Starting /dee2/code/volunteer_pipeline.sh SRR3208038 current disk space = 3049001488384 free memory = 1575527624 SRR3208038 SRAfilesize 87e2a79f6518773f8348739a0052a5eb SRR3208038.sra SRR3208038.sra file validated SRR3208038 is single end SRR3208038 is conventional basespace SRR3208038 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208038_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5675 33.0 33.0 33.0 33.0 33.0 2 32.15425 33.0 33.0 33.0 33.0 33.0 3 32.078 33.0 33.0 33.0 33.0 33.0 4 32.32925 33.0 33.0 33.0 33.0 33.0 5 32.423 33.0 33.0 33.0 33.0 33.0 6 36.03525 37.0 37.0 37.0 37.0 37.0 7 36.2745 37.0 37.0 37.0 37.0 37.0 8 36.17325 37.0 37.0 37.0 37.0 37.0 9 36.217 37.0 37.0 37.0 37.0 37.0 10-11 36.200125 37.0 37.0 37.0 37.0 37.0 12-13 36.24425 37.0 37.0 37.0 37.0 37.0 14-15 36.226124999999996 37.0 37.0 37.0 37.0 37.0 16-17 36.232124999999996 37.0 37.0 37.0 37.0 37.0 18-19 36.197125 37.0 37.0 37.0 37.0 37.0 20-21 36.307249999999996 37.0 37.0 37.0 37.0 37.0 22-23 36.31425 37.0 37.0 37.0 37.0 37.0 24-25 36.280625 37.0 37.0 37.0 37.0 37.0 26-27 36.248000000000005 37.0 37.0 37.0 37.0 37.0 28-29 36.27525 37.0 37.0 37.0 37.0 37.0 30-31 36.20825 37.0 37.0 37.0 37.0 37.0 32-33 36.160875 37.0 37.0 37.0 37.0 37.0 34-35 36.13825 37.0 37.0 37.0 37.0 37.0 36-37 36.183 37.0 37.0 37.0 37.0 37.0 38-39 36.222625 37.0 37.0 37.0 37.0 37.0 40-41 36.161375 37.0 37.0 37.0 37.0 37.0 42-43 36.2165 37.0 37.0 37.0 37.0 37.0 44-45 36.152625 37.0 37.0 37.0 37.0 37.0 46-47 36.218125 37.0 37.0 37.0 37.0 37.0 48-49 36.220625 37.0 37.0 37.0 37.0 37.0 50-51 36.201 37.0 37.0 37.0 37.0 37.0 52-53 36.191375 37.0 37.0 37.0 37.0 37.0 54-55 36.17175 37.0 37.0 37.0 37.0 37.0 56-57 36.18675 37.0 37.0 37.0 37.0 37.0 58-59 36.193625 37.0 37.0 37.0 37.0 37.0 60-61 36.175625 37.0 37.0 37.0 37.0 37.0 62-63 36.222375 37.0 37.0 37.0 37.0 37.0 64-65 36.184 37.0 37.0 37.0 37.0 37.0 66-67 36.1155 37.0 37.0 37.0 37.0 37.0 68-69 36.136125 37.0 37.0 37.0 37.0 37.0 70-71 36.051125 37.0 37.0 37.0 37.0 37.0 72-73 36.131875 37.0 37.0 37.0 37.0 37.0 74-75 36.073875 37.0 37.0 37.0 37.0 37.0 76-77 36.065124999999995 37.0 37.0 37.0 37.0 37.0 78-79 36.101875 37.0 37.0 37.0 37.0 37.0 80-81 36.080875 37.0 37.0 37.0 37.0 37.0 82-83 36.059 37.0 37.0 37.0 37.0 37.0 84-85 36.03975 37.0 37.0 37.0 37.0 37.0 86-87 35.99325 37.0 37.0 37.0 37.0 37.0 88-89 36.045874999999995 37.0 37.0 37.0 37.0 37.0 90-91 35.991875 37.0 37.0 37.0 37.0 37.0 92-93 35.992625000000004 37.0 37.0 37.0 37.0 37.0 94-95 36.01625 37.0 37.0 37.0 37.0 37.0 96-97 35.98375 37.0 37.0 37.0 37.0 37.0 98-99 35.912375 37.0 37.0 37.0 37.0 37.0 100-101 35.88725 37.0 37.0 37.0 37.0 37.0 102-103 35.901375 37.0 37.0 37.0 37.0 37.0 104-105 35.888125 37.0 37.0 37.0 37.0 37.0 106-107 35.790625 37.0 37.0 37.0 37.0 37.0 108-109 35.783 37.0 37.0 37.0 37.0 37.0 110-111 35.713625 37.0 37.0 37.0 37.0 37.0 112-113 35.6485 37.0 37.0 37.0 37.0 37.0 114-115 35.619 37.0 37.0 37.0 37.0 37.0 116-117 35.667375 37.0 37.0 37.0 37.0 37.0 118-119 35.659125 37.0 37.0 37.0 37.0 37.0 120-121 35.641000000000005 37.0 37.0 37.0 37.0 37.0 122-123 35.587875 37.0 37.0 37.0 37.0 37.0 124-125 33.9425 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 1.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 2.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 1.0 17 1.0 18 3.0 19 1.0 20 2.0 21 4.0 22 5.0 23 2.0 24 7.0 25 4.0 26 8.0 27 13.0 28 13.0 29 39.0 30 45.0 31 39.0 32 55.0 33 78.0 34 127.0 35 249.0 36 3277.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.196679438058748 15.836526181353769 13.205619412515965 48.76117496807152 2 18.275 22.15 40.575 19.0 3 21.625 25.6 28.175 24.6 4 22.75 31.75 21.349999999999998 24.15 5 24.025 34.2 24.4 17.375 6 19.975 37.5 23.125 19.400000000000002 7 16.8 18.725 43.85 20.625 8 17.299999999999997 25.224999999999998 29.675 27.800000000000004 9 20.724999999999998 23.125 31.724999999999998 24.425 10-11 22.625 31.974999999999998 23.5625 21.837500000000002 12-13 19.9125 27.125 29.375 23.5875 14-15 20.625 27.950000000000003 28.487499999999997 22.9375 16-17 22.037499999999998 27.900000000000002 27.400000000000002 22.662499999999998 18-19 22.2 28.4125 27.8375 21.55 20-21 21.1375 28.825 27.537499999999998 22.5 22-23 21.7375 29.099999999999998 27.287499999999998 21.875 24-25 21.325 28.775000000000002 27.650000000000002 22.25 26-27 22.112499999999997 27.925 27.537499999999998 22.425 28-29 21.15 28.925 27.675 22.25 30-31 21.492873218304574 28.794698674668666 27.306826706676667 22.405601400350086 32-33 21.546546546546548 28.315815815815814 27.540040040040044 22.597597597597595 34-35 22.35146966854284 27.904940587867415 27.76735459662289 21.976235146966854 36-37 22.225 28.787499999999998 27.6125 21.375 38-39 21.224999999999998 28.6875 28.1375 21.95 40-41 21.987499999999997 27.962500000000002 27.787499999999998 22.2625 42-43 21.6 28.512500000000003 27.5125 22.375 44-45 22.15 28.512500000000003 26.487500000000004 22.85 46-47 21.325 28.299999999999997 28.262500000000003 22.112499999999997 48-49 22.237499999999997 27.6625 27.462500000000002 22.6375 50-51 21.8625 28.3125 28.125 21.7 52-53 22.650000000000002 27.6375 27.487499999999997 22.225 54-55 21.375 28.262500000000003 27.825 22.537499999999998 56-57 21.224999999999998 28.65 28.3875 21.7375 58-59 22.175 28.3625 27.725 21.7375 60-61 22.037499999999998 29.212500000000002 26.85 21.9 62-63 21.85 27.5125 28.475 22.162499999999998 64-65 21.2375 28.975 27.825 21.9625 66-67 21.6875 28.875 27.237499999999997 22.2 68-69 21.340167520940117 28.2410301287661 27.21590198774847 23.202900362545318 70-71 20.875 28.3375 28.299999999999997 22.4875 72-73 21.4875 28.462500000000002 27.875 22.175 74-75 22.0625 28.15 28.025 21.762500000000003 76-77 22.525000000000002 28.225 27.825 21.425 78-79 21.877734716839605 28.316039504938118 26.8533566695837 22.95286910863858 80-81 22.2708515693385 27.485306990121295 28.49818682005752 21.745654620482682 82-83 22.6875 27.875 28.075 21.3625 84-85 22.05 29.15 27.1625 21.637500000000003 86-87 22.3875 27.975 28.1 21.5375 88-89 21.7875 28.000000000000004 28.287499999999998 21.925 90-91 22.0125 28.725 27.8375 21.425 92-93 22.1 27.900000000000002 28.1875 21.8125 94-95 21.025 28.599999999999998 28.475 21.9 96-97 22.4375 27.575 28.237499999999997 21.75 98-99 22.6 28.225 28.287499999999998 20.8875 100-101 22.475 28.299999999999997 27.625 21.6 102-103 21.5625 28.925 28.449999999999996 21.0625 104-105 22.252781597699713 28.86610826353294 27.51593949243655 21.365170646330792 106-107 22.477809726215778 28.703587948493563 27.665958244780597 21.152644080510065 108-109 22.852856607075882 28.54106763345418 27.715964495561945 20.890111263907986 110-111 22.5625 29.0875 26.9625 21.3875 112-113 23.0375 29.312500000000004 27.0125 20.6375 114-115 21.987499999999997 29.212500000000002 26.7625 22.037499999999998 116-117 22.650000000000002 29.475 26.8375 21.0375 118-119 22.8625 28.712500000000002 26.6 21.825 120-121 23.35 28.525 26.4125 21.712500000000002 122-123 23.3125 29.9375 26.55 20.200000000000003 124-125 23.8875 29.7125 24.9125 21.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.5 25 5.0 26 7.0 27 7.0 28 8.5 29 10.5 30 20.0 31 39.5 32 47.0 33 48.5 34 54.5 35 65.0 36 81.5 37 102.0 38 133.5 39 167.5 40 188.0 41 214.0 42 252.5 43 284.0 44 286.5 45 265.5 46 261.0 47 250.0 48 221.0 49 196.0 50 161.0 51 130.5 52 109.0 53 85.5 54 64.5 55 51.5 56 42.0 57 30.5 58 22.5 59 18.0 60 14.0 61 9.5 62 8.0 63 7.0 64 5.5 65 4.5 66 4.0 67 3.0 68 4.0 69 4.0 70 1.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.025 32-33 0.1 34-35 0.0625 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0125 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0125 80-81 0.0375 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0125 106-107 0.0125 108-109 0.0125 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.15 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.16249999999999998 0.0 0.0 0.0 0.0 66-67 0.1875 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.3 0.0 0.0 0.0 0.0 102-103 1.55 0.0 0.0 0.0 0.0 104-105 1.9625 0.0 0.0 0.0 0.0 106-107 2.525 0.0 0.0 0.0 0.0 108-109 3.1 0.0 0.0 0.0 0.0 110-111 3.65 0.0 0.0 0.0 0.0 112-113 4.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1026079 spots for SRR3208038.sra Written 1026079 spots for SRR3208038.sra Read 1026079 spots for SRR3208038.sra Written 1026079 spots for SRR3208038.sra Read 1026079 spots for SRR3208038.sra Written 1026079 spots for SRR3208038.sra Read 1026079 spots for SRR3208038.sra Written 1026079 spots for SRR3208038.sra Read 1026079 spots for SRR3208038.sra Written 1026079 spots for SRR3208038.sra Read 1026094 spots for SRR3208038.sra Written 1026094 spots for SRR3208038.sra Read 1026079 spots for SRR3208038.sra Written 1026079 spots for SRR3208038.sra Read 1026079 spots for SRR3208038.sra Written 1026079 spots for SRR3208038.sra Read 1026079 spots for SRR3208038.sra Written 1026079 spots for SRR3208038.sra Read 1026079 spots for SRR3208038.sra Written 1026079 spots for SRR3208038.sra Read 1026079 spots for SRR3208038.sra Written 1026079 spots for SRR3208038.sra Read 1026079 spots for SRR3208038.sra Written 1026079 spots for SRR3208038.sra Read 1026079 spots for SRR3208038.sra Written 1026079 spots for SRR3208038.sra Read 1026079 spots for SRR3208038.sra Written 1026079 spots for SRR3208038.sra Read 1026079 spots for SRR3208038.sra Written 1026079 spots for SRR3208038.sra Read 1026079 spots for SRR3208038.sra Written 1026079 spots for SRR3208038.sra Read 1026079 spots for SRR3208038.sra Written 1026079 spots for SRR3208038.sra Read 1026079 spots for SRR3208038.sra Written 1026079 spots for SRR3208038.sra Read 1026079 spots for SRR3208038.sra Written 1026079 spots for SRR3208038.sra Read 1026079 spots for SRR3208038.sra Written 1026079 spots for SRR3208038.sra SRR ids: ['SRR3208038.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9kps5luw SRR3208038.sra spots: 20521595 blocks: [[1, 1026079], [1026080, 2052158], [2052159, 3078237], [3078238, 4104316], [4104317, 5130395], [5130396, 6156474], [6156475, 7182553], [7182554, 8208632], [8208633, 9234711], [9234712, 10260790], [10260791, 11286869], [11286870, 12312948], [12312949, 13339027], [13339028, 14365106], [14365107, 15391185], [15391186, 16417264], [16417265, 17443343], [17443344, 18469422], [18469423, 19495501], [19495502, 20521595]] SRR3208038 file size 6572480 SRR3208038 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208038 SRR3208038_1.fastq Input file: SRR3208038_1.fastq trimmed: SRR3208038-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 03:20:58 2025 >> started Wed Feb 12 03:21:10 2025 >> done (11.223s) 20521595 reads processed; of these: 14687 ( 0.07%) short reads filtered out after trimming by size control 59441 ( 0.29%) empty reads filtered out after trimming by size control 20447467 (99.64%) reads available; of these: 2305710 (11.28%) trimmed reads available after processing 18141757 (88.72%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 625 0.00% 19 618 0.00% 20 643 0.00% 21 692 0.00% 22 823 0.00% 23 868 0.00% 24 1045 0.01% 25 1132 0.01% 26 1219 0.01% 27 1108 0.01% 28 1083 0.01% 29 1189 0.01% 30 1568 0.01% 31 1564 0.01% 32 1052 0.01% 33 983 0.00% 34 966 0.00% 35 997 0.00% 36 971 0.00% 37 1051 0.01% 38 1022 0.00% 39 1040 0.01% 40 1069 0.01% 41 1032 0.01% 42 1071 0.01% 43 1112 0.01% 44 1110 0.01% 45 1110 0.01% 46 1145 0.01% 47 1143 0.01% 48 1232 0.01% 49 1212 0.01% 50 1227 0.01% 51 1274 0.01% 52 1203 0.01% 53 1310 0.01% 54 1316 0.01% 55 1355 0.01% 56 1359 0.01% 57 1374 0.01% 58 1469 0.01% 59 1595 0.01% 60 1551 0.01% 61 1700 0.01% 62 1618 0.01% 63 1607 0.01% 64 1680 0.01% 65 1663 0.01% 66 1723 0.01% 67 1865 0.01% 68 1876 0.01% 69 2023 0.01% 70 2117 0.01% 71 2174 0.01% 72 2268 0.01% 73 2445 0.01% 74 2726 0.01% 75 2699 0.01% 76 2716 0.01% 77 2913 0.01% 78 3318 0.02% 79 3524 0.02% 80 3859 0.02% 81 4339 0.02% 82 4931 0.02% 83 5455 0.03% 84 6001 0.03% 85 6392 0.03% 86 6930 0.03% 87 7711 0.04% 88 8594 0.04% 89 9923 0.05% 90 11481 0.06% 91 13002 0.06% 92 15059 0.07% 93 16872 0.08% 94 3075 0.02% 95 3163 0.02% 96 3326 0.02% 97 3591 0.02% 98 3796 0.02% 99 4114 0.02% 100 4195 0.02% 101 4291 0.02% 102 4828 0.02% 103 4834 0.02% 104 5235 0.03% 105 5628 0.03% 106 5884 0.03% 107 6323 0.03% 108 7138 0.03% 109 7787 0.04% 110 8471 0.04% 111 9515 0.05% 112 10805 0.05% 113 12219 0.06% 114 14073 0.07% 115 16170 0.08% 116 18965 0.09% 117 23069 0.11% 118 29574 0.14% 119 38767 0.19% 120 53084 0.26% 121 109947 0.54% 122 119327 0.58% 123 282608 1.38% 124 1270176 6.21% 125 18141757 88.72% 20447467 reads passed initial QC criterion=sequence-density sequence-density=4.13 sequence-density-rank=1 fanout-score=48.84 fanout-score-rank=1 prefix-density=5.63 prefix-fanout=35.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=fanout-score sequence-density=4.13 sequence-density-rank=1 fanout-score=48.84 fanout-score-rank=1 prefix-density=5.63 prefix-fanout=35.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTGAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTGAAAA -o SRR3208038 - Input file: STDIN trimmed: SRR3208038-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 03:21:58 2025 >> started Wed Feb 12 03:22:11 2025 >> done (13.592s) 12268480 reads processed; of these: 141 ( 0.00%) short reads filtered out after trimming by size control 225 ( 0.00%) empty reads filtered out after trimming by size control 12268114 (100.00%) reads available; of these: 1583808 (12.91%) trimmed reads available after processing 10684306 (87.09%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 368 0.00% 19 392 0.00% 20 398 0.00% 21 428 0.00% 22 497 0.00% 23 526 0.00% 24 638 0.01% 25 708 0.01% 26 741 0.01% 27 658 0.01% 28 669 0.01% 29 699 0.01% 30 935 0.01% 31 950 0.01% 32 616 0.01% 33 579 0.00% 34 606 0.00% 35 608 0.00% 36 561 0.00% 37 644 0.01% 38 618 0.01% 39 625 0.01% 40 649 0.01% 41 619 0.01% 42 642 0.01% 43 672 0.01% 44 649 0.01% 45 660 0.01% 46 682 0.01% 47 694 0.01% 48 738 0.01% 49 741 0.01% 50 741 0.01% 51 745 0.01% 52 730 0.01% 53 811 0.01% 54 773 0.01% 55 804 0.01% 56 822 0.01% 57 833 0.01% 58 880 0.01% 59 965 0.01% 60 920 0.01% 61 1003 0.01% 62 969 0.01% 63 957 0.01% 64 988 0.01% 65 979 0.01% 66 1026 0.01% 67 1098 0.01% 68 1119 0.01% 69 1230 0.01% 70 1308 0.01% 71 1285 0.01% 72 1372 0.01% 73 1432 0.01% 74 1613 0.01% 75 1598 0.01% 76 1584 0.01% 77 1802 0.01% 78 1990 0.02% 79 2104 0.02% 80 2323 0.02% 81 2613 0.02% 82 3007 0.02% 83 3285 0.03% 84 3642 0.03% 85 3849 0.03% 86 4209 0.03% 87 4632 0.04% 88 5226 0.04% 89 6068 0.05% 90 6884 0.06% 91 7655 0.06% 92 9040 0.07% 93 10181 0.08% 94 11418 0.09% 95 12364 0.10% 96 13720 0.11% 97 15036 0.12% 98 16607 0.14% 99 18945 0.15% 100 21418 0.17% 101 24214 0.20% 102 27642 0.23% 103 30791 0.25% 104 33487 0.27% 105 36529 0.30% 106 38088 0.31% 107 40589 0.33% 108 43256 0.35% 109 46483 0.38% 110 51022 0.42% 111 56097 0.46% 112 61853 0.50% 113 67552 0.55% 114 72971 0.59% 115 76774 0.63% 116 80254 0.65% 117 84305 0.69% 118 90436 0.74% 119 99968 0.81% 120 125598 1.02% 121 203485 1.66% 122 380675 3.10% 123 152247 1.24% 124 686082 5.59% 125 9420903 76.79% criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=24.25 fanout-score-rank=13 prefix-density=0.17 prefix-fanout=8.9 sequence=TTCTCATCAAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=47 fanout-score=458.71 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=16.5 sequence=CAGCAGCAAGACAAACCGAATTATTCATAAGTACCAATAAAATAAGCATTGCGCAAAAGGGATAGGATAAATCACTCTTAAGCTTGAGGCTTCTCCCATTTGAGGGGCTTGACAACTTCCCAGGTGAAGTCTGGGTCATCCCTTCCAAAATGTCCGTATGCAGCTGTCTTCAAGAACCTATTACCCCCCCTCTTGAGATCCAGGTTGATGGTCATCATTCCAGGCCTAAAGTCAAAGCTCTCCTTCACAATCTTAAGGATCTCCTTGTCAGGAATTTTTCCAGTGCCATAGGTGTCCACAAAGACTGACAAAGGCTCAGGTACACCAATAGCATAGGA Started job on | Feb 12 03:22:45 Started mapping on | Feb 12 03:22:45 Finished on | Feb 12 03:23:09 Mapping speed, Million of reads per hour | 3067.07 Number of input reads | 20447101 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 19633924 Uniquely mapped reads % | 96.02% Average mapped length | 122.62 Number of splices: Total | 7682312 Number of splices: Annotated (sjdb) | 7542852 Number of splices: GT/AG | 7566877 Number of splices: GC/AG | 95304 Number of splices: AT/AC | 7434 Number of splices: Non-canonical | 12697 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.15 Insertion rate per base | 0.02% Insertion average length | 1.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 397007 % of reads mapped to multiple loci | 1.94% Number of reads mapped to too many loci | 189665 % of reads mapped to too many loci | 0.93% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.10% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 416170 416170 416170 N_multimapping 397007 397007 397007 N_noFeature 760060 10135242 10137007 N_ambiguous 188887 33383 34081 UnstrandedReadsAssigned:18684977 PositiveStrandReadsAssigned:9465299 NegativeStrandReadsAssigned:9462836 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208038 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208038-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,447,101 reads, 19,186,168 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52401 SRR3208038.ke.tsv 34699 SRR3208038.se.tsv 87100 total ==> SRR3208038.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 447 17.75 Potri.005G024800.1.v4.1 1035 936 48 3.90779 Potri.004G059700.1.v4.1 961 862 16 1.41442 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 383.275 10.2694 Potri.016G087400.1.v4.1 270 171 884 393.932 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 67 3.0499 Potri.012G127500.1.v4.1 977 878 3180 275.993 ==> SRR3208038.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1824 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 358 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 38 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3208038 completed mapping pipeline successfully