Starting /dee2/code/volunteer_pipeline.sh SRR3208039 current disk space = 2823847157760 free memory = 1579452964 SRR3208039 SRAfilesize efea664a56f8d3cae74a75beb9254c51 SRR3208039.sra SRR3208039.sra file validated SRR3208039 is single end SRR3208039 is conventional basespace SRR3208039 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208039_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.526 33.0 33.0 33.0 33.0 33.0 2 32.1575 33.0 33.0 33.0 33.0 33.0 3 32.23875 33.0 33.0 33.0 33.0 33.0 4 32.4255 33.0 33.0 33.0 33.0 33.0 5 32.4675 33.0 33.0 33.0 33.0 33.0 6 36.173 37.0 37.0 37.0 37.0 37.0 7 36.25475 37.0 37.0 37.0 37.0 37.0 8 36.354 37.0 37.0 37.0 37.0 37.0 9 36.36825 37.0 37.0 37.0 37.0 37.0 10-11 36.3835 37.0 37.0 37.0 37.0 37.0 12-13 36.3815 37.0 37.0 37.0 37.0 37.0 14-15 36.3875 37.0 37.0 37.0 37.0 37.0 16-17 36.362375 37.0 37.0 37.0 37.0 37.0 18-19 36.37325 37.0 37.0 37.0 37.0 37.0 20-21 36.4135 37.0 37.0 37.0 37.0 37.0 22-23 36.365624999999994 37.0 37.0 37.0 37.0 37.0 24-25 36.412 37.0 37.0 37.0 37.0 37.0 26-27 36.385999999999996 37.0 37.0 37.0 37.0 37.0 28-29 36.40175 37.0 37.0 37.0 37.0 37.0 30-31 36.379125 37.0 37.0 37.0 37.0 37.0 32-33 36.354375000000005 37.0 37.0 37.0 37.0 37.0 34-35 36.361125 37.0 37.0 37.0 37.0 37.0 36-37 36.395375 37.0 37.0 37.0 37.0 37.0 38-39 36.282624999999996 37.0 37.0 37.0 37.0 37.0 40-41 36.294124999999994 37.0 37.0 37.0 37.0 37.0 42-43 36.33825 37.0 37.0 37.0 37.0 37.0 44-45 36.27375 37.0 37.0 37.0 37.0 37.0 46-47 36.379125 37.0 37.0 37.0 37.0 37.0 48-49 36.316625 37.0 37.0 37.0 37.0 37.0 50-51 36.317625 37.0 37.0 37.0 37.0 37.0 52-53 36.333124999999995 37.0 37.0 37.0 37.0 37.0 54-55 36.317875 37.0 37.0 37.0 37.0 37.0 56-57 36.298 37.0 37.0 37.0 37.0 37.0 58-59 36.276125 37.0 37.0 37.0 37.0 37.0 60-61 36.28675 37.0 37.0 37.0 37.0 37.0 62-63 36.20125 37.0 37.0 37.0 37.0 37.0 64-65 36.2635 37.0 37.0 37.0 37.0 37.0 66-67 36.233374999999995 37.0 37.0 37.0 37.0 37.0 68-69 36.235 37.0 37.0 37.0 37.0 37.0 70-71 36.18175 37.0 37.0 37.0 37.0 37.0 72-73 36.174 37.0 37.0 37.0 37.0 37.0 74-75 36.141625000000005 37.0 37.0 37.0 37.0 37.0 76-77 36.200125 37.0 37.0 37.0 37.0 37.0 78-79 36.14775 37.0 37.0 37.0 37.0 37.0 80-81 36.13775 37.0 37.0 37.0 37.0 37.0 82-83 36.105875 37.0 37.0 37.0 37.0 37.0 84-85 36.102125 37.0 37.0 37.0 37.0 37.0 86-87 36.02825 37.0 37.0 37.0 37.0 37.0 88-89 36.09725 37.0 37.0 37.0 37.0 37.0 90-91 36.158 37.0 37.0 37.0 37.0 37.0 92-93 36.05875 37.0 37.0 37.0 37.0 37.0 94-95 36.054125 37.0 37.0 37.0 37.0 37.0 96-97 36.0355 37.0 37.0 37.0 37.0 37.0 98-99 36.051500000000004 37.0 37.0 37.0 37.0 37.0 100-101 36.020375 37.0 37.0 37.0 37.0 37.0 102-103 35.974625 37.0 37.0 37.0 37.0 37.0 104-105 35.9105 37.0 37.0 37.0 37.0 37.0 106-107 35.862875 37.0 37.0 37.0 37.0 37.0 108-109 35.871875 37.0 37.0 37.0 37.0 37.0 110-111 35.811 37.0 37.0 37.0 37.0 37.0 112-113 35.75975 37.0 37.0 37.0 37.0 37.0 114-115 35.760625000000005 37.0 37.0 37.0 37.0 37.0 116-117 35.735375000000005 37.0 37.0 37.0 37.0 37.0 118-119 35.6775 37.0 37.0 37.0 37.0 37.0 120-121 35.6345 37.0 37.0 37.0 37.0 37.0 122-123 35.547125 37.0 37.0 37.0 37.0 37.0 124-125 33.944874999999996 37.0 35.0 37.0 27.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 1.0 4 0.0 5 0.0 6 2.0 7 0.0 8 1.0 9 0.0 10 2.0 11 0.0 12 2.0 13 2.0 14 1.0 15 4.0 16 4.0 17 0.0 18 0.0 19 2.0 20 2.0 21 1.0 22 1.0 23 2.0 24 3.0 25 7.0 26 13.0 27 12.0 28 18.0 29 15.0 30 35.0 31 47.0 32 60.0 33 77.0 34 127.0 35 258.0 36 3292.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.858388917393537 15.931246793227297 13.288866085171883 46.92149820420728 2 18.375 23.65 38.574999999999996 19.400000000000002 3 21.525 25.525 27.525 25.424999999999997 4 24.25 31.8 21.425 22.525000000000002 5 24.2 34.75 22.925 18.125 6 19.675 36.1 23.625 20.599999999999998 7 17.575 19.575 42.449999999999996 20.4 8 18.45 23.875 30.325000000000003 27.35 9 19.45 23.325000000000003 32.975 24.25 10-11 22.9375 33.4875 22.55 21.025 12-13 20.075000000000003 26.6625 29.562500000000004 23.7 14-15 21.712500000000002 27.3375 27.950000000000003 23.0 16-17 22.1375 27.450000000000003 27.462500000000002 22.95 18-19 21.6625 28.212500000000002 27.8375 22.287499999999998 20-21 22.125 27.825 27.950000000000003 22.1 22-23 21.3125 28.65 28.1 21.9375 24-25 21.0375 28.262500000000003 28.325 22.375 26-27 21.525 28.212500000000002 27.9375 22.325 28-29 21.330332583145786 27.644411102775695 28.394598649662417 22.630657664416105 30-31 21.867966991747938 29.532383095773945 27.19429857464366 21.405351337834457 32-33 21.785892946473236 28.4392196098049 28.151575787893947 21.623311655827916 34-35 21.670626484931848 28.72327122671002 27.64786795048143 21.958234337876704 36-37 21.265158144768094 28.22852856607076 27.803475434429302 22.702837854731843 38-39 22.190273784223027 27.815976997124643 27.753469183647955 22.240280035004375 40-41 22.290286285785722 27.228403550443808 27.603450431303912 22.877859732466558 42-43 21.665208151018877 28.178522315289413 28.853606700837602 21.302662832854107 44-45 22.2625 28.5875 27.85 21.3 46-47 21.275 28.575 28.15 22.0 48-49 22.675 27.712500000000002 27.2625 22.35 50-51 21.837500000000002 29.462500000000002 27.224999999999998 21.475 52-53 22.7125 28.499999999999996 27.175 21.6125 54-55 21.0125 27.762500000000003 28.199999999999996 23.025000000000002 56-57 21.875 28.3625 28.3125 21.45 58-59 22.237499999999997 28.287499999999998 27.962500000000002 21.512500000000003 60-61 21.462500000000002 28.050000000000004 28.225 22.2625 62-63 21.75 28.65 28.299999999999997 21.3 64-65 22.3 28.262500000000003 27.625 21.8125 66-67 20.724999999999998 28.675 28.4125 22.1875 68-69 21.883206202325873 29.13592597223959 27.222708515693384 21.758159309741153 70-71 21.65 29.212500000000002 27.3 21.837500000000002 72-73 21.3125 28.012500000000003 27.9125 22.7625 74-75 22.275 27.700000000000003 28.849999999999998 21.175 76-77 22.502812851606453 28.653581697712216 27.11588948618577 21.727715964495562 78-79 20.832812304614233 28.98586970113793 28.173064899337252 22.00825309491059 80-81 22.75456592444333 27.808356267200402 27.33299974981236 22.10407805854391 82-83 22.30278784848106 28.90361295161895 26.56582072759095 22.22777847230904 84-85 21.9 28.462500000000002 28.075 21.5625 86-87 20.8875 28.7 27.9375 22.475 88-89 21.2375 29.375 27.6375 21.75 90-91 21.05 28.95 27.987499999999997 22.0125 92-93 21.7 28.575 28.475 21.25 94-95 21.4 29.037499999999998 28.449999999999996 21.1125 96-97 21.925 27.9375 27.6625 22.475 98-99 22.7625 28.1 27.650000000000002 21.4875 100-101 21.462500000000002 28.65 27.825 22.0625 102-103 22.225 28.95 27.800000000000004 21.025 104-105 21.5607803901951 28.55177588794397 28.189094547273637 21.698349174587296 106-107 22.886443221610804 29.052026013006504 27.163581790895446 20.897948974487242 108-109 21.458046767537827 28.635738401900714 27.972989871201705 21.93322495935976 110-111 21.9625 27.9375 27.650000000000002 22.45 112-113 22.45 29.45 26.9125 21.1875 114-115 22.8125 28.875 26.9125 21.4 116-117 22.412499999999998 28.349999999999998 27.224999999999998 22.0125 118-119 23.125 29.225 26.2125 21.4375 120-121 22.975 28.537499999999998 26.8 21.6875 122-123 22.8875 28.3625 26.35 22.400000000000002 124-125 23.175 29.6875 25.2125 21.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 2.0 23 2.0 24 2.0 25 2.5 26 5.0 27 8.0 28 10.5 29 13.5 30 21.0 31 25.0 32 27.5 33 44.0 34 58.5 35 72.0 36 101.0 37 122.0 38 133.5 39 162.0 40 191.5 41 218.0 42 246.5 43 274.0 44 273.5 45 273.0 46 270.5 47 243.0 48 232.5 49 207.0 50 164.0 51 138.5 52 112.0 53 76.5 54 58.0 55 46.5 56 34.0 57 30.0 58 20.5 59 12.5 60 12.5 61 10.5 62 9.5 63 7.0 64 3.5 65 2.5 66 3.0 67 5.0 68 3.5 69 1.0 70 1.5 71 1.0 72 0.0 73 0.0 74 0.5 75 1.5 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.025 30-31 0.025 32-33 0.05 34-35 0.0375 36-37 0.0125 38-39 0.0125 40-41 0.0125 42-43 0.0125 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0375 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0125 78-79 0.0375 80-81 0.075 82-83 0.0125 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.05 106-107 0.05 108-109 0.0375 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92492492492492 99.825 2 0.050050050050050046 0.1 3 0.025025025025025023 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.2125 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.25 0.0 0.0 0.0 0.0 102-103 1.5875 0.0 0.0 0.0 0.0 104-105 1.9125 0.0 0.0 0.0 0.0 106-107 2.325 0.0 0.0 0.0 0.0 108-109 2.7 0.0 0.0 0.0 0.0 110-111 3.2874999999999996 0.0 0.0 0.0 0.0 112-113 3.9749999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1169092 spots for SRR3208039.sra Written 1169092 spots for SRR3208039.sra Read 1169092 spots for SRR3208039.sra Written 1169092 spots for SRR3208039.sra Read 1169092 spots for SRR3208039.sra Written 1169092 spots for SRR3208039.sra Read 1169092 spots for SRR3208039.sra Written 1169092 spots for SRR3208039.sra Read 1169092 spots for SRR3208039.sra Written 1169092 spots for SRR3208039.sra Read 1169092 spots for SRR3208039.sra Written 1169092 spots for SRR3208039.sra Read 1169092 spots for SRR3208039.sra Written 1169092 spots for SRR3208039.sra Read 1169092 spots for SRR3208039.sra Written 1169092 spots for SRR3208039.sra Read 1169092 spots for SRR3208039.sra Written 1169092 spots for SRR3208039.sra Read 1169092 spots for SRR3208039.sra Written 1169092 spots for SRR3208039.sra Read 1169092 spots for SRR3208039.sra Written 1169092 spots for SRR3208039.sra Read 1169092 spots for SRR3208039.sra Written 1169092 spots for SRR3208039.sra Read 1169095 spots for SRR3208039.sra Written 1169095 spots for SRR3208039.sra Read 1169092 spots for SRR3208039.sra Written 1169092 spots for SRR3208039.sra Read 1169092 spots for SRR3208039.sra Written 1169092 spots for SRR3208039.sra Read 1169092 spots for SRR3208039.sra Written 1169092 spots for SRR3208039.sra Read 1169092 spots for SRR3208039.sra Written 1169092 spots for SRR3208039.sra Read 1169092 spots for SRR3208039.sra Written 1169092 spots for SRR3208039.sra Read 1169092 spots for SRR3208039.sra Written 1169092 spots for SRR3208039.sra Read 1169092 spots for SRR3208039.sra Written 1169092 spots for SRR3208039.sra SRR ids: ['SRR3208039.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9nj_juka SRR3208039.sra spots: 23381843 blocks: [[1, 1169092], [1169093, 2338184], [2338185, 3507276], [3507277, 4676368], [4676369, 5845460], [5845461, 7014552], [7014553, 8183644], [8183645, 9352736], [9352737, 10521828], [10521829, 11690920], [11690921, 12860012], [12860013, 14029104], [14029105, 15198196], [15198197, 16367288], [16367289, 17536380], [17536381, 18705472], [18705473, 19874564], [19874565, 21043656], [21043657, 22212748], [22212749, 23381843]] SRR3208039 file size 7490047 SRR3208039 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208039 SRR3208039_1.fastq Input file: SRR3208039_1.fastq trimmed: SRR3208039-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Apr 10 12:51:03 2025 >> started Thu Apr 10 12:51:17 2025 >> done (13.214s) 23381843 reads processed; of these: 16162 ( 0.07%) short reads filtered out after trimming by size control 76762 ( 0.33%) empty reads filtered out after trimming by size control 23288919 (99.60%) reads available; of these: 2602898 (11.18%) trimmed reads available after processing 20686021 (88.82%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 697 0.00% 19 687 0.00% 20 774 0.00% 21 788 0.00% 22 901 0.00% 23 999 0.00% 24 1182 0.01% 25 1313 0.01% 26 1294 0.01% 27 1258 0.01% 28 1205 0.01% 29 1319 0.01% 30 1679 0.01% 31 1538 0.01% 32 1274 0.01% 33 1144 0.00% 34 1157 0.00% 35 1247 0.01% 36 1195 0.01% 37 1230 0.01% 38 1245 0.01% 39 1207 0.01% 40 1273 0.01% 41 1229 0.01% 42 1324 0.01% 43 1358 0.01% 44 1332 0.01% 45 1387 0.01% 46 1410 0.01% 47 1422 0.01% 48 1426 0.01% 49 1442 0.01% 50 1465 0.01% 51 1495 0.01% 52 1500 0.01% 53 1513 0.01% 54 1627 0.01% 55 1693 0.01% 56 1674 0.01% 57 1799 0.01% 58 1910 0.01% 59 1842 0.01% 60 1950 0.01% 61 2063 0.01% 62 2028 0.01% 63 2069 0.01% 64 2152 0.01% 65 2325 0.01% 66 2297 0.01% 67 2240 0.01% 68 2426 0.01% 69 2583 0.01% 70 2706 0.01% 71 2694 0.01% 72 2875 0.01% 73 2920 0.01% 74 3190 0.01% 75 3480 0.01% 76 3706 0.02% 77 3642 0.02% 78 3837 0.02% 79 4237 0.02% 80 4550 0.02% 81 4970 0.02% 82 5469 0.02% 83 6016 0.03% 84 6639 0.03% 85 7026 0.03% 86 7657 0.03% 87 8422 0.04% 88 9284 0.04% 89 10483 0.05% 90 11855 0.05% 91 13673 0.06% 92 15585 0.07% 93 17505 0.08% 94 3492 0.01% 95 3726 0.02% 96 3953 0.02% 97 3985 0.02% 98 4331 0.02% 99 4382 0.02% 100 4829 0.02% 101 5045 0.02% 102 5528 0.02% 103 5506 0.02% 104 5944 0.03% 105 6141 0.03% 106 6791 0.03% 107 7464 0.03% 108 7935 0.03% 109 8770 0.04% 110 9555 0.04% 111 10681 0.05% 112 11989 0.05% 113 13745 0.06% 114 15835 0.07% 115 18601 0.08% 116 21419 0.09% 117 26030 0.11% 118 33985 0.15% 119 43572 0.19% 120 60166 0.26% 121 123121 0.53% 122 133922 0.58% 123 318463 1.37% 124 1433984 6.16% 125 20686021 88.82% 23288919 reads passed initial QC criterion=sequence-density sequence-density=3.68 sequence-density-rank=1 fanout-score=52.36 fanout-score-rank=1 prefix-density=5.09 prefix-fanout=37.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA criterion=fanout-score sequence-density=3.68 sequence-density-rank=1 fanout-score=52.36 fanout-score-rank=1 prefix-density=5.09 prefix-fanout=37.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA -o SRR3208039 - Input file: STDIN trimmed: SRR3208039-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Thu Apr 10 12:52:44 2025 >> started Thu Apr 10 12:52:58 2025 >> done (13.476s) 11644460 reads processed; of these: 156 ( 0.00%) short reads filtered out after trimming by size control 660 ( 0.01%) empty reads filtered out after trimming by size control 11643644 (99.99%) reads available; of these: 1409294 (12.10%) trimmed reads available after processing 10234350 (87.90%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 367 0.00% 19 366 0.00% 20 398 0.00% 21 396 0.00% 22 470 0.00% 23 524 0.00% 24 600 0.01% 25 649 0.01% 26 676 0.01% 27 615 0.01% 28 592 0.01% 29 636 0.01% 30 820 0.01% 31 714 0.01% 32 644 0.01% 33 580 0.00% 34 576 0.00% 35 628 0.01% 36 603 0.01% 37 612 0.01% 38 637 0.01% 39 610 0.01% 40 646 0.01% 41 616 0.01% 42 672 0.01% 43 658 0.01% 44 674 0.01% 45 731 0.01% 46 745 0.01% 47 745 0.01% 48 719 0.01% 49 725 0.01% 50 730 0.01% 51 738 0.01% 52 732 0.01% 53 759 0.01% 54 827 0.01% 55 828 0.01% 56 818 0.01% 57 930 0.01% 58 989 0.01% 59 900 0.01% 60 985 0.01% 61 1034 0.01% 62 1037 0.01% 63 1076 0.01% 64 1059 0.01% 65 1062 0.01% 66 1193 0.01% 67 1108 0.01% 68 1201 0.01% 69 1305 0.01% 70 1358 0.01% 71 1354 0.01% 72 1381 0.01% 73 1428 0.01% 74 1564 0.01% 75 1637 0.01% 76 1688 0.01% 77 1774 0.02% 78 1891 0.02% 79 2128 0.02% 80 2304 0.02% 81 2510 0.02% 82 2762 0.02% 83 2969 0.03% 84 3326 0.03% 85 3527 0.03% 86 3784 0.03% 87 4316 0.04% 88 4662 0.04% 89 5273 0.05% 90 5879 0.05% 91 6724 0.06% 92 7688 0.07% 93 8772 0.08% 94 9754 0.08% 95 10878 0.09% 96 11488 0.10% 97 12802 0.11% 98 14205 0.12% 99 15809 0.14% 100 18209 0.16% 101 20553 0.18% 102 23183 0.20% 103 26083 0.22% 104 28862 0.25% 105 30925 0.27% 106 32762 0.28% 107 34953 0.30% 108 37241 0.32% 109 40691 0.35% 110 44663 0.38% 111 49168 0.42% 112 54689 0.47% 113 59757 0.51% 114 64732 0.56% 115 68573 0.59% 116 72440 0.62% 117 75923 0.65% 118 82205 0.71% 119 90303 0.78% 120 114949 0.99% 121 188806 1.62% 122 356359 3.06% 123 144742 1.24% 124 651545 5.60% 125 9036738 77.61% criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=23.68 fanout-score-rank=10 prefix-density=0.16 prefix-fanout=10.1 sequence=CTGCAGCTGCAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=22 fanout-score=238.47 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=26.2 sequence=CTTCTTCTTCTT Started job on | Apr 10 12:53:25 Started mapping on | Apr 10 12:53:25 Finished on | Apr 10 12:53:57 Mapping speed, Million of reads per hour | 2619.91 Number of input reads | 23288103 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 21972146 Uniquely mapped reads % | 94.35% Average mapped length | 122.75 Number of splices: Total | 8233921 Number of splices: Annotated (sjdb) | 8066145 Number of splices: GT/AG | 8107535 Number of splices: GC/AG | 102951 Number of splices: AT/AC | 8172 Number of splices: Non-canonical | 15263 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.12 Insertion rate per base | 0.02% Insertion average length | 1.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 448504 % of reads mapped to multiple loci | 1.93% Number of reads mapped to too many loci | 320451 % of reads mapped to too many loci | 1.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.34% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 867453 867453 867453 N_multimapping 448504 448504 448504 N_noFeature 974729 11387244 11402342 N_ambiguous 237402 40024 40540 UnstrandedReadsAssigned:20760015 PositiveStrandReadsAssigned:10544878 NegativeStrandReadsAssigned:10529264 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208039 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208039-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,288,103 reads, 21,446,310 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52401 SRR3208039.ke.tsv 34699 SRR3208039.se.tsv 87100 total ==> SRR3208039.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 616 21.8686 Potri.005G024800.1.v4.1 1035 936 127 9.24363 Potri.004G059700.1.v4.1 961 862 15 1.18549 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 356.422 8.53786 Potri.016G087400.1.v4.1 270 171 844 336.249 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 86 3.49991 Potri.012G127500.1.v4.1 977 878 2821 218.889 ==> SRR3208039.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1835 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 399 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 60 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 14 SRR3208039 completed mapping pipeline successfully