Starting /dee2/code/volunteer_pipeline.sh SRR3208036 current disk space = 3049041014784 free memory = 1405446940 SRR3208036 SRAfilesize 98a80e881663c8402184d50a5d178738 SRR3208036.sra SRR3208036.sra file validated SRR3208036 is single end SRR3208036 is conventional basespace SRR3208036 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208036_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5015 33.0 33.0 33.0 33.0 33.0 2 32.126 33.0 33.0 33.0 33.0 33.0 3 32.17225 33.0 33.0 33.0 33.0 33.0 4 32.2305 33.0 33.0 33.0 33.0 33.0 5 32.3 33.0 33.0 33.0 33.0 33.0 6 36.0405 37.0 37.0 37.0 37.0 37.0 7 36.091 37.0 37.0 37.0 37.0 37.0 8 36.1305 37.0 37.0 37.0 37.0 37.0 9 36.11425 37.0 37.0 37.0 37.0 37.0 10-11 36.176 37.0 37.0 37.0 37.0 37.0 12-13 36.143875 37.0 37.0 37.0 37.0 37.0 14-15 36.150625 37.0 37.0 37.0 37.0 37.0 16-17 36.184124999999995 37.0 37.0 37.0 37.0 37.0 18-19 36.2115 37.0 37.0 37.0 37.0 37.0 20-21 36.199124999999995 37.0 37.0 37.0 37.0 37.0 22-23 36.2235 37.0 37.0 37.0 37.0 37.0 24-25 36.154250000000005 37.0 37.0 37.0 37.0 37.0 26-27 36.173500000000004 37.0 37.0 37.0 37.0 37.0 28-29 36.151375 37.0 37.0 37.0 37.0 37.0 30-31 36.128875 37.0 37.0 37.0 37.0 37.0 32-33 36.10075 37.0 37.0 37.0 37.0 37.0 34-35 36.099125 37.0 37.0 37.0 37.0 37.0 36-37 36.080875000000006 37.0 37.0 37.0 37.0 37.0 38-39 36.05475 37.0 37.0 37.0 37.0 37.0 40-41 36.1115 37.0 37.0 37.0 37.0 37.0 42-43 36.106375 37.0 37.0 37.0 37.0 37.0 44-45 36.056375 37.0 37.0 37.0 37.0 37.0 46-47 36.104375000000005 37.0 37.0 37.0 37.0 37.0 48-49 36.111625000000004 37.0 37.0 37.0 37.0 37.0 50-51 36.1155 37.0 37.0 37.0 37.0 37.0 52-53 36.125 37.0 37.0 37.0 37.0 37.0 54-55 36.06075 37.0 37.0 37.0 37.0 37.0 56-57 36.0835 37.0 37.0 37.0 37.0 37.0 58-59 36.103125 37.0 37.0 37.0 37.0 37.0 60-61 36.046875 37.0 37.0 37.0 37.0 37.0 62-63 36.096000000000004 37.0 37.0 37.0 37.0 37.0 64-65 36.123125 37.0 37.0 37.0 37.0 37.0 66-67 36.070625 37.0 37.0 37.0 37.0 37.0 68-69 36.032875000000004 37.0 37.0 37.0 37.0 37.0 70-71 35.9995 37.0 37.0 37.0 37.0 37.0 72-73 36.005750000000006 37.0 37.0 37.0 37.0 37.0 74-75 36.024625 37.0 37.0 37.0 37.0 37.0 76-77 35.976625 37.0 37.0 37.0 37.0 37.0 78-79 35.96125 37.0 37.0 37.0 37.0 37.0 80-81 36.002375 37.0 37.0 37.0 37.0 37.0 82-83 35.935625 37.0 37.0 37.0 37.0 37.0 84-85 35.93125 37.0 37.0 37.0 37.0 37.0 86-87 35.960625 37.0 37.0 37.0 37.0 37.0 88-89 35.914125 37.0 37.0 37.0 37.0 37.0 90-91 35.85125 37.0 37.0 37.0 37.0 37.0 92-93 35.894125 37.0 37.0 37.0 37.0 37.0 94-95 35.926874999999995 37.0 37.0 37.0 37.0 37.0 96-97 35.844125 37.0 37.0 37.0 37.0 37.0 98-99 35.86075 37.0 37.0 37.0 37.0 37.0 100-101 35.78475 37.0 37.0 37.0 37.0 37.0 102-103 35.792125 37.0 37.0 37.0 37.0 37.0 104-105 35.69225 37.0 37.0 37.0 37.0 37.0 106-107 35.718999999999994 37.0 37.0 37.0 37.0 37.0 108-109 35.678625 37.0 37.0 37.0 37.0 37.0 110-111 35.63875 37.0 37.0 37.0 37.0 37.0 112-113 35.617374999999996 37.0 37.0 37.0 37.0 37.0 114-115 35.596625 37.0 37.0 37.0 37.0 37.0 116-117 35.504875 37.0 37.0 37.0 37.0 37.0 118-119 35.536125 37.0 37.0 37.0 37.0 37.0 120-121 35.410125 37.0 37.0 37.0 37.0 37.0 122-123 35.409375 37.0 37.0 37.0 37.0 37.0 124-125 33.813375 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 25.0 3 3.0 4 2.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 3.0 11 0.0 12 1.0 13 3.0 14 3.0 15 3.0 16 0.0 17 1.0 18 3.0 19 1.0 20 1.0 21 2.0 22 9.0 23 5.0 24 7.0 25 9.0 26 7.0 27 13.0 28 13.0 29 26.0 30 21.0 31 41.0 32 56.0 33 77.0 34 146.0 35 234.0 36 3284.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.10580117556862 14.643496038844875 13.595706618962433 49.65499616662407 2 18.075 21.625 40.1 20.200000000000003 3 22.400000000000002 26.400000000000002 26.75 24.45 4 25.4 30.025000000000002 21.0 23.575 5 24.675 34.175 22.975 18.175 6 20.05 37.625 24.025 18.3 7 16.3 18.925 44.275 20.5 8 19.55 22.900000000000002 30.825000000000003 26.724999999999998 9 20.825 22.175 33.125 23.875 10-11 22.400000000000002 32.4125 23.8625 21.325 12-13 20.275000000000002 25.775 30.625000000000004 23.325000000000003 14-15 21.512500000000003 27.575 28.849999999999998 22.0625 16-17 21.7 27.975 27.4125 22.912499999999998 18-19 22.425 27.3625 28.000000000000004 22.2125 20-21 22.275 28.499999999999996 28.000000000000004 21.224999999999998 22-23 21.3125 28.299999999999997 28.599999999999998 21.7875 24-25 22.112499999999997 28.249999999999996 27.6375 22.0 26-27 22.4875 28.599999999999998 27.1 21.8125 28-29 21.29282320580145 28.91972993248312 27.731932983245812 22.05551387846962 30-31 21.14542953607603 28.42315868450669 28.135550831561833 22.295860947855445 32-33 21.37853390042532 28.658994245684262 28.383787840880657 21.57868401300976 34-35 22.348674337168582 28.101550775387697 27.426213106553277 22.123561780890444 36-37 21.215151893986747 27.628453556694588 28.378547318414803 22.777847230903863 38-39 21.792948237059264 29.21980495123781 26.894223555888974 22.093023255813954 40-41 21.965245655706962 28.90361295161895 28.103512939117394 21.027628453556694 42-43 22.152769096137018 27.903487935992 27.353419177397175 22.59032379047381 44-45 22.1875 28.725 28.175 20.9125 46-47 21.625 28.15 27.400000000000002 22.825 48-49 21.675 29.4375 27.0 21.8875 50-51 21.9 28.225 27.400000000000002 22.475 52-53 21.875 28.675 27.6125 21.837500000000002 54-55 22.075 28.15 27.85 21.925 56-57 21.925 27.675 28.4375 21.9625 58-59 21.712500000000002 27.6625 28.6375 21.987499999999997 60-61 21.462500000000002 27.925 28.349999999999998 22.2625 62-63 21.912499999999998 27.675 28.037499999999998 22.375 64-65 21.5375 28.65 27.3 22.5125 66-67 21.637500000000003 28.499999999999996 27.5875 22.275 68-69 22.06525815726966 28.403550443805475 27.94099262407801 21.590198774846854 70-71 21.6875 28.212500000000002 28.5625 21.5375 72-73 21.725 27.500000000000004 28.249999999999996 22.525000000000002 74-75 22.2125 27.750000000000004 27.750000000000004 22.287499999999998 76-77 22.037499999999998 28.5625 27.575 21.825 78-79 21.327665958244783 28.416052006500813 27.528441055131893 22.727840980122515 80-81 21.405351337834457 28.51962990747687 27.74443610902726 22.330582645661416 82-83 22.015251906488313 28.053506688336043 28.20352544068008 21.727715964495562 84-85 21.9375 28.4 27.1375 22.525000000000002 86-87 21.8875 27.55 28.3375 22.225 88-89 22.275 28.1875 28.4375 21.099999999999998 90-91 22.6125 28.0625 27.8375 21.4875 92-93 21.975 27.825 27.725 22.475 94-95 22.05 28.237499999999997 27.987499999999997 21.725 96-97 22.3375 27.675 27.700000000000003 22.287499999999998 98-99 21.3 28.475 28.237499999999997 21.987499999999997 100-101 21.7 29.299999999999997 27.6375 21.3625 102-103 22.85 28.175 27.212500000000002 21.762500000000003 104-105 23.452931616452055 28.66608326040755 27.090886360795096 20.790098762345295 106-107 22.240280035004375 28.91611451431429 27.128391048881113 21.715214401800225 108-109 23.29041130141268 28.528566070758842 26.56582072759095 21.61520190023753 110-111 22.6375 29.312500000000004 26.900000000000002 21.15 112-113 23.0875 28.749999999999996 27.0625 21.099999999999998 114-115 22.912499999999998 29.125 26.987499999999997 20.974999999999998 116-117 22.5875 28.3875 26.937499999999996 22.0875 118-119 23.1125 28.449999999999996 26.724999999999998 21.712500000000002 120-121 23.5625 29.075 25.974999999999998 21.3875 122-123 23.0875 29.262500000000003 26.35 21.3 124-125 23.625 29.7875 24.875 21.712500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.5 24 1.0 25 1.5 26 4.5 27 7.5 28 8.5 29 11.5 30 22.5 31 28.5 32 25.0 33 36.0 34 55.0 35 70.0 36 92.5 37 122.5 38 146.0 39 175.0 40 202.0 41 226.0 42 256.5 43 272.0 44 267.0 45 258.0 46 258.0 47 241.0 48 223.5 49 210.5 50 164.0 51 124.5 52 106.5 53 85.0 54 62.5 55 48.5 56 35.0 57 24.5 58 25.0 59 19.5 60 16.5 61 14.5 62 9.5 63 8.0 64 7.0 65 4.0 66 2.5 67 2.0 68 1.0 69 1.0 70 2.0 71 2.5 72 1.5 73 1.0 74 1.5 75 2.0 76 1.0 77 0.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.025 30-31 0.0375 32-33 0.075 34-35 0.05 36-37 0.0125 38-39 0.025 40-41 0.0125 42-43 0.0125 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0125 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0125 80-81 0.025 82-83 0.0125 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0125 106-107 0.0125 108-109 0.0125 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.5249999999999999 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.9750000000000001 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.6124999999999998 0.0 0.0 0.0 0.0 102-103 2.0625 0.0 0.0 0.0 0.0 104-105 2.5625 0.0 0.0 0.0 0.0 106-107 3.0375 0.0 0.0 0.0 0.0 108-109 3.8125 0.0 0.0 0.0 0.0 110-111 4.6125 0.0 0.0 0.0 0.0 112-113 5.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 859549 spots for SRR3208036.sra Written 859549 spots for SRR3208036.sra Read 859549 spots for SRR3208036.sra Written 859549 spots for SRR3208036.sra Read 859549 spots for SRR3208036.sra Written 859549 spots for SRR3208036.sra Read 859549 spots for SRR3208036.sra Written 859549 spots for SRR3208036.sra Read 859549 spots for SRR3208036.sra Written 859549 spots for SRR3208036.sra Read 859549 spots for SRR3208036.sra Written 859549 spots for SRR3208036.sra Read 859549 spots for SRR3208036.sra Written 859549 spots for SRR3208036.sra Read 859549 spots for SRR3208036.sra Written 859549 spots for SRR3208036.sra Read 859549 spots for SRR3208036.sra Written 859549 spots for SRR3208036.sra Read 859549 spots for SRR3208036.sra Written 859549 spots for SRR3208036.sra Read 859549 spots for SRR3208036.sra Written 859549 spots for SRR3208036.sra Read 859549 spots for SRR3208036.sra Written 859549 spots for SRR3208036.sra Read 859549 spots for SRR3208036.sra Written 859549 spots for SRR3208036.sra Read 859549 spots for SRR3208036.sra Written 859549 spots for SRR3208036.sra Read 859549 spots for SRR3208036.sra Written 859549 spots for SRR3208036.sra Read 859549 spots for SRR3208036.sra Written 859549 spots for SRR3208036.sra Read 859549 spots for SRR3208036.sra Written 859549 spots for SRR3208036.sra Read 859549 spots for SRR3208036.sra Written 859549 spots for SRR3208036.sra Read 859549 spots for SRR3208036.sra Written 859549 spots for SRR3208036.sra Read 859549 spots for SRR3208036.sra Written 859549 spots for SRR3208036.sra SRR ids: ['SRR3208036.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_km0i3dh2 SRR3208036.sra spots: 17190980 blocks: [[1, 859549], [859550, 1719098], [1719099, 2578647], [2578648, 3438196], [3438197, 4297745], [4297746, 5157294], [5157295, 6016843], [6016844, 6876392], [6876393, 7735941], [7735942, 8595490], [8595491, 9455039], [9455040, 10314588], [10314589, 11174137], [11174138, 12033686], [12033687, 12893235], [12893236, 13752784], [13752785, 14612333], [14612334, 15471882], [15471883, 16331431], [16331432, 17190980]] SRR3208036 file size 5504018 SRR3208036 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208036 SRR3208036_1.fastq Input file: SRR3208036_1.fastq trimmed: SRR3208036-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 02:45:18 2025 >> started Wed Feb 12 02:45:27 2025 >> done (9.103s) 17190980 reads processed; of these: 13566 ( 0.08%) short reads filtered out after trimming by size control 58163 ( 0.34%) empty reads filtered out after trimming by size control 17119251 (99.58%) reads available; of these: 1950055 (11.39%) trimmed reads available after processing 15169196 (88.61%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 583 0.00% 19 515 0.00% 20 588 0.00% 21 574 0.00% 22 681 0.00% 23 707 0.00% 24 850 0.00% 25 1014 0.01% 26 962 0.01% 27 917 0.01% 28 927 0.01% 29 1058 0.01% 30 1540 0.01% 31 1429 0.01% 32 853 0.00% 33 857 0.01% 34 825 0.00% 35 790 0.00% 36 897 0.01% 37 818 0.00% 38 872 0.01% 39 866 0.01% 40 845 0.00% 41 926 0.01% 42 940 0.01% 43 923 0.01% 44 995 0.01% 45 1012 0.01% 46 994 0.01% 47 927 0.01% 48 915 0.01% 49 1001 0.01% 50 1011 0.01% 51 1046 0.01% 52 1060 0.01% 53 1057 0.01% 54 1089 0.01% 55 1071 0.01% 56 1165 0.01% 57 1145 0.01% 58 1211 0.01% 59 1344 0.01% 60 1354 0.01% 61 1354 0.01% 62 1460 0.01% 63 1448 0.01% 64 1449 0.01% 65 1410 0.01% 66 1496 0.01% 67 1591 0.01% 68 1671 0.01% 69 1720 0.01% 70 1873 0.01% 71 1954 0.01% 72 2143 0.01% 73 2279 0.01% 74 2432 0.01% 75 2404 0.01% 76 2524 0.01% 77 2726 0.02% 78 2958 0.02% 79 3177 0.02% 80 3645 0.02% 81 4142 0.02% 82 4798 0.03% 83 5362 0.03% 84 5638 0.03% 85 6323 0.04% 86 6758 0.04% 87 7366 0.04% 88 8491 0.05% 89 9448 0.06% 90 11121 0.06% 91 12823 0.07% 92 14590 0.09% 93 16071 0.09% 94 2627 0.02% 95 2715 0.02% 96 2810 0.02% 97 3101 0.02% 98 3199 0.02% 99 3282 0.02% 100 3537 0.02% 101 3820 0.02% 102 4042 0.02% 103 4216 0.02% 104 4370 0.03% 105 4609 0.03% 106 4962 0.03% 107 5147 0.03% 108 5831 0.03% 109 6548 0.04% 110 6989 0.04% 111 7756 0.05% 112 8839 0.05% 113 10186 0.06% 114 11561 0.07% 115 13605 0.08% 116 16046 0.09% 117 19388 0.11% 118 24706 0.14% 119 32357 0.19% 120 44525 0.26% 121 91565 0.53% 122 100883 0.59% 123 237969 1.39% 124 1063065 6.21% 125 15169196 88.61% 17119251 reads passed initial QC criterion=sequence-density sequence-density=4.68 sequence-density-rank=1 fanout-score=48.12 fanout-score-rank=1 prefix-density=6.37 prefix-fanout=35.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC criterion=fanout-score sequence-density=4.68 sequence-density-rank=1 fanout-score=48.12 fanout-score-rank=1 prefix-density=6.37 prefix-fanout=35.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC -o SRR3208036 - Input file: STDIN trimmed: SRR3208036-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 02:46:07 2025 >> started Wed Feb 12 02:46:18 2025 >> done (11.298s) 10271551 reads processed; of these: 75 ( 0.00%) short reads filtered out after trimming by size control 353 ( 0.00%) empty reads filtered out after trimming by size control 10271123 (100.00%) reads available; of these: 1435011 (13.97%) trimmed reads available after processing 8836112 (86.03%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 374 0.00% 19 300 0.00% 20 335 0.00% 21 353 0.00% 22 419 0.00% 23 430 0.00% 24 532 0.01% 25 622 0.01% 26 559 0.01% 27 559 0.01% 28 547 0.01% 29 647 0.01% 30 966 0.01% 31 842 0.01% 32 522 0.01% 33 516 0.01% 34 494 0.00% 35 455 0.00% 36 516 0.01% 37 500 0.00% 38 538 0.01% 39 516 0.01% 40 525 0.01% 41 583 0.01% 42 568 0.01% 43 554 0.01% 44 597 0.01% 45 615 0.01% 46 605 0.01% 47 547 0.01% 48 561 0.01% 49 612 0.01% 50 614 0.01% 51 645 0.01% 52 611 0.01% 53 634 0.01% 54 651 0.01% 55 642 0.01% 56 703 0.01% 57 660 0.01% 58 740 0.01% 59 813 0.01% 60 793 0.01% 61 826 0.01% 62 901 0.01% 63 854 0.01% 64 885 0.01% 65 831 0.01% 66 940 0.01% 67 966 0.01% 68 986 0.01% 69 1062 0.01% 70 1104 0.01% 71 1132 0.01% 72 1249 0.01% 73 1326 0.01% 74 1361 0.01% 75 1380 0.01% 76 1480 0.01% 77 1673 0.02% 78 1784 0.02% 79 1970 0.02% 80 2205 0.02% 81 2485 0.02% 82 2874 0.03% 83 3284 0.03% 84 3410 0.03% 85 3802 0.04% 86 4133 0.04% 87 4414 0.04% 88 5129 0.05% 89 5738 0.06% 90 6628 0.06% 91 7602 0.07% 92 8660 0.08% 93 9721 0.09% 94 11103 0.11% 95 12166 0.12% 96 13337 0.13% 97 14739 0.14% 98 15967 0.16% 99 18097 0.18% 100 20423 0.20% 101 22839 0.22% 102 25983 0.25% 103 29085 0.28% 104 31943 0.31% 105 33896 0.33% 106 35683 0.35% 107 37727 0.37% 108 39919 0.39% 109 43420 0.42% 110 47500 0.46% 111 52012 0.51% 112 56988 0.55% 113 62115 0.60% 114 66030 0.64% 115 70150 0.68% 116 72893 0.71% 117 75934 0.74% 118 80432 0.78% 119 88220 0.86% 120 109700 1.07% 121 172735 1.68% 122 321163 3.13% 123 126919 1.24% 124 569943 5.55% 125 7774452 75.69% criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=2.82 fanout-score-rank=36 prefix-density=0.07 prefix-fanout=2.4 sequence=AAAGAAGTCAAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=21 fanout-score=314.21 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=29.9 sequence=TTCTTCTTCTTT Started job on | Feb 12 02:46:43 Started mapping on | Feb 12 02:46:43 Finished on | Feb 12 02:47:03 Mapping speed, Million of reads per hour | 3081.39 Number of input reads | 17118823 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 16340950 Uniquely mapped reads % | 95.46% Average mapped length | 122.42 Number of splices: Total | 6266925 Number of splices: Annotated (sjdb) | 6149643 Number of splices: GT/AG | 6172436 Number of splices: GC/AG | 77334 Number of splices: AT/AC | 6085 Number of splices: Non-canonical | 11070 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.14 Insertion rate per base | 0.02% Insertion average length | 1.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 336428 % of reads mapped to multiple loci | 1.97% Number of reads mapped to too many loci | 305422 % of reads mapped to too many loci | 1.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.79% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 441445 441445 441445 N_multimapping 336428 336428 336428 N_noFeature 660344 8446388 8445977 N_ambiguous 164591 27773 28195 UnstrandedReadsAssigned:15516015 PositiveStrandReadsAssigned:7866789 NegativeStrandReadsAssigned:7866778 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208036 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208036-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,118,823 reads, 16,070,833 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52401 SRR3208036.ke.tsv 34699 SRR3208036.se.tsv 87100 total ==> SRR3208036.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 368.49 17.2289 Potri.005G024800.1.v4.1 1035 936 65 6.23079 Potri.004G059700.1.v4.1 961 862 23 2.39401 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 285.176 8.99681 Potri.016G087400.1.v4.1 270 171 698 366.239 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 43.549 2.33415 Potri.012G127500.1.v4.1 977 878 2334 238.513 ==> SRR3208036.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1362 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 284 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 33 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3208036 completed mapping pipeline successfully