Starting /dee2/code/volunteer_pipeline.sh SRR3208037 current disk space = 3048883585024 free memory = 1573106004 SRR3208037 SRAfilesize 0e63cecd3f8a00eb5c40e9a7109b91a7 SRR3208037.sra SRR3208037.sra file validated SRR3208037 is single end SRR3208037 is conventional basespace SRR3208037 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208037_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4325 33.0 33.0 33.0 33.0 33.0 2 32.112 33.0 33.0 33.0 33.0 33.0 3 32.12425 33.0 33.0 33.0 33.0 33.0 4 32.26275 33.0 33.0 33.0 33.0 33.0 5 32.376 33.0 33.0 33.0 33.0 33.0 6 36.007 37.0 37.0 37.0 37.0 37.0 7 36.245 37.0 37.0 37.0 37.0 37.0 8 36.1965 37.0 37.0 37.0 37.0 37.0 9 36.24325 37.0 37.0 37.0 37.0 37.0 10-11 36.21925 37.0 37.0 37.0 37.0 37.0 12-13 36.29075 37.0 37.0 37.0 37.0 37.0 14-15 36.25075 37.0 37.0 37.0 37.0 37.0 16-17 36.269875 37.0 37.0 37.0 37.0 37.0 18-19 36.249 37.0 37.0 37.0 37.0 37.0 20-21 36.264375 37.0 37.0 37.0 37.0 37.0 22-23 36.25075 37.0 37.0 37.0 37.0 37.0 24-25 36.238875 37.0 37.0 37.0 37.0 37.0 26-27 36.18275 37.0 37.0 37.0 37.0 37.0 28-29 36.21 37.0 37.0 37.0 37.0 37.0 30-31 36.243875 37.0 37.0 37.0 37.0 37.0 32-33 36.214375000000004 37.0 37.0 37.0 37.0 37.0 34-35 36.208875 37.0 37.0 37.0 37.0 37.0 36-37 36.199875000000006 37.0 37.0 37.0 37.0 37.0 38-39 36.189750000000004 37.0 37.0 37.0 37.0 37.0 40-41 36.239875 37.0 37.0 37.0 37.0 37.0 42-43 36.259125 37.0 37.0 37.0 37.0 37.0 44-45 36.255875 37.0 37.0 37.0 37.0 37.0 46-47 36.235375 37.0 37.0 37.0 37.0 37.0 48-49 36.21625 37.0 37.0 37.0 37.0 37.0 50-51 36.205124999999995 37.0 37.0 37.0 37.0 37.0 52-53 36.17875 37.0 37.0 37.0 37.0 37.0 54-55 36.172875 37.0 37.0 37.0 37.0 37.0 56-57 36.18625 37.0 37.0 37.0 37.0 37.0 58-59 36.2225 37.0 37.0 37.0 37.0 37.0 60-61 36.189 37.0 37.0 37.0 37.0 37.0 62-63 36.205875 37.0 37.0 37.0 37.0 37.0 64-65 36.195750000000004 37.0 37.0 37.0 37.0 37.0 66-67 36.1395 37.0 37.0 37.0 37.0 37.0 68-69 36.160875000000004 37.0 37.0 37.0 37.0 37.0 70-71 36.046 37.0 37.0 37.0 37.0 37.0 72-73 36.1195 37.0 37.0 37.0 37.0 37.0 74-75 36.066875 37.0 37.0 37.0 37.0 37.0 76-77 36.102625 37.0 37.0 37.0 37.0 37.0 78-79 36.081875 37.0 37.0 37.0 37.0 37.0 80-81 36.065749999999994 37.0 37.0 37.0 37.0 37.0 82-83 36.062124999999995 37.0 37.0 37.0 37.0 37.0 84-85 36.031 37.0 37.0 37.0 37.0 37.0 86-87 36.032624999999996 37.0 37.0 37.0 37.0 37.0 88-89 36.03337500000001 37.0 37.0 37.0 37.0 37.0 90-91 35.990375 37.0 37.0 37.0 37.0 37.0 92-93 36.033249999999995 37.0 37.0 37.0 37.0 37.0 94-95 36.03975 37.0 37.0 37.0 37.0 37.0 96-97 35.922125 37.0 37.0 37.0 37.0 37.0 98-99 35.903375 37.0 37.0 37.0 37.0 37.0 100-101 35.925625 37.0 37.0 37.0 37.0 37.0 102-103 35.9145 37.0 37.0 37.0 37.0 37.0 104-105 35.854124999999996 37.0 37.0 37.0 37.0 37.0 106-107 35.799875 37.0 37.0 37.0 37.0 37.0 108-109 35.7605 37.0 37.0 37.0 37.0 37.0 110-111 35.755624999999995 37.0 37.0 37.0 37.0 37.0 112-113 35.623875 37.0 37.0 37.0 37.0 37.0 114-115 35.714875 37.0 37.0 37.0 37.0 37.0 116-117 35.620625000000004 37.0 37.0 37.0 37.0 37.0 118-119 35.61450000000001 37.0 37.0 37.0 37.0 37.0 120-121 35.608374999999995 37.0 37.0 37.0 37.0 37.0 122-123 35.57075 37.0 37.0 37.0 37.0 37.0 124-125 33.837374999999994 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 2.0 10 0.0 11 0.0 12 3.0 13 1.0 14 0.0 15 1.0 16 1.0 17 1.0 18 2.0 19 2.0 20 2.0 21 1.0 22 3.0 23 3.0 24 6.0 25 6.0 26 11.0 27 18.0 28 14.0 29 23.0 30 36.0 31 35.0 32 63.0 33 97.0 34 125.0 35 258.0 36 3264.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.26407369498465 15.532241555783008 13.94575230296827 49.25793244626407 2 18.975 21.7 39.175 20.150000000000002 3 22.625 25.174999999999997 27.525 24.675 4 22.980745186296573 32.10802700675169 21.305326331582897 23.605901475368842 5 25.35 34.625 23.200000000000003 16.825000000000003 6 19.25 36.199999999999996 24.55 20.0 7 15.925 18.775 44.425 20.875 8 18.35 24.075 30.45 27.125 9 19.975 24.275 32.300000000000004 23.45 10-11 22.075 33.725 22.7625 21.4375 12-13 19.925 27.224999999999998 30.425 22.425 14-15 21.587500000000002 26.724999999999998 28.475 23.2125 16-17 22.05 28.3375 27.275 22.3375 18-19 21.6125 28.225 28.050000000000004 22.112499999999997 20-21 22.25 28.0625 27.400000000000002 22.287499999999998 22-23 21.0375 29.349999999999998 27.6 22.0125 24-25 21.0125 28.375 28.212500000000002 22.400000000000002 26-27 20.727590948868606 28.34104263032879 27.490936367045883 23.44043005375672 28-29 21.170438914592975 28.548205577091405 27.83543828935851 22.44591721895711 30-31 21.135567783891947 27.66383191595798 28.68934467233617 22.511255627813906 32-33 21.898449224612307 28.85192596298149 27.71385692846423 21.53576788394197 34-35 21.585792896448226 28.76438219109555 27.113556778389196 22.536268134067033 36-37 20.717679419854964 28.632158039509875 27.994498624656167 22.655663915978995 38-39 21.867966991747938 28.119529882470616 27.45686421605401 22.55563890972743 40-41 21.005251312828207 28.232058014503625 28.419604901225306 22.343085771442862 42-43 21.61790447611903 28.719679919979995 28.044511127781945 21.61790447611903 44-45 21.625 28.4375 27.9375 22.0 46-47 21.5375 27.787499999999998 27.962500000000002 22.7125 48-49 21.975 27.575 28.575 21.875 50-51 21.6875 28.3625 27.700000000000003 22.25 52-53 20.1125 28.525 28.8625 22.5 54-55 21.1875 28.262500000000003 28.262500000000003 22.287499999999998 56-57 21.5375 27.3625 28.499999999999996 22.6 58-59 21.6625 29.062500000000004 27.925 21.349999999999998 60-61 22.975 27.0125 27.85 22.162499999999998 62-63 22.775000000000002 27.487499999999997 28.712500000000002 21.025 64-65 21.5 28.425 28.499999999999996 21.575 66-67 21.825 28.225 27.750000000000004 22.2 68-69 21.7375 28.4 28.287499999999998 21.575 70-71 21.825 27.987499999999997 28.3375 21.85 72-73 21.1625 28.599999999999998 28.237499999999997 22.0 74-75 21.8625 27.6875 28.275 22.175 76-77 21.7875 28.012500000000003 28.5625 21.637500000000003 78-79 22.3875 27.150000000000002 28.125 22.3375 80-81 21.45 28.599999999999998 28.525 21.425 82-83 22.575 27.737499999999997 28.462500000000002 21.224999999999998 84-85 21.625 27.5625 28.299999999999997 22.5125 86-87 20.9 29.175 28.925 21.0 88-89 21.4875 28.375 27.975 22.162499999999998 90-91 21.65 28.075 28.1125 22.162499999999998 92-93 22.825 28.15 27.2625 21.762500000000003 94-95 20.9875 28.95 27.6375 22.425 96-97 21.8125 28.1 27.975 22.112499999999997 98-99 22.175 28.4 27.925 21.5 100-101 22.3 28.1625 27.737499999999997 21.8 102-103 22.45 28.225 28.075 21.25 104-105 22.4875 28.050000000000004 27.4125 22.05 106-107 22.287499999999998 28.325 27.487499999999997 21.9 108-109 21.05 29.212500000000002 28.449999999999996 21.2875 110-111 22.2125 29.45 27.150000000000002 21.1875 112-113 23.525 28.6875 25.9625 21.825 114-115 22.8125 28.3875 26.400000000000002 22.400000000000002 116-117 22.662499999999998 28.812500000000004 27.175 21.349999999999998 118-119 22.825 29.4875 25.837500000000002 21.85 120-121 22.9625 29.362500000000004 25.637500000000003 22.037499999999998 122-123 23.3375 29.7 25.8 21.1625 124-125 22.8625 29.299999999999997 26.650000000000002 21.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 1.0 24 2.0 25 3.0 26 6.0 27 10.5 28 13.5 29 16.0 30 17.0 31 25.0 32 40.0 33 56.5 34 69.0 35 72.5 36 95.5 37 127.0 38 142.0 39 174.0 40 203.0 41 229.0 42 249.5 43 252.0 44 260.0 45 261.5 46 250.5 47 233.5 48 224.0 49 187.0 50 144.0 51 139.0 52 112.5 53 78.0 54 69.5 55 47.0 56 33.0 57 37.0 58 27.0 59 18.0 60 14.0 61 12.0 62 10.5 63 5.0 64 6.0 65 6.5 66 2.5 67 1.5 68 1.0 69 2.5 70 3.5 71 1.0 72 0.0 73 1.5 74 1.5 75 1.0 76 1.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.3 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.0375 30-31 0.05 32-33 0.05 34-35 0.05 36-37 0.025 38-39 0.025 40-41 0.025 42-43 0.025 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87481221832749 99.725 2 0.10015022533800699 0.2 3 0.025037556334501748 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.0625 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.6625000000000001 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 1.125 0.0 0.0 0.0 0.0 98-99 1.35 0.0 0.0 0.0 0.0 100-101 1.75 0.0 0.0 0.0 0.0 102-103 2.2 0.0 0.0 0.0 0.0 104-105 2.7375 0.0 0.0 0.0 0.0 106-107 3.225 0.0 0.0 0.0 0.0 108-109 3.8375000000000004 0.0 0.0 0.0 0.0 110-111 4.6 0.0 0.0 0.0 0.0 112-113 5.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1023748 spots for SRR3208037.sra Written 1023748 spots for SRR3208037.sra Read 1023748 spots for SRR3208037.sra Written 1023748 spots for SRR3208037.sra Read 1023748 spots for SRR3208037.sra Written 1023748 spots for SRR3208037.sra Read 1023748 spots for SRR3208037.sra Written 1023748 spots for SRR3208037.sra Read 1023748 spots for SRR3208037.sra Written 1023748 spots for SRR3208037.sra Read 1023748 spots for SRR3208037.sra Written 1023748 spots for SRR3208037.sra Read 1023748 spots for SRR3208037.sra Written 1023748 spots for SRR3208037.sra Read 1023748 spots for SRR3208037.sra Written 1023748 spots for SRR3208037.sra Read 1023748 spots for SRR3208037.sra Written 1023748 spots for SRR3208037.sra Read 1023748 spots for SRR3208037.sra Written 1023748 spots for SRR3208037.sra Read 1023748 spots for SRR3208037.sra Written 1023748 spots for SRR3208037.sra Read 1023748 spots for SRR3208037.sra Written 1023748 spots for SRR3208037.sra Read 1023748 spots for SRR3208037.sra Written 1023748 spots for SRR3208037.sra Read 1023748 spots for SRR3208037.sra Written 1023748 spots for SRR3208037.sra Read 1023759 spots for SRR3208037.sra Written 1023759 spots for SRR3208037.sra Read 1023748 spots for SRR3208037.sra Written 1023748 spots for SRR3208037.sra Read 1023748 spots for SRR3208037.sra Written 1023748 spots for SRR3208037.sra Read 1023748 spots for SRR3208037.sra Written 1023748 spots for SRR3208037.sra Read 1023748 spots for SRR3208037.sra Written 1023748 spots for SRR3208037.sra Read 1023748 spots for SRR3208037.sra Written 1023748 spots for SRR3208037.sra SRR ids: ['SRR3208037.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_81s405dl SRR3208037.sra spots: 20474971 blocks: [[1, 1023748], [1023749, 2047496], [2047497, 3071244], [3071245, 4094992], [4094993, 5118740], [5118741, 6142488], [6142489, 7166236], [7166237, 8189984], [8189985, 9213732], [9213733, 10237480], [10237481, 11261228], [11261229, 12284976], [12284977, 13308724], [13308725, 14332472], [14332473, 15356220], [15356221, 16379968], [16379969, 17403716], [17403717, 18427464], [18427465, 19451212], [19451213, 20474971]] SRR3208037 file size 6557522 SRR3208037 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208037 SRR3208037_1.fastq Input file: SRR3208037_1.fastq trimmed: SRR3208037-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 03:03:01 2025 >> started Wed Feb 12 03:03:17 2025 >> done (16.498s) 20474971 reads processed; of these: 15141 ( 0.07%) short reads filtered out after trimming by size control 79715 ( 0.39%) empty reads filtered out after trimming by size control 20380115 (99.54%) reads available; of these: 2343122 (11.50%) trimmed reads available after processing 18036993 (88.50%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 650 0.00% 19 602 0.00% 20 707 0.00% 21 676 0.00% 22 831 0.00% 23 852 0.00% 24 1088 0.01% 25 1134 0.01% 26 1170 0.01% 27 1090 0.01% 28 1111 0.01% 29 1187 0.01% 30 1660 0.01% 31 1557 0.01% 32 1113 0.01% 33 1037 0.01% 34 1053 0.01% 35 993 0.00% 36 1054 0.01% 37 1141 0.01% 38 1111 0.01% 39 1110 0.01% 40 1119 0.01% 41 1099 0.01% 42 1158 0.01% 43 1236 0.01% 44 1232 0.01% 45 1184 0.01% 46 1293 0.01% 47 1200 0.01% 48 1299 0.01% 49 1325 0.01% 50 1286 0.01% 51 1386 0.01% 52 1303 0.01% 53 1361 0.01% 54 1378 0.01% 55 1454 0.01% 56 1449 0.01% 57 1584 0.01% 58 1508 0.01% 59 1619 0.01% 60 1765 0.01% 61 1839 0.01% 62 1764 0.01% 63 1952 0.01% 64 1893 0.01% 65 1919 0.01% 66 2034 0.01% 67 2049 0.01% 68 2131 0.01% 69 2208 0.01% 70 2401 0.01% 71 2613 0.01% 72 2813 0.01% 73 3121 0.02% 74 3281 0.02% 75 3231 0.02% 76 3251 0.02% 77 3424 0.02% 78 3721 0.02% 79 4075 0.02% 80 4634 0.02% 81 5038 0.02% 82 5542 0.03% 83 6415 0.03% 84 6665 0.03% 85 7408 0.04% 86 7832 0.04% 87 8592 0.04% 88 9606 0.05% 89 11283 0.06% 90 12458 0.06% 91 14542 0.07% 92 16764 0.08% 93 18804 0.09% 94 3239 0.02% 95 3415 0.02% 96 3400 0.02% 97 3747 0.02% 98 3950 0.02% 99 4019 0.02% 100 4298 0.02% 101 4526 0.02% 102 4951 0.02% 103 4993 0.02% 104 5423 0.03% 105 5639 0.03% 106 6137 0.03% 107 6439 0.03% 108 7105 0.03% 109 8042 0.04% 110 8773 0.04% 111 9669 0.05% 112 10911 0.05% 113 12223 0.06% 114 14490 0.07% 115 16555 0.08% 116 19436 0.10% 117 23368 0.11% 118 30404 0.15% 119 39415 0.19% 120 53516 0.26% 121 109932 0.54% 122 120236 0.59% 123 283842 1.39% 124 1274561 6.25% 125 18036993 88.50% 20380115 reads passed initial QC criterion=sequence-density sequence-density=4.47 sequence-density-rank=1 fanout-score=51.21 fanout-score-rank=1 prefix-density=6.08 prefix-fanout=37.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGAAAAA criterion=fanout-score sequence-density=4.47 sequence-density-rank=1 fanout-score=51.21 fanout-score-rank=1 prefix-density=6.08 prefix-fanout=37.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGAAAAA -o SRR3208037 - Input file: STDIN trimmed: SRR3208037-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 03:04:05 2025 >> started Wed Feb 12 03:04:22 2025 >> done (17.300s) 12228069 reads processed; of these: 173 ( 0.00%) short reads filtered out after trimming by size control 1273 ( 0.01%) empty reads filtered out after trimming by size control 12226623 (99.99%) reads available; of these: 1649457 (13.49%) trimmed reads available after processing 10577166 (86.51%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 372 0.00% 19 370 0.00% 20 436 0.00% 21 410 0.00% 22 509 0.00% 23 508 0.00% 24 622 0.01% 25 666 0.01% 26 696 0.01% 27 644 0.01% 28 654 0.01% 29 674 0.01% 30 962 0.01% 31 963 0.01% 32 670 0.01% 33 624 0.01% 34 638 0.01% 35 596 0.00% 36 644 0.01% 37 689 0.01% 38 687 0.01% 39 693 0.01% 40 621 0.01% 41 673 0.01% 42 705 0.01% 43 718 0.01% 44 757 0.01% 45 741 0.01% 46 763 0.01% 47 710 0.01% 48 776 0.01% 49 756 0.01% 50 741 0.01% 51 820 0.01% 52 793 0.01% 53 838 0.01% 54 819 0.01% 55 896 0.01% 56 886 0.01% 57 944 0.01% 58 929 0.01% 59 955 0.01% 60 1045 0.01% 61 1117 0.01% 62 1060 0.01% 63 1085 0.01% 64 1097 0.01% 65 1149 0.01% 66 1205 0.01% 67 1206 0.01% 68 1270 0.01% 69 1346 0.01% 70 1463 0.01% 71 1493 0.01% 72 1557 0.01% 73 1580 0.01% 74 1684 0.01% 75 1824 0.01% 76 1920 0.02% 77 2114 0.02% 78 2255 0.02% 79 2496 0.02% 80 2732 0.02% 81 3052 0.02% 82 3308 0.03% 83 3797 0.03% 84 4081 0.03% 85 4493 0.04% 86 4728 0.04% 87 5143 0.04% 88 5845 0.05% 89 6791 0.06% 90 7588 0.06% 91 8549 0.07% 92 9943 0.08% 93 11319 0.09% 94 12780 0.10% 95 13987 0.11% 96 14724 0.12% 97 16352 0.13% 98 17978 0.15% 99 20082 0.16% 100 22882 0.19% 101 26051 0.21% 102 29709 0.24% 103 33166 0.27% 104 36373 0.30% 105 38867 0.32% 106 40691 0.33% 107 43138 0.35% 108 45673 0.37% 109 49500 0.40% 110 53973 0.44% 111 59357 0.49% 112 65314 0.53% 113 71387 0.58% 114 77320 0.63% 115 80949 0.66% 116 84245 0.69% 117 87649 0.72% 118 93568 0.77% 119 102723 0.84% 120 127974 1.05% 121 203119 1.66% 122 379786 3.11% 123 152646 1.25% 124 686255 5.61% 125 9297502 76.04% criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=58.73 fanout-score-rank=12 prefix-density=0.26 prefix-fanout=14.0 sequence=CACCACCACCATGGGCTCCCCAGCCACCATAGGTGTCAATAATGATCTTGCGTCCAGTGAGACCTGCATCACCATGAGGACCACCAATAAC criterion=fanout-score sequence-density=0.04 sequence-density-rank=14 fanout-score=335.58 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=29.6 sequence=TTCTTCTTCTTT Started job on | Feb 12 03:04:50 Started mapping on | Feb 12 03:04:50 Finished on | Feb 12 03:05:22 Mapping speed, Million of reads per hour | 2292.60 Number of input reads | 20378669 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 18854683 Uniquely mapped reads % | 92.52% Average mapped length | 122.48 Number of splices: Total | 7175143 Number of splices: Annotated (sjdb) | 7022678 Number of splices: GT/AG | 7062227 Number of splices: GC/AG | 92668 Number of splices: AT/AC | 7178 Number of splices: Non-canonical | 13070 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.19 Insertion rate per base | 0.02% Insertion average length | 1.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 406038 % of reads mapped to multiple loci | 1.99% Number of reads mapped to too many loci | 444395 % of reads mapped to too many loci | 2.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.29% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1117948 1117948 1117948 N_multimapping 406038 406038 406038 N_noFeature 911359 9828712 9818072 N_ambiguous 192535 36417 37311 UnstrandedReadsAssigned:17750789 PositiveStrandReadsAssigned:8989554 NegativeStrandReadsAssigned:8999300 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208037 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208037-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,378,669 reads, 18,469,277 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,097 rounds 52401 SRR3208037.ke.tsv 34699 SRR3208037.se.tsv 87100 total ==> SRR3208037.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 687 28.0112 Potri.005G024800.1.v4.1 1035 936 167 13.9602 Potri.004G059700.1.v4.1 961 862 9 0.81693 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 333.341 9.17082 Potri.016G087400.1.v4.1 270 171 686 313.89 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 80 3.73925 Potri.012G127500.1.v4.1 977 878 4716 420.27 ==> SRR3208037.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2113 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 370 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 48 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 21 SRR3208037 completed mapping pipeline successfully