14131 0.15% 100 16434 0.17% 101 18267 0.19% 102 20786 0.22% 103 23142 0.24% 104 25105 0.26% 105 26617 0.28% 106 28380 0.29% 107 29819 0.31% 108 31777 0.33% 109 34746 0.36% 110 38428 0.40% 111 42526 0.44% 112 46760 0.49% 113 51178 0.53% 114 55848 0.58% 115 58695 0.61% 116 61975 0.64% 117 64207 0.67% 118 69026 0.72% 119 76273 0.79% 120 95486 0.99% 121 140351 1.46% 122 294586 3.06% 123 107308 1.11% 124 523528 5.44% 125 7471471 77.63% criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=3.81 fanout-score-rank=27 prefix-density=0.15 prefix-fanout=2.8 sequence=TTCAACCAAGCGCG criterion=fanout-score sequence-density=0.04 sequence-density-rank=21 fanout-score=155.57 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=20.1 sequence=GCAGCAGCAGCAA Started job on | Feb 12 02:42:16 Started mapping on | Feb 12 02:42:16 Finished on | Feb 12 02:42:44 Mapping speed, Million of reads per hour | 2474.95 Number of input reads | 19249607 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 17482356 Uniquely mapped reads % | 90.82% Average mapped length | 122.73 Number of splices: Total | 6751071 Number of splices: Annotated (sjdb) | 6615485 Number of splices: GT/AG | 6646295 Number of splices: GC/AG | 85594 Number of splices: AT/AC | 6960 Number of splices: Non-canonical | 12222 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.11 Insertion rate per base | 0.02% Insertion average length | 1.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 385297 % of reads mapped to multiple loci | 2.00% Number of reads mapped to too many loci | 980991 % of reads mapped to too many loci | 5.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.07% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1381954 1381954 1381954 N_multimapping 385297 385297 385297 N_noFeature 780625 9079585 9068273 N_ambiguous 180052 32388 32872 UnstrandedReadsAssigned:16521679 PositiveStrandReadsAssigned:8370383 NegativeStrandReadsAssigned:8381211 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208032 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208032-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,249,607 reads, 17,718,269 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,239 rounds 52401 SRR3208032.ke.tsv 34699 SRR3208032.se.tsv 87100 total ==> SRR3208032.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 566 24.2569 Potri.005G024800.1.v4.1 1035 936 73 6.41417 Potri.004G059700.1.v4.1 961 862 8 0.763266 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 322.159 9.31609 Potri.016G087400.1.v4.1 270 171 741 356.382 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 91.5026 4.49543 Potri.012G127500.1.v4.1 977 878 2184 204.574 ==> SRR3208032.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1735 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 331 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 38 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 15 SRR3208032 completed mapping pipeline successfully