Starting /dee2/code/volunteer_pipeline.sh SRR3208035 current disk space = 3049007865856 free memory = 1577956616 SRR3208035 SRAfilesize 21e5fa0bde0e9e3047a0a4cf9ef31490 SRR3208035.sra SRR3208035.sra file validated SRR3208035 is single end SRR3208035 is conventional basespace SRR3208035 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208035_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7855 33.0 33.0 33.0 33.0 33.0 2 32.2685 33.0 33.0 33.0 33.0 33.0 3 32.14925 33.0 33.0 33.0 33.0 33.0 4 32.30875 33.0 33.0 33.0 33.0 33.0 5 32.3535 33.0 33.0 33.0 33.0 33.0 6 36.01575 37.0 37.0 37.0 37.0 37.0 7 36.23625 37.0 37.0 37.0 37.0 37.0 8 36.252 37.0 37.0 37.0 37.0 37.0 9 36.231 37.0 37.0 37.0 37.0 37.0 10-11 36.181749999999994 37.0 37.0 37.0 37.0 37.0 12-13 36.220749999999995 37.0 37.0 37.0 37.0 37.0 14-15 36.22225 37.0 37.0 37.0 37.0 37.0 16-17 36.29325 37.0 37.0 37.0 37.0 37.0 18-19 36.238125 37.0 37.0 37.0 37.0 37.0 20-21 36.272999999999996 37.0 37.0 37.0 37.0 37.0 22-23 36.304125 37.0 37.0 37.0 37.0 37.0 24-25 36.258250000000004 37.0 37.0 37.0 37.0 37.0 26-27 36.253125 37.0 37.0 37.0 37.0 37.0 28-29 36.24825 37.0 37.0 37.0 37.0 37.0 30-31 36.2595 37.0 37.0 37.0 37.0 37.0 32-33 36.164375 37.0 37.0 37.0 37.0 37.0 34-35 36.145624999999995 37.0 37.0 37.0 37.0 37.0 36-37 36.182874999999996 37.0 37.0 37.0 37.0 37.0 38-39 36.202875 37.0 37.0 37.0 37.0 37.0 40-41 36.19425 37.0 37.0 37.0 37.0 37.0 42-43 36.177125000000004 37.0 37.0 37.0 37.0 37.0 44-45 36.191625 37.0 37.0 37.0 37.0 37.0 46-47 36.244375000000005 37.0 37.0 37.0 37.0 37.0 48-49 36.212875 37.0 37.0 37.0 37.0 37.0 50-51 36.179625 37.0 37.0 37.0 37.0 37.0 52-53 36.1435 37.0 37.0 37.0 37.0 37.0 54-55 36.101 37.0 37.0 37.0 37.0 37.0 56-57 36.1315 37.0 37.0 37.0 37.0 37.0 58-59 36.169250000000005 37.0 37.0 37.0 37.0 37.0 60-61 36.146125 37.0 37.0 37.0 37.0 37.0 62-63 36.168125 37.0 37.0 37.0 37.0 37.0 64-65 36.093625 37.0 37.0 37.0 37.0 37.0 66-67 36.11875 37.0 37.0 37.0 37.0 37.0 68-69 36.106625 37.0 37.0 37.0 37.0 37.0 70-71 36.085875 37.0 37.0 37.0 37.0 37.0 72-73 36.053375 37.0 37.0 37.0 37.0 37.0 74-75 36.045500000000004 37.0 37.0 37.0 37.0 37.0 76-77 36.051375 37.0 37.0 37.0 37.0 37.0 78-79 36.018375 37.0 37.0 37.0 37.0 37.0 80-81 35.963375 37.0 37.0 37.0 37.0 37.0 82-83 35.983000000000004 37.0 37.0 37.0 37.0 37.0 84-85 36.064125000000004 37.0 37.0 37.0 37.0 37.0 86-87 35.931125 37.0 37.0 37.0 37.0 37.0 88-89 35.940749999999994 37.0 37.0 37.0 37.0 37.0 90-91 35.890875 37.0 37.0 37.0 37.0 37.0 92-93 35.839749999999995 37.0 37.0 37.0 37.0 37.0 94-95 35.92975 37.0 37.0 37.0 37.0 37.0 96-97 35.876 37.0 37.0 37.0 37.0 37.0 98-99 35.782624999999996 37.0 37.0 37.0 37.0 37.0 100-101 35.793875 37.0 37.0 37.0 37.0 37.0 102-103 35.746624999999995 37.0 37.0 37.0 37.0 37.0 104-105 35.737125 37.0 37.0 37.0 37.0 37.0 106-107 35.78425 37.0 37.0 37.0 37.0 37.0 108-109 35.799125000000004 37.0 37.0 37.0 37.0 37.0 110-111 35.777125 37.0 37.0 37.0 37.0 37.0 112-113 35.604749999999996 37.0 37.0 37.0 35.0 37.0 114-115 35.629374999999996 37.0 37.0 37.0 37.0 37.0 116-117 35.530249999999995 37.0 37.0 37.0 37.0 37.0 118-119 35.533625 37.0 37.0 37.0 37.0 37.0 120-121 35.513625000000005 37.0 37.0 37.0 37.0 37.0 122-123 35.394875 37.0 37.0 37.0 37.0 37.0 124-125 33.814750000000004 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 3.0 4 1.0 5 0.0 6 1.0 7 0.0 8 1.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 3.0 16 3.0 17 0.0 18 0.0 19 2.0 20 2.0 21 7.0 22 6.0 23 4.0 24 5.0 25 9.0 26 8.0 27 19.0 28 21.0 29 29.0 30 34.0 31 38.0 32 46.0 33 95.0 34 138.0 35 262.0 36 3244.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.26730915546538 15.419731169160539 13.94876997210246 48.36418970327162 2 18.825 21.65 38.625 20.9 3 21.275 26.25 27.425 25.05 4 24.562281140570285 30.86543271635818 20.485242621310658 24.087043521760883 5 24.875 35.25 22.0 17.875 6 19.425 37.275000000000006 23.875 19.425 7 16.775000000000002 19.2 43.175000000000004 20.849999999999998 8 18.224999999999998 24.75 30.025000000000002 27.0 9 19.825 23.5 32.775 23.9 10-11 21.825 33.2625 23.1125 21.8 12-13 19.8375 26.8125 30.15 23.200000000000003 14-15 21.762500000000003 27.962500000000002 27.85 22.425 16-17 21.925 27.250000000000004 27.875 22.95 18-19 22.0 28.537499999999998 27.075 22.3875 20-21 21.125 28.9875 27.375 22.5125 22-23 21.55 28.012500000000003 27.462500000000002 22.975 24-25 21.2875 28.15 28.1875 22.375 26-27 21.342835708927232 28.619654913728432 28.232058014503625 21.80545136284071 28-29 21.338336460287678 28.530331457160724 27.567229518449032 22.564102564102566 30-31 21.453590192644484 27.9459594696022 27.995996997748314 22.604453340005005 32-33 21.90511953936663 28.526724245838025 27.775691575916884 21.79246463887846 34-35 21.17382054811663 28.19421849580778 28.557126767613568 22.07483418846202 36-37 21.007877954232836 28.410653995248218 28.23558834562961 22.345879704889335 38-39 21.54557959234713 28.210578967112664 28.23558834562961 22.00825309491059 40-41 22.04576716268601 28.110541453044892 27.997999249718646 21.845692134550458 42-43 21.770663998999627 27.972989871201705 28.61072902338377 21.645617106414903 44-45 22.325 28.0875 27.1625 22.425 46-47 21.475 28.525 27.8125 22.1875 48-49 21.7875 26.787499999999998 28.575 22.85 50-51 21.9625 28.7375 27.474999999999998 21.825 52-53 22.287499999999998 28.287499999999998 27.537499999999998 21.8875 54-55 22.112499999999997 28.487499999999997 27.9125 21.4875 56-57 21.575 27.675 28.549999999999997 22.2 58-59 21.099999999999998 28.475 28.325 22.1 60-61 22.037499999999998 27.800000000000004 27.700000000000003 22.4625 62-63 22.3 27.875 27.987499999999997 21.837500000000002 64-65 22.3625 28.275 27.9375 21.425 66-67 21.5375 28.3625 28.050000000000004 22.05 68-69 22.077759719964995 28.416052006500813 27.84098012251531 21.665208151018877 70-71 21.912499999999998 29.2875 27.250000000000004 21.55 72-73 20.7875 28.4 28.449999999999996 22.3625 74-75 21.5625 28.512500000000003 27.712500000000002 22.2125 76-77 22.0125 28.325 27.875 21.7875 78-79 21.45268158519815 28.391048881110137 27.25340667583448 22.90286285785723 80-81 21.6260162601626 28.430268918073796 27.17948717948718 22.76422764227642 82-83 21.837500000000002 28.3375 27.6375 22.1875 84-85 21.95 28.6125 27.35 22.0875 86-87 21.825 28.6625 27.900000000000002 21.6125 88-89 22.4625 28.625 27.275 21.637500000000003 90-91 22.275 28.3875 27.725 21.6125 92-93 21.6625 28.849999999999998 27.6375 21.85 94-95 22.525000000000002 28.175 28.212500000000002 21.087500000000002 96-97 22.2 28.4125 27.6 21.7875 98-99 22.0875 28.5875 27.8125 21.512500000000003 100-101 22.6 28.7 26.674999999999997 22.025 102-103 21.625 29.037499999999998 26.937499999999996 22.400000000000002 104-105 22.090261282660332 28.103512939117394 27.69096137017127 22.115264408051004 106-107 21.515189398674835 28.778597324665583 28.27853481685211 21.427678459807474 108-109 22.927865983247905 28.316039504938118 27.378422302787847 21.377672209026127 110-111 23.0375 29.1875 26.85 20.925 112-113 22.6375 28.875 27.200000000000003 21.2875 114-115 22.8125 28.325 26.5 22.3625 116-117 22.3625 29.525000000000002 25.900000000000002 22.2125 118-119 22.9625 28.549999999999997 27.025 21.462500000000002 120-121 22.3375 29.1625 27.1375 21.3625 122-123 23.4125 28.5625 26.35 21.675 124-125 24.075 29.2 25.362499999999997 21.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.5 23 2.0 24 2.0 25 3.0 26 5.5 27 6.5 28 9.0 29 16.5 30 22.5 31 31.0 32 38.5 33 48.0 34 53.5 35 65.5 36 96.0 37 120.0 38 140.5 39 161.5 40 192.0 41 226.5 42 255.5 43 269.5 44 267.0 45 259.0 46 257.5 47 244.5 48 216.0 49 183.5 50 162.0 51 134.5 52 105.0 53 92.5 54 69.5 55 50.0 56 33.5 57 28.0 58 23.0 59 19.5 60 19.0 61 11.0 62 10.0 63 9.0 64 5.5 65 5.5 66 5.0 67 3.5 68 2.0 69 1.0 70 4.0 71 4.0 72 1.0 73 1.0 74 1.0 75 1.0 76 0.5 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.425 2 0.0 3 0.0 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.025 28-29 0.0625 30-31 0.075 32-33 0.13749999999999998 34-35 0.11249999999999999 36-37 0.0375 38-39 0.0375 40-41 0.0375 42-43 0.0375 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0125 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0125 80-81 0.0625 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0125 106-107 0.0125 108-109 0.0125 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7743795437453 99.5 2 0.17548257708698922 0.35000000000000003 3 0.0501378791677112 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.0625 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.0875 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.3625 0.0 0.0 0.0 0.0 104-105 1.825 0.0 0.0 0.0 0.0 106-107 2.2 0.0 0.0 0.0 0.0 108-109 2.5875 0.0 0.0 0.0 0.0 110-111 3.2375 0.0 0.0 0.0 0.0 112-113 3.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 639656 spots for SRR3208035.sra Written 639656 spots for SRR3208035.sra Read 639656 spots for SRR3208035.sra Written 639656 spots for SRR3208035.sra Read 639656 spots for SRR3208035.sra Written 639656 spots for SRR3208035.sra Read 639656 spots for SRR3208035.sra Written 639656 spots for SRR3208035.sra Read 639656 spots for SRR3208035.sra Written 639656 spots for SRR3208035.sra Read 639656 spots for SRR3208035.sra Written 639656 spots for SRR3208035.sra Read 639656 spots for SRR3208035.sra Written 639656 spots for SRR3208035.sra Read 639656 spots for SRR3208035.sra Written 639656 spots for SRR3208035.sra Read 639656 spots for SRR3208035.sra Written 639656 spots for SRR3208035.sra Read 639656 spots for SRR3208035.sra Written 639656 spots for SRR3208035.sra Read 639656 spots for SRR3208035.sra Written 639656 spots for SRR3208035.sra Read 639656 spots for SRR3208035.sra Written 639656 spots for SRR3208035.sra Read 639656 spots for SRR3208035.sra Written 639656 spots for SRR3208035.sra Read 639656 spots for SRR3208035.sra Written 639656 spots for SRR3208035.sra Read 639656 spots for SRR3208035.sra Written 639656 spots for SRR3208035.sra Read 639656 spots for SRR3208035.sra Written 639656 spots for SRR3208035.sra Read 639656 spots for SRR3208035.sra Written 639656 spots for SRR3208035.sra Read 639656 spots for SRR3208035.sra Written 639656 spots for SRR3208035.sra Read 639656 spots for SRR3208035.sra Written 639656 spots for SRR3208035.sra Read 639665 spots for SRR3208035.sra Written 639665 spots for SRR3208035.sra SRR ids: ['SRR3208035.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rvbw9tm4 SRR3208035.sra spots: 12793129 blocks: [[1, 639656], [639657, 1279312], [1279313, 1918968], [1918969, 2558624], [2558625, 3198280], [3198281, 3837936], [3837937, 4477592], [4477593, 5117248], [5117249, 5756904], [5756905, 6396560], [6396561, 7036216], [7036217, 7675872], [7675873, 8315528], [8315529, 8955184], [8955185, 9594840], [9594841, 10234496], [10234497, 10874152], [10874153, 11513808], [11513809, 12153464], [12153465, 12793129]] SRR3208035 file size 4093185 SRR3208035 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208035 SRR3208035_1.fastq Input file: SRR3208035_1.fastq trimmed: SRR3208035-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 02:45:36 2025 >> started Wed Feb 12 02:45:43 2025 >> done (7.086s) 12793129 reads processed; of these: 8662 ( 0.07%) short reads filtered out after trimming by size control 47358 ( 0.37%) empty reads filtered out after trimming by size control 12737109 (99.56%) reads available; of these: 1426532 (11.20%) trimmed reads available after processing 11310577 (88.80%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 382 0.00% 19 387 0.00% 20 437 0.00% 21 460 0.00% 22 449 0.00% 23 578 0.00% 24 658 0.01% 25 732 0.01% 26 631 0.00% 27 686 0.01% 28 704 0.01% 29 755 0.01% 30 1078 0.01% 31 958 0.01% 32 670 0.01% 33 668 0.01% 34 617 0.00% 35 648 0.01% 36 645 0.01% 37 644 0.01% 38 698 0.01% 39 649 0.01% 40 664 0.01% 41 667 0.01% 42 660 0.01% 43 767 0.01% 44 675 0.01% 45 723 0.01% 46 759 0.01% 47 783 0.01% 48 763 0.01% 49 834 0.01% 50 782 0.01% 51 839 0.01% 52 887 0.01% 53 871 0.01% 54 870 0.01% 55 868 0.01% 56 962 0.01% 57 901 0.01% 58 950 0.01% 59 1077 0.01% 60 1076 0.01% 61 1079 0.01% 62 1060 0.01% 63 1223 0.01% 64 1166 0.01% 65 1215 0.01% 66 1153 0.01% 67 1248 0.01% 68 1308 0.01% 69 1390 0.01% 70 1498 0.01% 71 1538 0.01% 72 1627 0.01% 73 1781 0.01% 74 1862 0.01% 75 1840 0.01% 76 1784 0.01% 77 1990 0.02% 78 2172 0.02% 79 2416 0.02% 80 2641 0.02% 81 2871 0.02% 82 3235 0.03% 83 3459 0.03% 84 3809 0.03% 85 4050 0.03% 86 4529 0.04% 87 4980 0.04% 88 5534 0.04% 89 6213 0.05% 90 7139 0.06% 91 8079 0.06% 92 9101 0.07% 93 10372 0.08% 94 1849 0.01% 95 1874 0.01% 96 2075 0.02% 97 2202 0.02% 98 2271 0.02% 99 2461 0.02% 100 2629 0.02% 101 2733 0.02% 102 2853 0.02% 103 3047 0.02% 104 3190 0.03% 105 3396 0.03% 106 3607 0.03% 107 3779 0.03% 108 4295 0.03% 109 4630 0.04% 110 5121 0.04% 111 5659 0.04% 112 6490 0.05% 113 7460 0.06% 114 8543 0.07% 115 9937 0.08% 116 11780 0.09% 117 13957 0.11% 118 18004 0.14% 119 23590 0.19% 120 32352 0.25% 121 67484 0.53% 122 72793 0.57% 123 172818 1.36% 124 786779 6.18% 125 11310577 88.80% 12737109 reads passed initial QC criterion=sequence-density sequence-density=3.99 sequence-density-rank=1 fanout-score=52.33 fanout-score-rank=1 prefix-density=5.47 prefix-fanout=38.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC criterion=fanout-score sequence-density=3.99 sequence-density-rank=1 fanout-score=52.33 fanout-score-rank=1 prefix-density=5.47 prefix-fanout=38.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC -o SRR3208035 - Input file: STDIN trimmed: SRR3208035-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 02:46:15 2025 >> started Wed Feb 12 02:46:22 2025 >> done (6.903s) 6368555 reads processed; of these: 46 ( 0.00%) short reads filtered out after trimming by size control 366 ( 0.01%) empty reads filtered out after trimming by size control 6368143 (99.99%) reads available; of these: 796914 (12.51%) trimmed reads available after processing 5571229 (87.49%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 187 0.00% 19 195 0.00% 20 220 0.00% 21 228 0.00% 22 205 0.00% 23 290 0.00% 24 320 0.01% 25 372 0.01% 26 341 0.01% 27 360 0.01% 28 354 0.01% 29 376 0.01% 30 533 0.01% 31 486 0.01% 32 320 0.01% 33 330 0.01% 34 309 0.00% 35 332 0.01% 36 310 0.00% 37 313 0.00% 38 377 0.01% 39 309 0.00% 40 329 0.01% 41 329 0.01% 42 328 0.01% 43 383 0.01% 44 329 0.01% 45 342 0.01% 46 375 0.01% 47 414 0.01% 48 367 0.01% 49 445 0.01% 50 371 0.01% 51 394 0.01% 52 424 0.01% 53 430 0.01% 54 436 0.01% 55 450 0.01% 56 487 0.01% 57 448 0.01% 58 500 0.01% 59 547 0.01% 60 524 0.01% 61 527 0.01% 62 512 0.01% 63 634 0.01% 64 562 0.01% 65 617 0.01% 66 565 0.01% 67 615 0.01% 68 683 0.01% 69 690 0.01% 70 736 0.01% 71 779 0.01% 72 775 0.01% 73 807 0.01% 74 837 0.01% 75 901 0.01% 76 914 0.01% 77 1009 0.02% 78 1129 0.02% 79 1222 0.02% 80 1302 0.02% 81 1493 0.02% 82 1652 0.03% 83 1740 0.03% 84 1901 0.03% 85 2036 0.03% 86 2278 0.04% 87 2490 0.04% 88 2776 0.04% 89 3084 0.05% 90 3543 0.06% 91 4004 0.06% 92 4440 0.07% 93 5234 0.08% 94 5936 0.09% 95 6292 0.10% 96 6943 0.11% 97 7513 0.12% 98 8466 0.13% 99 9459 0.15% 100 10756 0.17% 101 12106 0.19% 102 13834 0.22% 103 15292 0.24% 104 17019 0.27% 105 17881 0.28% 106 18560 0.29% 107 20011 0.31% 108 21715 0.34% 109 23317 0.37% 110 25388 0.40% 111 27863 0.44% 112 30761 0.48% 113 33745 0.53% 114 36276 0.57% 115 38832 0.61% 116 40506 0.64% 117 42528 0.67% 118 45238 0.71% 119 50890 0.80% 120 63461 1.00% 121 102915 1.62% 122 194818 3.06% 123 78006 1.22% 124 354896 5.57% 125 4918714 77.24% criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=4.48 fanout-score-rank=23 prefix-density=0.12 prefix-fanout=3.1 sequence=TTCAACCAAGCGCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=394.07 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=15.5 sequence=CAGCAGCAAGACAAACCGAATTATTCATAAGTACCAATAAAATAAGCATTGCGCAAAAGGGATAGGATAAATCACTCTTAAGCTTGAGGCTTCTCCCATTTGAGGGGCTTGACAACTTCCCAGGTGAAGTCTGGGTCATCCCTTCCAAAATGTCCGTATGC Started job on | Feb 12 02:46:49 Started mapping on | Feb 12 02:46:49 Finished on | Feb 12 02:47:09 Mapping speed, Million of reads per hour | 2292.61 Number of input reads | 12736697 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 11701570 Uniquely mapped reads % | 91.87% Average mapped length | 122.66 Number of splices: Total | 4485946 Number of splices: Annotated (sjdb) | 4397617 Number of splices: GT/AG | 4416806 Number of splices: GC/AG | 56537 Number of splices: AT/AC | 4357 Number of splices: Non-canonical | 8246 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.09 Insertion rate per base | 0.02% Insertion average length | 1.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 256580 % of reads mapped to multiple loci | 2.01% Number of reads mapped to too many loci | 441595 % of reads mapped to too many loci | 3.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.49% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 778547 778547 778547 N_multimapping 256580 256580 256580 N_noFeature 519786 6071667 6073049 N_ambiguous 119141 21121 21629 UnstrandedReadsAssigned:11062643 PositiveStrandReadsAssigned:5608782 NegativeStrandReadsAssigned:5606892 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208035 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208035-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,736,697 reads, 11,698,208 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,084 rounds 52401 SRR3208035.ke.tsv 34699 SRR3208035.se.tsv 87100 total ==> SRR3208035.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 279 18.1224 Potri.005G024800.1.v4.1 1035 936 47 6.25905 Potri.004G059700.1.v4.1 961 862 3 0.433811 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 202.272 8.8653 Potri.016G087400.1.v4.1 270 171 482 351.348 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 46 3.42522 Potri.012G127500.1.v4.1 977 878 1732 245.889 ==> SRR3208035.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1053 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 195 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 31 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR3208035 completed mapping pipeline successfully