Starting /dee2/code/volunteer_pipeline.sh SRR3208034 current disk space = 3049187848192 free memory = 1484933132 SRR3208034 SRAfilesize 1a521042d5d9703908a3fa6b6e586a7d SRR3208034.sra SRR3208034.sra file validated SRR3208034 is single end SRR3208034 is conventional basespace SRR3208034 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208034_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.41825 33.0 33.0 33.0 33.0 33.0 2 32.05325 33.0 33.0 33.0 33.0 33.0 3 32.0305 33.0 33.0 33.0 33.0 33.0 4 32.1475 33.0 33.0 33.0 33.0 33.0 5 32.23475 33.0 33.0 33.0 33.0 33.0 6 35.90275 37.0 37.0 37.0 37.0 37.0 7 36.067 37.0 37.0 37.0 37.0 37.0 8 36.02775 37.0 37.0 37.0 37.0 37.0 9 36.0595 37.0 37.0 37.0 37.0 37.0 10-11 36.103625 37.0 37.0 37.0 37.0 37.0 12-13 36.079375 37.0 37.0 37.0 37.0 37.0 14-15 36.082625 37.0 37.0 37.0 37.0 37.0 16-17 36.08475 37.0 37.0 37.0 37.0 37.0 18-19 36.1515 37.0 37.0 37.0 37.0 37.0 20-21 36.1235 37.0 37.0 37.0 37.0 37.0 22-23 36.05525 37.0 37.0 37.0 37.0 37.0 24-25 36.077375 37.0 37.0 37.0 37.0 37.0 26-27 36.11775 37.0 37.0 37.0 37.0 37.0 28-29 36.0895 37.0 37.0 37.0 37.0 37.0 30-31 36.08175 37.0 37.0 37.0 37.0 37.0 32-33 36.06975 37.0 37.0 37.0 37.0 37.0 34-35 36.012375 37.0 37.0 37.0 37.0 37.0 36-37 35.947375 37.0 37.0 37.0 37.0 37.0 38-39 36.044875000000005 37.0 37.0 37.0 37.0 37.0 40-41 35.99225 37.0 37.0 37.0 37.0 37.0 42-43 36.016 37.0 37.0 37.0 37.0 37.0 44-45 35.956125 37.0 37.0 37.0 37.0 37.0 46-47 35.99275 37.0 37.0 37.0 37.0 37.0 48-49 35.9825 37.0 37.0 37.0 37.0 37.0 50-51 35.95 37.0 37.0 37.0 37.0 37.0 52-53 36.02525 37.0 37.0 37.0 37.0 37.0 54-55 36.007125 37.0 37.0 37.0 37.0 37.0 56-57 35.983125 37.0 37.0 37.0 37.0 37.0 58-59 35.987624999999994 37.0 37.0 37.0 37.0 37.0 60-61 35.99925 37.0 37.0 37.0 37.0 37.0 62-63 36.080375000000004 37.0 37.0 37.0 37.0 37.0 64-65 36.03175 37.0 37.0 37.0 37.0 37.0 66-67 35.988749999999996 37.0 37.0 37.0 37.0 37.0 68-69 35.909375 37.0 37.0 37.0 37.0 37.0 70-71 35.952 37.0 37.0 37.0 37.0 37.0 72-73 35.904375 37.0 37.0 37.0 37.0 37.0 74-75 35.766875 37.0 37.0 37.0 37.0 37.0 76-77 35.740875 37.0 37.0 37.0 37.0 37.0 78-79 35.75925 37.0 37.0 37.0 37.0 37.0 80-81 35.801375 37.0 37.0 37.0 37.0 37.0 82-83 35.61025 37.0 37.0 37.0 37.0 37.0 84-85 35.696375 37.0 37.0 37.0 37.0 37.0 86-87 35.693625 37.0 37.0 37.0 37.0 37.0 88-89 35.71662499999999 37.0 37.0 37.0 37.0 37.0 90-91 35.699875 37.0 37.0 37.0 37.0 37.0 92-93 35.632374999999996 37.0 37.0 37.0 37.0 37.0 94-95 35.5965 37.0 37.0 37.0 37.0 37.0 96-97 35.64725 37.0 37.0 37.0 37.0 37.0 98-99 35.568375 37.0 37.0 37.0 37.0 37.0 100-101 35.570499999999996 37.0 37.0 37.0 37.0 37.0 102-103 35.519625000000005 37.0 37.0 37.0 37.0 37.0 104-105 35.507125 37.0 37.0 37.0 37.0 37.0 106-107 35.501875 37.0 37.0 37.0 37.0 37.0 108-109 35.471374999999995 37.0 37.0 37.0 37.0 37.0 110-111 35.338375 37.0 37.0 37.0 35.0 37.0 112-113 35.313375 37.0 37.0 37.0 37.0 37.0 114-115 35.35125 37.0 37.0 37.0 37.0 37.0 116-117 35.28025 37.0 37.0 37.0 35.0 37.0 118-119 35.274625 37.0 37.0 37.0 37.0 37.0 120-121 35.227875 37.0 37.0 37.0 35.0 37.0 122-123 35.158625 37.0 37.0 37.0 33.0 37.0 124-125 33.542249999999996 37.0 35.0 37.0 17.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 37.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 1.0 9 3.0 10 1.0 11 1.0 12 1.0 13 0.0 14 0.0 15 3.0 16 3.0 17 2.0 18 1.0 19 3.0 20 4.0 21 4.0 22 17.0 23 6.0 24 6.0 25 10.0 26 6.0 27 18.0 28 18.0 29 24.0 30 36.0 31 40.0 32 60.0 33 77.0 34 120.0 35 234.0 36 3263.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.72032603158431 15.282730514518594 13.627101375445747 48.36984207845135 2 18.7 20.875 39.825 20.599999999999998 3 21.4 24.25 28.499999999999996 25.85 4 23.35 30.925000000000004 21.775 23.95 5 25.7 33.650000000000006 23.325000000000003 17.325 6 19.775000000000002 37.85 22.75 19.625 7 16.900000000000002 19.400000000000002 43.7 20.0 8 18.3 24.075 29.925 27.700000000000003 9 19.675 23.45 33.25 23.625 10-11 22.725 32.45 23.325000000000003 21.5 12-13 20.4125 26.687499999999996 29.812499999999996 23.0875 14-15 21.087500000000002 27.8625 28.449999999999996 22.6 16-17 22.650000000000002 28.0625 27.3375 21.95 18-19 21.4875 28.775000000000002 27.55 22.1875 20-21 22.175 27.875 28.1625 21.7875 22-23 21.875 27.537499999999998 27.462500000000002 23.125 24-25 20.8125 29.1625 27.474999999999998 22.55 26-27 21.587500000000002 28.0625 27.474999999999998 22.875 28-29 21.2375 27.3125 28.287499999999998 23.1625 30-31 21.3625 28.1125 28.487499999999997 22.037499999999998 32-33 21.453590192644484 28.533900425318986 27.220415311483613 22.792094070552913 34-35 21.920720270101288 28.72327122671002 27.11016631236714 22.24584219082156 36-37 21.1875 29.325000000000003 27.3375 22.15 38-39 21.875 28.125 27.962500000000002 22.037499999999998 40-41 22.275 28.749999999999996 27.212500000000002 21.762500000000003 42-43 21.5 28.275 27.650000000000002 22.575 44-45 21.0625 28.299999999999997 28.537499999999998 22.1 46-47 21.4375 29.025000000000002 27.4125 22.125 48-49 21.625 28.6875 27.35 22.3375 50-51 21.95 27.500000000000004 27.9375 22.6125 52-53 22.475 27.5125 27.8125 22.2 54-55 21.337500000000002 27.900000000000002 28.7 22.0625 56-57 21.5 28.287499999999998 28.6125 21.6 58-59 22.2625 27.425 28.8625 21.45 60-61 22.125 27.987499999999997 27.85 22.037499999999998 62-63 21.3875 28.6125 26.987499999999997 23.0125 64-65 22.112499999999997 28.6875 27.500000000000004 21.7 66-67 22.1375 28.249999999999996 27.525 22.0875 68-69 21.7875 28.8375 27.737499999999997 21.637500000000003 70-71 21.6875 28.7 27.925 21.6875 72-73 21.375 27.85 28.7 22.075 74-75 21.25 28.1125 28.237499999999997 22.400000000000002 76-77 21.8 28.0625 28.599999999999998 21.5375 78-79 21.8875 28.65 27.750000000000004 21.712500000000002 80-81 22.162499999999998 28.499999999999996 27.275 22.0625 82-83 21.8 28.8875 27.775 21.5375 84-85 22.5125 28.012500000000003 27.975 21.5 86-87 22.112499999999997 28.1125 27.8625 21.912499999999998 88-89 21.9625 27.8375 27.55 22.650000000000002 90-91 21.7 27.975 28.012500000000003 22.3125 92-93 22.15 28.3125 27.900000000000002 21.637500000000003 94-95 21.775 28.0625 28.6625 21.5 96-97 23.2375 27.85 27.450000000000003 21.462500000000002 98-99 21.712500000000002 28.037499999999998 27.700000000000003 22.55 100-101 23.025000000000002 27.800000000000004 27.437499999999996 21.7375 102-103 22.35 28.3625 27.0875 22.2 104-105 22.2 28.625 27.6375 21.5375 106-107 22.0625 28.787499999999998 26.8625 22.287499999999998 108-109 22.075 28.962500000000002 27.1 21.8625 110-111 23.2375 28.212500000000002 26.8 21.75 112-113 21.7 28.8875 27.55 21.8625 114-115 23.025000000000002 29.562500000000004 26.0625 21.349999999999998 116-117 22.7125 29.062500000000004 26.5625 21.6625 118-119 22.5625 28.762500000000003 27.250000000000004 21.425 120-121 22.912499999999998 29.125 26.0 21.9625 122-123 23.2875 28.9375 26.0125 21.762500000000003 124-125 23.4125 29.062500000000004 25.4625 22.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.0 23 0.0 24 1.5 25 3.5 26 3.0 27 5.5 28 11.0 29 9.5 30 12.5 31 19.5 32 28.5 33 44.5 34 51.0 35 65.5 36 97.5 37 120.0 38 138.0 39 167.0 40 206.5 41 241.5 42 256.5 43 265.0 44 279.5 45 272.0 46 257.0 47 243.5 48 219.0 49 183.0 50 164.5 51 150.5 52 112.0 53 82.5 54 64.0 55 46.5 56 33.0 57 29.0 58 20.5 59 12.5 60 14.0 61 15.0 62 12.0 63 8.0 64 5.0 65 4.0 66 3.5 67 5.0 68 4.5 69 2.5 70 2.0 71 1.5 72 0.5 73 0.0 74 0.0 75 1.0 76 1.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.8499999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.075 34-35 0.0375 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69788519637463 99.0 2 0.22658610271903326 0.44999999999999996 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025176233635448138 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC 16 0.4 TruSeq Adapter, Index 4 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1125 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.9125 0.0 0.0 0.0 0.0 98-99 1.15 0.0 0.0 0.0 0.0 100-101 1.3375 0.0 0.0 0.0 0.0 102-103 1.675 0.0 0.0 0.0 0.0 104-105 2.1125 0.0 0.0 0.0 0.0 106-107 2.5875 0.0 0.0 0.0 0.0 108-109 2.975 0.0 0.0 0.0 0.0 110-111 3.5875 0.0 0.0 0.0 0.0 112-113 4.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 733476 spots for SRR3208034.sra Written 733476 spots for SRR3208034.sra Read 733476 spots for SRR3208034.sra Written 733476 spots for SRR3208034.sra Read 733476 spots for SRR3208034.sra Written 733476 spots for SRR3208034.sra Read 733476 spots for SRR3208034.sra Written 733476 spots for SRR3208034.sra Read 733476 spots for SRR3208034.sra Written 733476 spots for SRR3208034.sra Read 733476 spots for SRR3208034.sra Written 733476 spots for SRR3208034.sra Read 733476 spots for SRR3208034.sra Written 733476 spots for SRR3208034.sra Read 733476 spots for SRR3208034.sra Written 733476 spots for SRR3208034.sra Read 733476 spots for SRR3208034.sra Written 733476 spots for SRR3208034.sra Read 733476 spots for SRR3208034.sra Written 733476 spots for SRR3208034.sra Read 733476 spots for SRR3208034.sra Written 733476 spots for SRR3208034.sra Read 733476 spots for SRR3208034.sra Written 733476 spots for SRR3208034.sra Read 733476 spots for SRR3208034.sra Written 733476 spots for SRR3208034.sra Read 733476 spots for SRR3208034.sra Written 733476 spots for SRR3208034.sra Read 733476 spots for SRR3208034.sra Written 733476 spots for SRR3208034.sra Read 733476 spots for SRR3208034.sra Written 733476 spots for SRR3208034.sra Read 733476 spots for SRR3208034.sra Written 733476 spots for SRR3208034.sra Read 733476 spots for SRR3208034.sra Written 733476 spots for SRR3208034.sra Read 733495 spots for SRR3208034.sra Written 733495 spots for SRR3208034.sra Read 733476 spots for SRR3208034.sra Written 733476 spots for SRR3208034.sra SRR ids: ['SRR3208034.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_led9gfdd SRR3208034.sra spots: 14669539 blocks: [[1, 733476], [733477, 1466952], [1466953, 2200428], [2200429, 2933904], [2933905, 3667380], [3667381, 4400856], [4400857, 5134332], [5134333, 5867808], [5867809, 6601284], [6601285, 7334760], [7334761, 8068236], [8068237, 8801712], [8801713, 9535188], [9535189, 10268664], [10268665, 11002140], [11002141, 11735616], [11735617, 12469092], [12469093, 13202568], [13202569, 13936044], [13936045, 14669539]] SRR3208034 file size 4695138 SRR3208034 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208034 SRR3208034_1.fastq Input file: SRR3208034_1.fastq trimmed: SRR3208034-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 02:32:42 2025 >> started Wed Feb 12 02:32:50 2025 >> done (8.374s) 14669539 reads processed; of these: 13632 ( 0.09%) short reads filtered out after trimming by size control 119002 ( 0.81%) empty reads filtered out after trimming by size control 14536905 (99.10%) reads available; of these: 1642969 (11.30%) trimmed reads available after processing 12893936 (88.70%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 548 0.00% 19 608 0.00% 20 1648 0.01% 21 667 0.00% 22 633 0.00% 23 811 0.01% 24 836 0.01% 25 958 0.01% 26 897 0.01% 27 764 0.01% 28 859 0.01% 29 973 0.01% 30 1255 0.01% 31 1258 0.01% 32 831 0.01% 33 798 0.01% 34 710 0.00% 35 745 0.01% 36 783 0.01% 37 870 0.01% 38 858 0.01% 39 761 0.01% 40 838 0.01% 41 862 0.01% 42 855 0.01% 43 812 0.01% 44 885 0.01% 45 883 0.01% 46 923 0.01% 47 866 0.01% 48 909 0.01% 49 896 0.01% 50 979 0.01% 51 1008 0.01% 52 990 0.01% 53 1043 0.01% 54 979 0.01% 55 1035 0.01% 56 1076 0.01% 57 1139 0.01% 58 1153 0.01% 59 1262 0.01% 60 1230 0.01% 61 1309 0.01% 62 1446 0.01% 63 2577 0.02% 64 1496 0.01% 65 1512 0.01% 66 1404 0.01% 67 1442 0.01% 68 1573 0.01% 69 1549 0.01% 70 1687 0.01% 71 1850 0.01% 72 2342 0.02% 73 2525 0.02% 74 2695 0.02% 75 2377 0.02% 76 2198 0.02% 77 2270 0.02% 78 2483 0.02% 79 2693 0.02% 80 2904 0.02% 81 3439 0.02% 82 3583 0.02% 83 4017 0.03% 84 4310 0.03% 85 4637 0.03% 86 5184 0.04% 87 5581 0.04% 88 6353 0.04% 89 7187 0.05% 90 8012 0.06% 91 9108 0.06% 92 10540 0.07% 93 11931 0.08% 94 2266 0.02% 95 2406 0.02% 96 2492 0.02% 97 2679 0.02% 98 2785 0.02% 99 2929 0.02% 100 3172 0.02% 101 3261 0.02% 102 3507 0.02% 103 3566 0.02% 104 3845 0.03% 105 3930 0.03% 106 4301 0.03% 107 4537 0.03% 108 5064 0.03% 109 5581 0.04% 110 6148 0.04% 111 6707 0.05% 112 7561 0.05% 113 8684 0.06% 114 9990 0.07% 115 11561 0.08% 116 13398 0.09% 117 16233 0.11% 118 20545 0.14% 119 27288 0.19% 120 37295 0.26% 121 77202 0.53% 122 83906 0.58% 123 198851 1.37% 124 897371 6.17% 125 12893936 88.70% 14536905 reads passed initial QC criterion=sequence-density sequence-density=4.06 sequence-density-rank=1 fanout-score=48.87 fanout-score-rank=1 prefix-density=5.59 prefix-fanout=35.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=4.06 sequence-density-rank=1 fanout-score=48.87 fanout-score-rank=1 prefix-density=5.59 prefix-fanout=35.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR3208034 - Input file: STDIN trimmed: SRR3208034-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 02:33:25 2025 >> started Wed Feb 12 02:33:35 2025 >> done (9.902s) 8722143 reads processed; of these: 174 ( 0.00%) short reads filtered out after trimming by size control 2995 ( 0.03%) empty reads filtered out after trimming by size control 8718974 (99.96%) reads available; of these: 1120234 (12.85%) trimmed reads available after processing 7598740 (87.15%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 314 0.00% 19 367 0.00% 20 1288 0.01% 21 426 0.00% 22 418 0.00% 23 491 0.01% 24 494 0.01% 25 584 0.01% 26 559 0.01% 27 458 0.01% 28 524 0.01% 29 573 0.01% 30 773 0.01% 31 751 0.01% 32 506 0.01% 33 487 0.01% 34 422 0.00% 35 460 0.01% 36 472 0.01% 37 514 0.01% 38 515 0.01% 39 449 0.01% 40 499 0.01% 41 529 0.01% 42 525 0.01% 43 498 0.01% 44 535 0.01% 45 554 0.01% 46 561 0.01% 47 551 0.01% 48 542 0.01% 49 555 0.01% 50 588 0.01% 51 599 0.01% 52 609 0.01% 53 659 0.01% 54 614 0.01% 55 629 0.01% 56 670 0.01% 57 685 0.01% 58 658 0.01% 59 768 0.01% 60 773 0.01% 61 775 0.01% 62 831 0.01% 63 802 0.01% 64 836 0.01% 65 869 0.01% 66 817 0.01% 67 839 0.01% 68 920 0.01% 69 905 0.01% 70 993 0.01% 71 1035 0.01% 72 1148 0.01% 73 1088 0.01% 74 1088 0.01% 75 1210 0.01% 76 1293 0.01% 77 1319 0.02% 78 1467 0.02% 79 1611 0.02% 80 1749 0.02% 81 2077 0.02% 82 2133 0.02% 83 2320 0.03% 84 2503 0.03% 85 2863 0.03% 86 3118 0.04% 87 3341 0.04% 88 3711 0.04% 89 4236 0.05% 90 4849 0.06% 91 5415 0.06% 92 6198 0.07% 93 7071 0.08% 94 7927 0.09% 95 8819 0.10% 96 9697 0.11% 97 10452 0.12% 98 11653 0.13% 99 12878 0.15% 100 14836 0.17% 101 17016 0.20% 102 19293 0.22% 103 21191 0.24% 104 23488 0.27% 105 25231 0.29% 106 26610 0.31% 107 28531 0.33% 108 30372 0.35% 109 32695 0.37% 110 35921 0.41% 111 39545 0.45% 112 43887 0.50% 113 47615 0.55% 114 51626 0.59% 115 54861 0.63% 116 57081 0.65% 117 60035 0.69% 118 64270 0.74% 119 71003 0.81% 120 88846 1.02% 121 143528 1.65% 122 270796 3.11% 123 107631 1.23% 124 484018 5.55% 125 6701746 76.86% criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=31.96 fanout-score-rank=11 prefix-density=0.16 prefix-fanout=11.7 sequence=CTGCAGCTGCAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=332.73 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=29.8 sequence=TTCTTCTTCTTT Started job on | Feb 12 02:34:03 Started mapping on | Feb 12 02:34:03 Finished on | Feb 12 02:34:22 Mapping speed, Million of reads per hour | 2753.76 Number of input reads | 14533736 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 13766250 Uniquely mapped reads % | 94.72% Average mapped length | 122.62 Number of splices: Total | 5191793 Number of splices: Annotated (sjdb) | 5086137 Number of splices: GT/AG | 5111291 Number of splices: GC/AG | 65835 Number of splices: AT/AC | 5334 Number of splices: Non-canonical | 9333 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.14 Insertion rate per base | 0.02% Insertion average length | 1.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 285992 % of reads mapped to multiple loci | 1.97% Number of reads mapped to too many loci | 236379 % of reads mapped to too many loci | 1.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.68% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 481494 481494 481494 N_multimapping 285992 285992 285992 N_noFeature 616435 7135596 7151559 N_ambiguous 146621 25460 25937 UnstrandedReadsAssigned:13003194 PositiveStrandReadsAssigned:6605194 NegativeStrandReadsAssigned:6588754 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208034 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208034-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,533,736 reads, 13,458,008 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,205 rounds 52401 SRR3208034.ke.tsv 34699 SRR3208034.se.tsv 87100 total ==> SRR3208034.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 428.498 23.8919 Potri.005G024800.1.v4.1 1035 936 70 8.00199 Potri.004G059700.1.v4.1 961 862 14 1.73779 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 222.349 8.36529 Potri.016G087400.1.v4.1 270 171 553 346.023 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 72 4.60206 Potri.012G127500.1.v4.1 977 878 2399 292.356 ==> SRR3208034.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1235 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 278 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 24 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR3208034 completed mapping pipeline successfully