Starting /dee2/code/volunteer_pipeline.sh SRR3208033 current disk space = 3048973975552 free memory = 1579115992 SRR3208033 SRAfilesize 696a78964b0b3bfd0440d3e75f9b4a69 SRR3208033.sra SRR3208033.sra file validated SRR3208033 is single end SRR3208033 is conventional basespace SRR3208033 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208033_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.13025 33.0 33.0 33.0 33.0 33.0 2 31.9995 33.0 33.0 33.0 33.0 33.0 3 32.06125 33.0 33.0 33.0 33.0 33.0 4 32.24425 33.0 33.0 33.0 33.0 33.0 5 32.3125 33.0 33.0 33.0 33.0 33.0 6 35.7905 37.0 37.0 37.0 33.0 37.0 7 36.137 37.0 37.0 37.0 37.0 37.0 8 36.1295 37.0 37.0 37.0 37.0 37.0 9 36.12 37.0 37.0 37.0 37.0 37.0 10-11 36.15775 37.0 37.0 37.0 37.0 37.0 12-13 36.154625 37.0 37.0 37.0 37.0 37.0 14-15 36.165375 37.0 37.0 37.0 37.0 37.0 16-17 36.240875 37.0 37.0 37.0 37.0 37.0 18-19 36.2505 37.0 37.0 37.0 37.0 37.0 20-21 36.276875000000004 37.0 37.0 37.0 37.0 37.0 22-23 36.23075 37.0 37.0 37.0 37.0 37.0 24-25 36.17825 37.0 37.0 37.0 37.0 37.0 26-27 36.15 37.0 37.0 37.0 37.0 37.0 28-29 36.1755 37.0 37.0 37.0 37.0 37.0 30-31 36.1335 37.0 37.0 37.0 37.0 37.0 32-33 36.065124999999995 37.0 37.0 37.0 37.0 37.0 34-35 36.051874999999995 37.0 37.0 37.0 37.0 37.0 36-37 36.038624999999996 37.0 37.0 37.0 37.0 37.0 38-39 36.120625000000004 37.0 37.0 37.0 37.0 37.0 40-41 36.051249999999996 37.0 37.0 37.0 37.0 37.0 42-43 36.0745 37.0 37.0 37.0 37.0 37.0 44-45 36.144625000000005 37.0 37.0 37.0 37.0 37.0 46-47 36.128375 37.0 37.0 37.0 37.0 37.0 48-49 36.12775 37.0 37.0 37.0 37.0 37.0 50-51 36.1655 37.0 37.0 37.0 37.0 37.0 52-53 36.121875 37.0 37.0 37.0 37.0 37.0 54-55 36.12975 37.0 37.0 37.0 37.0 37.0 56-57 36.08 37.0 37.0 37.0 37.0 37.0 58-59 36.12125 37.0 37.0 37.0 37.0 37.0 60-61 36.092625 37.0 37.0 37.0 37.0 37.0 62-63 36.10525 37.0 37.0 37.0 37.0 37.0 64-65 36.0125 37.0 37.0 37.0 37.0 37.0 66-67 36.046125 37.0 37.0 37.0 37.0 37.0 68-69 36.016000000000005 37.0 37.0 37.0 37.0 37.0 70-71 35.99675 37.0 37.0 37.0 37.0 37.0 72-73 35.989000000000004 37.0 37.0 37.0 37.0 37.0 74-75 35.99325 37.0 37.0 37.0 37.0 37.0 76-77 35.99425 37.0 37.0 37.0 37.0 37.0 78-79 35.97024999999999 37.0 37.0 37.0 37.0 37.0 80-81 35.953125 37.0 37.0 37.0 37.0 37.0 82-83 36.017250000000004 37.0 37.0 37.0 37.0 37.0 84-85 35.92725 37.0 37.0 37.0 37.0 37.0 86-87 35.885625000000005 37.0 37.0 37.0 37.0 37.0 88-89 35.9095 37.0 37.0 37.0 37.0 37.0 90-91 35.90775 37.0 37.0 37.0 37.0 37.0 92-93 35.988625 37.0 37.0 37.0 37.0 37.0 94-95 35.92975 37.0 37.0 37.0 37.0 37.0 96-97 35.924375 37.0 37.0 37.0 37.0 37.0 98-99 35.91 37.0 37.0 37.0 37.0 37.0 100-101 35.803124999999994 37.0 37.0 37.0 37.0 37.0 102-103 35.856125000000006 37.0 37.0 37.0 37.0 37.0 104-105 35.816500000000005 37.0 37.0 37.0 37.0 37.0 106-107 35.799 37.0 37.0 37.0 37.0 37.0 108-109 35.779624999999996 37.0 37.0 37.0 37.0 37.0 110-111 35.691125 37.0 37.0 37.0 37.0 37.0 112-113 35.631125 37.0 37.0 37.0 37.0 37.0 114-115 35.638999999999996 37.0 37.0 37.0 37.0 37.0 116-117 35.55875 37.0 37.0 37.0 37.0 37.0 118-119 35.545875 37.0 37.0 37.0 35.0 37.0 120-121 35.48775 37.0 37.0 37.0 37.0 37.0 122-123 35.40625 37.0 37.0 37.0 37.0 37.0 124-125 33.92475 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 1.0 4 0.0 5 0.0 6 1.0 7 1.0 8 1.0 9 2.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 5.0 16 1.0 17 1.0 18 1.0 19 0.0 20 2.0 21 2.0 22 3.0 23 4.0 24 7.0 25 9.0 26 9.0 27 12.0 28 16.0 29 26.0 30 27.0 31 43.0 32 67.0 33 84.0 34 136.0 35 279.0 36 3231.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 20.9140201394268 15.233668990446683 14.433255873999485 49.41905499612703 2 18.65 22.725 38.824999999999996 19.8 3 21.55 25.15 26.825 26.474999999999998 4 23.43085771442861 31.13278319579895 20.955238809702426 24.48112028007002 5 24.325 33.5 24.224999999999998 17.95 6 18.7 36.975 23.9 20.424999999999997 7 18.075 19.1 42.449999999999996 20.375 8 18.8 24.15 30.825000000000003 26.224999999999998 9 19.75 24.425 31.924999999999997 23.9 10-11 21.95 34.0125 22.4375 21.6 12-13 20.674999999999997 26.3125 29.9875 23.025000000000002 14-15 20.875 28.237499999999997 28.287499999999998 22.6 16-17 21.6625 28.725 27.0125 22.6 18-19 22.3 28.1125 27.6625 21.925 20-21 21.349999999999998 28.4125 27.3 22.9375 22-23 22.2125 28.625 27.237499999999997 21.925 24-25 21.6625 28.075 28.3875 21.875 26-27 21.802725340667585 28.291036379547442 27.165895736967123 22.740342542817853 28-29 21.370513942728522 28.973365011879455 27.885457046392396 21.770663998999627 30-31 22.464040025015635 28.25515947467167 27.604752970606626 21.676047529706068 32-33 22.42242242242242 28.315815815815814 27.214714714714717 22.047047047047048 34-35 22.604453340005005 27.670753064798596 27.220415311483613 22.504378283712782 36-37 21.180295073768445 28.994748687171796 27.66941735433858 22.155538884721178 38-39 22.093023255813954 28.132033008252062 28.057014253563388 21.717929482370593 40-41 22.393098274568644 28.457114278569644 27.294323580895224 21.85546386596649 42-43 21.75543885971493 28.569642410602654 27.719429857464366 21.955488872218055 44-45 20.9 28.499999999999996 27.825 22.775000000000002 46-47 21.9375 27.8125 28.375 21.875 48-49 22.287499999999998 27.5625 27.5875 22.5625 50-51 22.1375 28.075 27.8625 21.925 52-53 21.85 29.225 26.424999999999997 22.5 54-55 21.349999999999998 28.812500000000004 27.224999999999998 22.6125 56-57 21.349999999999998 28.812500000000004 27.1375 22.7 58-59 22.075 29.049999999999997 26.950000000000003 21.925 60-61 22.55 27.537499999999998 27.287499999999998 22.625 62-63 22.0875 27.9125 27.737499999999997 22.2625 64-65 22.237499999999997 28.575 27.125 22.0625 66-67 22.0125 27.987499999999997 27.675 22.325 68-69 22.683506314868076 27.72289608603226 27.972989871201705 21.620607727897962 70-71 21.6875 28.225 28.025 22.0625 72-73 22.175 28.012500000000003 27.750000000000004 22.0625 74-75 21.8 27.1 28.6375 22.4625 76-77 21.3875 27.8625 28.6125 22.1375 78-79 21.320495185694636 29.260972864824307 27.810428910841566 21.608103038639488 80-81 21.634134134134133 28.053053053053052 27.677677677677675 22.635135135135133 82-83 21.025 28.5625 28.3625 22.05 84-85 21.925 28.000000000000004 27.3875 22.6875 86-87 22.35 27.35 27.900000000000002 22.400000000000002 88-89 22.2625 27.537499999999998 27.825 22.375 90-91 22.0125 27.5125 28.6375 21.837500000000002 92-93 22.5875 27.6875 28.299999999999997 21.425 94-95 22.125 27.8875 27.737499999999997 22.25 96-97 22.0 28.325 28.125 21.55 98-99 21.375 28.5625 27.5125 22.55 100-101 22.725 27.1625 27.787499999999998 22.325 102-103 21.5625 28.299999999999997 28.1625 21.975 104-105 22.1833187445292 28.61072902338377 27.19769913717644 22.00825309491059 106-107 23.146179817431538 27.872952357133922 27.697886707515316 21.28298111791922 108-109 21.945729648618233 29.498561960735277 26.860072527197698 21.695635863448793 110-111 22.7375 28.9375 27.1625 21.1625 112-113 23.1125 28.1625 27.800000000000004 20.925 114-115 23.1875 28.012500000000003 27.3375 21.462500000000002 116-117 23.6625 28.812500000000004 26.6125 20.9125 118-119 24.2375 28.549999999999997 26.1 21.1125 120-121 22.7 29.275000000000002 26.0125 22.0125 122-123 23.75 29.475 24.7875 21.987499999999997 124-125 23.849999999999998 29.65 25.137500000000003 21.3625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 2.0 23 1.5 24 0.5 25 1.5 26 3.5 27 5.5 28 7.5 29 11.0 30 24.5 31 37.0 32 38.0 33 42.5 34 59.0 35 70.0 36 93.0 37 115.5 38 136.0 39 165.0 40 180.0 41 223.0 42 249.0 43 254.0 44 267.5 45 275.0 46 265.5 47 246.5 48 221.5 49 189.5 50 161.0 51 127.0 52 107.5 53 93.5 54 69.0 55 47.5 56 33.5 57 26.5 58 24.5 59 18.5 60 18.0 61 13.0 62 8.5 63 9.0 64 6.5 65 8.5 66 7.5 67 4.5 68 4.5 69 4.0 70 2.5 71 1.5 72 2.5 73 3.5 74 3.5 75 1.5 76 0.5 77 2.0 78 2.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.175 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.0375 30-31 0.0625 32-33 0.1 34-35 0.075 36-37 0.025 38-39 0.025 40-41 0.025 42-43 0.025 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0375 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0375 80-81 0.1 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0375 106-107 0.0375 108-109 0.0375 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.2125 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.2625000000000002 0.0 0.0 0.0 0.0 102-103 1.6875 0.0 0.0 0.0 0.0 104-105 2.175 0.0 0.0 0.0 0.0 106-107 3.075 0.0 0.0 0.0 0.0 108-109 3.875 0.0 0.0 0.0 0.0 110-111 4.975 0.0 0.0 0.0 0.0 112-113 5.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1348425 spots for SRR3208033.sra Written 1348425 spots for SRR3208033.sra Read 1348425 spots for SRR3208033.sra Written 1348425 spots for SRR3208033.sra Read 1348425 spots for SRR3208033.sra Written 1348425 spots for SRR3208033.sra Read 1348425 spots for SRR3208033.sra Written 1348425 spots for SRR3208033.sra Read 1348425 spots for SRR3208033.sra Written 1348425 spots for SRR3208033.sra Read 1348425 spots for SRR3208033.sra Written 1348425 spots for SRR3208033.sra Read 1348425 spots for SRR3208033.sra Written 1348425 spots for SRR3208033.sra Read 1348425 spots for SRR3208033.sra Written 1348425 spots for SRR3208033.sra Read 1348425 spots for SRR3208033.sra Written 1348425 spots for SRR3208033.sra Read 1348425 spots for SRR3208033.sra Written 1348425 spots for SRR3208033.sra Read 1348425 spots for SRR3208033.sra Written 1348425 spots for SRR3208033.sra Read 1348425 spots for SRR3208033.sra Written 1348425 spots for SRR3208033.sra Read 1348425 spots for SRR3208033.sra Written 1348425 spots for SRR3208033.sra Read 1348425 spots for SRR3208033.sra Written 1348425 spots for SRR3208033.sra Read 1348425 spots for SRR3208033.sra Written 1348425 spots for SRR3208033.sra Read 1348425 spots for SRR3208033.sra Written 1348425 spots for SRR3208033.sra Read 1348425 spots for SRR3208033.sra Written 1348425 spots for SRR3208033.sra Read 1348425 spots for SRR3208033.sra Written 1348425 spots for SRR3208033.sra Read 1348425 spots for SRR3208033.sra Written 1348425 spots for SRR3208033.sra Read 1348436 spots for SRR3208033.sra Written 1348436 spots for SRR3208033.sra SRR ids: ['SRR3208033.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3y6i5w93 SRR3208033.sra spots: 26968511 blocks: [[1, 1348425], [1348426, 2696850], [2696851, 4045275], [4045276, 5393700], [5393701, 6742125], [6742126, 8090550], [8090551, 9438975], [9438976, 10787400], [10787401, 12135825], [12135826, 13484250], [13484251, 14832675], [14832676, 16181100], [16181101, 17529525], [17529526, 18877950], [18877951, 20226375], [20226376, 21574800], [21574801, 22923225], [22923226, 24271650], [24271651, 25620075], [25620076, 26968511]] SRR3208033 file size 8640652 SRR3208033 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208033 SRR3208033_1.fastq Input file: SRR3208033_1.fastq trimmed: SRR3208033-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 02:53:03 2025 >> started Wed Feb 12 02:53:17 2025 >> done (13.953s) 26968511 reads processed; of these: 26533 ( 0.10%) short reads filtered out after trimming by size control 140236 ( 0.52%) empty reads filtered out after trimming by size control 26801742 (99.38%) reads available; of these: 3130984 (11.68%) trimmed reads available after processing 23670758 (88.32%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1025 0.00% 19 1005 0.00% 20 1007 0.00% 21 1077 0.00% 22 1149 0.00% 23 1242 0.00% 24 1437 0.01% 25 1596 0.01% 26 1624 0.01% 27 1489 0.01% 28 1504 0.01% 29 1638 0.01% 30 2140 0.01% 31 1919 0.01% 32 1455 0.01% 33 1332 0.00% 34 1280 0.00% 35 1319 0.00% 36 1377 0.01% 37 1441 0.01% 38 1469 0.01% 39 1477 0.01% 40 1456 0.01% 41 1436 0.01% 42 1488 0.01% 43 1601 0.01% 44 1574 0.01% 45 1565 0.01% 46 1608 0.01% 47 1597 0.01% 48 1528 0.01% 49 1682 0.01% 50 1711 0.01% 51 1777 0.01% 52 1801 0.01% 53 1756 0.01% 54 1648 0.01% 55 2000 0.01% 56 1979 0.01% 57 2033 0.01% 58 2132 0.01% 59 2199 0.01% 60 2329 0.01% 61 2375 0.01% 62 2414 0.01% 63 2386 0.01% 64 2522 0.01% 65 2495 0.01% 66 2541 0.01% 67 2673 0.01% 68 2818 0.01% 69 3106 0.01% 70 3353 0.01% 71 3485 0.01% 72 3972 0.01% 73 4263 0.02% 74 4404 0.02% 75 4403 0.02% 76 4596 0.02% 77 4897 0.02% 78 5432 0.02% 79 6196 0.02% 80 6877 0.03% 81 7786 0.03% 82 8908 0.03% 83 9929 0.04% 84 10651 0.04% 85 11795 0.04% 86 12554 0.05% 87 14074 0.05% 88 15672 0.06% 89 17809 0.07% 90 20387 0.08% 91 23444 0.09% 92 27354 0.10% 93 30142 0.11% 94 4234 0.02% 95 4410 0.02% 96 4565 0.02% 97 4985 0.02% 98 5196 0.02% 99 5478 0.02% 100 5733 0.02% 101 6101 0.02% 102 6763 0.03% 103 6846 0.03% 104 7299 0.03% 105 7468 0.03% 106 8184 0.03% 107 8721 0.03% 108 9615 0.04% 109 10550 0.04% 110 11754 0.04% 111 13006 0.05% 112 14594 0.05% 113 16721 0.06% 114 18952 0.07% 115 21975 0.08% 116 25744 0.10% 117 30652 0.11% 118 40179 0.15% 119 52219 0.19% 120 71655 0.27% 121 146061 0.54% 122 159966 0.60% 123 375335 1.40% 124 1672408 6.24% 125 23670758 88.32% 26801742 reads passed initial QC criterion=sequence-density sequence-density=5.25 sequence-density-rank=1 fanout-score=50.70 fanout-score-rank=1 prefix-density=7.03 prefix-fanout=37.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC criterion=fanout-score sequence-density=5.25 sequence-density-rank=1 fanout-score=50.70 fanout-score-rank=1 prefix-density=7.03 prefix-fanout=37.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC -o SRR3208033 - Input file: STDIN trimmed: SRR3208033-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 02:54:16 2025 >> started Wed Feb 12 02:54:34 2025 >> done (18.270s) 17867828 reads processed; of these: 161 ( 0.00%) short reads filtered out after trimming by size control 737 ( 0.00%) empty reads filtered out after trimming by size control 17866930 (99.99%) reads available; of these: 2665160 (14.92%) trimmed reads available after processing 15201770 (85.08%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 691 0.00% 19 682 0.00% 20 684 0.00% 21 730 0.00% 22 781 0.00% 23 846 0.00% 24 926 0.01% 25 1068 0.01% 26 1063 0.01% 27 966 0.01% 28 987 0.01% 29 1119 0.01% 30 1411 0.01% 31 1278 0.01% 32 997 0.01% 33 881 0.00% 34 860 0.00% 35 900 0.01% 36 913 0.01% 37 986 0.01% 38 968 0.01% 39 967 0.01% 40 984 0.01% 41 954 0.01% 42 977 0.01% 43 1081 0.01% 44 1048 0.01% 45 1061 0.01% 46 1066 0.01% 47 1069 0.01% 48 1000 0.01% 49 1115 0.01% 50 1145 0.01% 51 1219 0.01% 52 1187 0.01% 53 1148 0.01% 54 1067 0.01% 55 1361 0.01% 56 1314 0.01% 57 1370 0.01% 58 1373 0.01% 59 1467 0.01% 60 1581 0.01% 61 1604 0.01% 62 1582 0.01% 63 1600 0.01% 64 1693 0.01% 65 1657 0.01% 66 1669 0.01% 67 1766 0.01% 68 1892 0.01% 69 2052 0.01% 70 2224 0.01% 71 2292 0.01% 72 2536 0.01% 73 2667 0.01% 74 2785 0.02% 75 2906 0.02% 76 3048 0.02% 77 3362 0.02% 78 3693 0.02% 79 4190 0.02% 80 4572 0.03% 81 5205 0.03% 82 5942 0.03% 83 6651 0.04% 84 7253 0.04% 85 7877 0.04% 86 8431 0.05% 87 9472 0.05% 88 10420 0.06% 89 12045 0.07% 90 13736 0.08% 91 15333 0.09% 92 18106 0.10% 93 20042 0.11% 94 22818 0.13% 95 24921 0.14% 96 26827 0.15% 97 29005 0.16% 98 32214 0.18% 99 36126 0.20% 100 40343 0.23% 101 45473 0.25% 102 51812 0.29% 103 57043 0.32% 104 62284 0.35% 105 65461 0.37% 106 68838 0.39% 107 72431 0.41% 108 76952 0.43% 109 82279 0.46% 110 90000 0.50% 111 97840 0.55% 112 107862 0.60% 113 116710 0.65% 114 124397 0.70% 115 130347 0.73% 116 134505 0.75% 117 138373 0.77% 118 147810 0.83% 119 161489 0.90% 120 197721 1.11% 121 306039 1.71% 122 557337 3.12% 123 220333 1.23% 124 983985 5.51% 125 13321761 74.56% criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=4.61 fanout-score-rank=20 prefix-density=0.11 prefix-fanout=3.0 sequence=TTCAACCAAGCGCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=356.36 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=15.4 sequence=CAGCAGCAAGACAAACCGAATTATTCATAAGTACCAATAAAATAAGCATTGCGCAAAAGGGATAGGATAAATCACTCTTAAGCTTGAGGCTTCTCCCATTTGAGGGGCTTGACAACTTCCCAGGTGAAGTCTGGGTCATCCCTTCCAAAATGTCCGTATGCAGCTGTCTTCAAGAACCTATTACCCCCCCTCTTGAGATCCAGGTTGATGGTCATCATTCCAGGCCTAAAGTCAAAG Started job on | Feb 12 02:55:05 Started mapping on | Feb 12 02:55:05 Finished on | Feb 12 02:55:38 Mapping speed, Million of reads per hour | 2923.73 Number of input reads | 26800844 Average input read length | 122 UNIQUE READS: Uniquely mapped reads number | 24961998 Uniquely mapped reads % | 93.14% Average mapped length | 122.20 Number of splices: Total | 9317313 Number of splices: Annotated (sjdb) | 9129223 Number of splices: GT/AG | 9174444 Number of splices: GC/AG | 116821 Number of splices: AT/AC | 9229 Number of splices: Non-canonical | 16819 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.13 Insertion rate per base | 0.02% Insertion average length | 1.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 531927 % of reads mapped to multiple loci | 1.98% Number of reads mapped to too many loci | 960909 % of reads mapped to too many loci | 3.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.28% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1306919 1306919 1306919 N_multimapping 531927 531927 531927 N_noFeature 1137637 12968623 12958317 N_ambiguous 266233 46191 47845 UnstrandedReadsAssigned:23558128 PositiveStrandReadsAssigned:11947184 NegativeStrandReadsAssigned:11955836 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208033 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208033-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,800,844 reads, 24,868,640 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52401 SRR3208033.ke.tsv 34699 SRR3208033.se.tsv 87100 total ==> SRR3208033.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 749 22.8194 Potri.005G024800.1.v4.1 1035 936 90 5.62165 Potri.004G059700.1.v4.1 961 862 18 1.22085 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 423.594 8.70799 Potri.016G087400.1.v4.1 270 171 1037 354.552 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 116 4.05135 Potri.012G127500.1.v4.1 977 878 3601 239.787 ==> SRR3208033.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2521 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 482 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 52 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 19 SRR3208033 completed mapping pipeline successfully