Starting /dee2/code/volunteer_pipeline.sh SRR3208040 current disk space = 3048996110336 free memory = 1397396652 SRR3208040 SRAfilesize dcd1eebfc9b5a1bbe685dc4dc66c0836 SRR3208040.sra SRR3208040.sra file validated SRR3208040 is single end SRR3208040 is conventional basespace SRR3208040 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208040_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3485 33.0 33.0 33.0 33.0 33.0 2 32.105 33.0 33.0 33.0 33.0 33.0 3 32.13925 33.0 33.0 33.0 33.0 33.0 4 32.292 33.0 33.0 33.0 33.0 33.0 5 32.31675 33.0 33.0 33.0 33.0 33.0 6 36.05575 37.0 37.0 37.0 37.0 37.0 7 36.16 37.0 37.0 37.0 37.0 37.0 8 36.24375 37.0 37.0 37.0 37.0 37.0 9 36.243 37.0 37.0 37.0 37.0 37.0 10-11 36.267250000000004 37.0 37.0 37.0 37.0 37.0 12-13 36.320875 37.0 37.0 37.0 37.0 37.0 14-15 36.28 37.0 37.0 37.0 37.0 37.0 16-17 36.2905 37.0 37.0 37.0 37.0 37.0 18-19 36.276624999999996 37.0 37.0 37.0 37.0 37.0 20-21 36.29025 37.0 37.0 37.0 37.0 37.0 22-23 36.23375 37.0 37.0 37.0 37.0 37.0 24-25 36.296 37.0 37.0 37.0 37.0 37.0 26-27 36.302 37.0 37.0 37.0 37.0 37.0 28-29 36.27575 37.0 37.0 37.0 37.0 37.0 30-31 36.2655 37.0 37.0 37.0 37.0 37.0 32-33 36.22725 37.0 37.0 37.0 37.0 37.0 34-35 36.214625 37.0 37.0 37.0 37.0 37.0 36-37 36.2395 37.0 37.0 37.0 37.0 37.0 38-39 36.304500000000004 37.0 37.0 37.0 37.0 37.0 40-41 36.218125 37.0 37.0 37.0 37.0 37.0 42-43 36.22775 37.0 37.0 37.0 37.0 37.0 44-45 36.214375000000004 37.0 37.0 37.0 37.0 37.0 46-47 36.243125 37.0 37.0 37.0 37.0 37.0 48-49 36.269 37.0 37.0 37.0 37.0 37.0 50-51 36.243375 37.0 37.0 37.0 37.0 37.0 52-53 36.236125 37.0 37.0 37.0 37.0 37.0 54-55 36.2565 37.0 37.0 37.0 37.0 37.0 56-57 36.147999999999996 37.0 37.0 37.0 37.0 37.0 58-59 36.170874999999995 37.0 37.0 37.0 37.0 37.0 60-61 36.166375 37.0 37.0 37.0 37.0 37.0 62-63 36.202125 37.0 37.0 37.0 37.0 37.0 64-65 36.187250000000006 37.0 37.0 37.0 37.0 37.0 66-67 36.17275 37.0 37.0 37.0 37.0 37.0 68-69 36.173500000000004 37.0 37.0 37.0 37.0 37.0 70-71 36.109125 37.0 37.0 37.0 37.0 37.0 72-73 36.189125000000004 37.0 37.0 37.0 37.0 37.0 74-75 36.11 37.0 37.0 37.0 37.0 37.0 76-77 36.068124999999995 37.0 37.0 37.0 37.0 37.0 78-79 35.9655 37.0 37.0 37.0 37.0 37.0 80-81 35.9995 37.0 37.0 37.0 37.0 37.0 82-83 35.949375 37.0 37.0 37.0 37.0 37.0 84-85 35.979124999999996 37.0 37.0 37.0 37.0 37.0 86-87 35.888999999999996 37.0 37.0 37.0 37.0 37.0 88-89 35.960125000000005 37.0 37.0 37.0 37.0 37.0 90-91 35.902625 37.0 37.0 37.0 37.0 37.0 92-93 35.866 37.0 37.0 37.0 37.0 37.0 94-95 35.912625 37.0 37.0 37.0 37.0 37.0 96-97 35.888374999999996 37.0 37.0 37.0 37.0 37.0 98-99 35.82925 37.0 37.0 37.0 37.0 37.0 100-101 35.835375 37.0 37.0 37.0 37.0 37.0 102-103 35.747875 37.0 37.0 37.0 37.0 37.0 104-105 35.698750000000004 37.0 37.0 37.0 37.0 37.0 106-107 35.652625 37.0 37.0 37.0 37.0 37.0 108-109 35.694625 37.0 37.0 37.0 37.0 37.0 110-111 35.689499999999995 37.0 37.0 37.0 37.0 37.0 112-113 35.579750000000004 37.0 37.0 37.0 37.0 37.0 114-115 35.604 37.0 37.0 37.0 37.0 37.0 116-117 35.493375 37.0 37.0 37.0 33.0 37.0 118-119 35.51575 37.0 37.0 37.0 37.0 37.0 120-121 35.400625 37.0 37.0 37.0 37.0 37.0 122-123 35.397875 37.0 37.0 37.0 37.0 37.0 124-125 33.768 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 3.0 9 1.0 10 0.0 11 1.0 12 2.0 13 0.0 14 2.0 15 3.0 16 2.0 17 0.0 18 2.0 19 0.0 20 4.0 21 4.0 22 6.0 23 7.0 24 5.0 25 9.0 26 6.0 27 9.0 28 21.0 29 18.0 30 32.0 31 44.0 32 66.0 33 91.0 34 137.0 35 258.0 36 3248.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.005141388174806 15.269922879177377 12.36503856041131 50.3598971722365 2 18.325 21.475 40.725 19.475 3 19.975 26.674999999999997 28.725 24.625 4 24.375 31.3 20.724999999999998 23.599999999999998 5 24.875 33.925 22.400000000000002 18.8 6 19.175 36.95 23.549999999999997 20.325 7 17.625 18.375 43.1 20.9 8 18.625 22.975 31.900000000000002 26.5 9 19.45 23.225 33.475 23.849999999999998 10-11 22.650000000000002 31.7375 23.724999999999998 21.8875 12-13 20.974999999999998 26.525 29.1625 23.3375 14-15 20.4625 27.237499999999997 29.575000000000003 22.725 16-17 22.0625 27.025 28.65 22.2625 18-19 21.025 29.012500000000003 27.200000000000003 22.7625 20-21 20.962500000000002 28.6125 28.287499999999998 22.1375 22-23 21.712500000000002 29.225 26.6 22.4625 24-25 21.2375 29.349999999999998 27.375 22.037499999999998 26-27 21.3625 28.275 28.199999999999996 22.162499999999998 28-29 21.712500000000002 28.95 27.237499999999997 22.1 30-31 21.80545136284071 28.169542385596397 28.75718929732433 21.267816954238562 32-33 21.215911933950462 29.359519639729797 27.395546659994995 22.029021766324743 34-35 21.1579342253345 28.148055520820307 28.298111791921972 22.39589846192322 36-37 22.3625 27.700000000000003 27.5625 22.375 38-39 22.35 27.487499999999997 28.7375 21.425 40-41 22.4875 28.499999999999996 27.4125 21.6 42-43 21.7375 28.4375 28.3875 21.4375 44-45 22.275 27.425 28.449999999999996 21.85 46-47 21.25 27.85 28.475 22.425 48-49 21.375 27.3 29.075 22.25 50-51 21.175 28.625 27.9375 22.2625 52-53 21.8875 28.212500000000002 26.737499999999997 23.1625 54-55 21.9 27.650000000000002 28.5625 21.8875 56-57 21.462500000000002 28.175 27.925 22.4375 58-59 21.6125 27.712500000000002 28.6125 22.0625 60-61 21.4125 27.3375 28.512500000000003 22.7375 62-63 20.7625 28.549999999999997 28.3875 22.3 64-65 21.9 27.6875 28.775000000000002 21.637500000000003 66-67 21.725 28.1125 28.3125 21.85 68-69 22.233337501563085 28.360635238214332 27.58534450418907 21.820682756033513 70-71 21.55 28.849999999999998 27.712500000000002 21.8875 72-73 21.875 28.050000000000004 27.8625 22.2125 74-75 21.837500000000002 28.725 27.975 21.462500000000002 76-77 21.702712839104887 28.416052006500813 27.853481685210653 22.027753469183647 78-79 21.620607727897962 28.398149305989744 28.010503938977116 21.970739027135174 80-81 22.079059294470856 28.371278458844134 27.47060295221416 22.079059294470856 82-83 21.327665958244783 28.803600450056255 27.165895736967123 22.702837854731843 84-85 22.175 28.575 27.3125 21.9375 86-87 22.037499999999998 28.299999999999997 28.275 21.3875 88-89 23.0375 28.199999999999996 26.724999999999998 22.037499999999998 90-91 21.8125 28.462500000000002 27.8375 21.8875 92-93 22.35 27.712500000000002 27.675 22.2625 94-95 22.675 28.237499999999997 27.85 21.2375 96-97 22.1 28.1125 28.237499999999997 21.55 98-99 22.8125 28.012500000000003 27.9125 21.2625 100-101 22.675 28.212500000000002 27.8625 21.25 102-103 23.05 28.775000000000002 26.650000000000002 21.525 104-105 22.26113056528264 29.30215107553777 27.288644322161083 21.14807403701851 106-107 21.823411705852926 28.27663831915958 27.876438219109556 22.02351175587794 108-109 22.808553207452796 27.68538201825685 28.373139927472803 21.13292484681756 110-111 23.2125 28.9 26.525 21.3625 112-113 22.9625 28.537499999999998 27.575 20.925 114-115 23.45 27.925 26.775 21.85 116-117 22.725 29.549999999999997 26.987499999999997 20.7375 118-119 23.8125 28.7 26.3625 21.125 120-121 23.400000000000002 28.487499999999997 26.2125 21.9 122-123 23.125 28.999999999999996 26.137500000000003 21.7375 124-125 23.1 29.212500000000002 26.174999999999997 21.512500000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 1.0 23 1.0 24 4.0 25 3.5 26 3.5 27 7.0 28 9.5 29 14.0 30 22.0 31 29.5 32 36.5 33 52.5 34 57.5 35 66.5 36 89.0 37 105.0 38 129.0 39 167.0 40 195.5 41 230.0 42 267.0 43 269.0 44 270.5 45 285.5 46 279.5 47 239.5 48 213.5 49 189.0 50 156.0 51 127.5 52 103.5 53 80.0 54 57.5 55 45.0 56 35.0 57 34.5 58 23.5 59 11.5 60 9.5 61 12.5 62 13.0 63 8.0 64 7.5 65 6.5 66 4.0 67 3.5 68 3.0 69 3.0 70 2.0 71 2.5 72 3.0 73 2.0 74 1.0 75 1.0 76 1.0 77 1.0 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.025 32-33 0.075 34-35 0.0375 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0375 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0125 78-79 0.0375 80-81 0.075 82-83 0.0125 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.05 106-107 0.05 108-109 0.0375 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79934788061199 99.47500000000001 2 0.15048908954100826 0.3 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025081514923501375 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTA 6 0.15 TruSeq Adapter, Index 14 (97% over 44bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.175 0.0 0.0 0.0 0.0 2 0.175 0.0 0.0 0.0 0.0 3 0.175 0.0 0.0 0.0 0.0 4 0.175 0.0 0.0 0.0 0.0 5 0.175 0.0 0.0 0.0 0.0 6 0.175 0.0 0.0 0.0 0.0 7 0.175 0.0 0.0 0.0 0.0 8 0.175 0.0 0.0 0.0 0.0 9 0.175 0.0 0.0 0.0 0.0 10-11 0.175 0.0 0.0 0.0 0.0 12-13 0.175 0.0 0.0 0.0 0.0 14-15 0.175 0.0 0.0 0.0 0.0 16-17 0.1875 0.0 0.0 0.0 0.0 18-19 0.2 0.0 0.0 0.0 0.0 20-21 0.225 0.0 0.0 0.0 0.0 22-23 0.25 0.0 0.0 0.0 0.0 24-25 0.25 0.0 0.0 0.0 0.0 26-27 0.25 0.0 0.0 0.0 0.0 28-29 0.25 0.0 0.0 0.0 0.0 30-31 0.25 0.0 0.0 0.0 0.0 32-33 0.25 0.0 0.0 0.0 0.0 34-35 0.25 0.0 0.0 0.0 0.0 36-37 0.25 0.0 0.0 0.0 0.0 38-39 0.25 0.0 0.0 0.0 0.0 40-41 0.25 0.0 0.0 0.0 0.0 42-43 0.25 0.0 0.0 0.0 0.0 44-45 0.25 0.0 0.0 0.0 0.0 46-47 0.25 0.0 0.0 0.0 0.0 48-49 0.25 0.0 0.0 0.0 0.0 50-51 0.25 0.0 0.0 0.0 0.0 52-53 0.25 0.0 0.0 0.0 0.0 54-55 0.25 0.0 0.0 0.0 0.0 56-57 0.25 0.0 0.0 0.0 0.0 58-59 0.25 0.0 0.0 0.0 0.0 60-61 0.25 0.0 0.0 0.0 0.0 62-63 0.25 0.0 0.0 0.0 0.0 64-65 0.25 0.0 0.0 0.0 0.0 66-67 0.25 0.0 0.0 0.0 0.0 68-69 0.25 0.0 0.0 0.0 0.0 70-71 0.275 0.0 0.0 0.0 0.0 72-73 0.275 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.38749999999999996 0.0 0.0 0.0 0.0 84-85 0.425 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.6625000000000001 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.15 0.0 0.0 0.0 0.0 100-101 1.45 0.0 0.0 0.0 0.0 102-103 1.8125 0.0 0.0 0.0 0.0 104-105 2.2875 0.0 0.0 0.0 0.0 106-107 2.7 0.0 0.0 0.0 0.0 108-109 3.2625 0.0 0.0 0.0 0.0 110-111 4.137499999999999 0.0 0.0 0.0 0.0 112-113 4.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCACG 15 0.0040863203 59.49375 12-13 >>END_MODULE Read 1128892 spots for SRR3208040.sra Written 1128892 spots for SRR3208040.sra Read 1128892 spots for SRR3208040.sra Written 1128892 spots for SRR3208040.sra Read 1128892 spots for SRR3208040.sra Written 1128892 spots for SRR3208040.sra Read 1128892 spots for SRR3208040.sra Written 1128892 spots for SRR3208040.sra Read 1128892 spots for SRR3208040.sra Written 1128892 spots for SRR3208040.sra Read 1128892 spots for SRR3208040.sra Written 1128892 spots for SRR3208040.sra Read 1128892 spots for SRR3208040.sra Written 1128892 spots for SRR3208040.sra Read 1128892 spots for SRR3208040.sra Written 1128892 spots for SRR3208040.sra Read 1128892 spots for SRR3208040.sra Written 1128892 spots for SRR3208040.sra Read 1128892 spots for SRR3208040.sra Written 1128892 spots for SRR3208040.sra Read 1128892 spots for SRR3208040.sra Written 1128892 spots for SRR3208040.sra Read 1128892 spots for SRR3208040.sra Written 1128892 spots for SRR3208040.sra Read 1128892 spots for SRR3208040.sra Written 1128892 spots for SRR3208040.sra Read 1128892 spots for SRR3208040.sra Written 1128892 spots for SRR3208040.sra Read 1128892 spots for SRR3208040.sra Written 1128892 spots for SRR3208040.sra Read 1128892 spots for SRR3208040.sra Written 1128892 spots for SRR3208040.sra Read 1128892 spots for SRR3208040.sra Written 1128892 spots for SRR3208040.sra Read 1128892 spots for SRR3208040.sra Written 1128892 spots for SRR3208040.sra Read 1128900 spots for SRR3208040.sra Written 1128900 spots for SRR3208040.sra Read 1128892 spots for SRR3208040.sra Written 1128892 spots for SRR3208040.sra SRR ids: ['SRR3208040.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ex29p1vx SRR3208040.sra spots: 22577848 blocks: [[1, 1128892], [1128893, 2257784], [2257785, 3386676], [3386677, 4515568], [4515569, 5644460], [5644461, 6773352], [6773353, 7902244], [7902245, 9031136], [9031137, 10160028], [10160029, 11288920], [11288921, 12417812], [12417813, 13546704], [13546705, 14675596], [14675597, 15804488], [15804489, 16933380], [16933381, 18062272], [18062273, 19191164], [19191165, 20320056], [20320057, 21448948], [21448949, 22577848]] SRR3208040 file size 7232129 SRR3208040 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208040 SRR3208040_1.fastq Input file: SRR3208040_1.fastq trimmed: SRR3208040-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 03:17:13 2025 >> started Wed Feb 12 03:17:26 2025 >> done (13.081s) 22577848 reads processed; of these: 17297 ( 0.08%) short reads filtered out after trimming by size control 102302 ( 0.45%) empty reads filtered out after trimming by size control 22458249 (99.47%) reads available; of these: 2582711 (11.50%) trimmed reads available after processing 19875538 (88.50%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 732 0.00% 19 755 0.00% 20 892 0.00% 21 819 0.00% 22 902 0.00% 23 1060 0.00% 24 1128 0.01% 25 1426 0.01% 26 1311 0.01% 27 1214 0.01% 28 1179 0.01% 29 1402 0.01% 30 1790 0.01% 31 1840 0.01% 32 1179 0.01% 33 1129 0.01% 34 1075 0.00% 35 1189 0.01% 36 1169 0.01% 37 1152 0.01% 38 1152 0.01% 39 1172 0.01% 40 1289 0.01% 41 1255 0.01% 42 1289 0.01% 43 1268 0.01% 44 1289 0.01% 45 1298 0.01% 46 1331 0.01% 47 1275 0.01% 48 1302 0.01% 49 1362 0.01% 50 1429 0.01% 51 1463 0.01% 52 1460 0.01% 53 1502 0.01% 54 1470 0.01% 55 1662 0.01% 56 1590 0.01% 57 1727 0.01% 58 1759 0.01% 59 1771 0.01% 60 1894 0.01% 61 1874 0.01% 62 1920 0.01% 63 1848 0.01% 64 2133 0.01% 65 2212 0.01% 66 2150 0.01% 67 2168 0.01% 68 2315 0.01% 69 2312 0.01% 70 2564 0.01% 71 2748 0.01% 72 2834 0.01% 73 2993 0.01% 74 3194 0.01% 75 3535 0.02% 76 3863 0.02% 77 3715 0.02% 78 3996 0.02% 79 4458 0.02% 80 4738 0.02% 81 5504 0.02% 82 5982 0.03% 83 6640 0.03% 84 7211 0.03% 85 7700 0.03% 86 8569 0.04% 87 9421 0.04% 88 10396 0.05% 89 11953 0.05% 90 13701 0.06% 91 15558 0.07% 92 18022 0.08% 93 20128 0.09% 94 3488 0.02% 95 3637 0.02% 96 3820 0.02% 97 4221 0.02% 98 4333 0.02% 99 4525 0.02% 100 4824 0.02% 101 5052 0.02% 102 5503 0.02% 103 5572 0.02% 104 5998 0.03% 105 6437 0.03% 106 6795 0.03% 107 7198 0.03% 108 7903 0.04% 109 8802 0.04% 110 9428 0.04% 111 10709 0.05% 112 12052 0.05% 113 13769 0.06% 114 15652 0.07% 115 18463 0.08% 116 21608 0.10% 117 26061 0.12% 118 33713 0.15% 119 43950 0.20% 120 59745 0.27% 121 121894 0.54% 122 133869 0.60% 123 313268 1.39% 124 1405715 6.26% 125 19875538 88.50% 22458249 reads passed initial QC criterion=sequence-density sequence-density=4.33 sequence-density-rank=1 fanout-score=48.70 fanout-score-rank=1 prefix-density=5.91 prefix-fanout=35.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=fanout-score sequence-density=4.33 sequence-density-rank=1 fanout-score=48.70 fanout-score-rank=1 prefix-density=5.91 prefix-fanout=35.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTGAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTGAAAA -o SRR3208040 - Input file: STDIN trimmed: SRR3208040-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 03:18:30 2025 >> started Wed Feb 12 03:18:46 2025 >> done (15.406s) 13474950 reads processed; of these: 156 ( 0.00%) short reads filtered out after trimming by size control 887 ( 0.01%) empty reads filtered out after trimming by size control 13473907 (99.99%) reads available; of these: 1802095 (13.37%) trimmed reads available after processing 11671812 (86.63%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 466 0.00% 19 436 0.00% 20 523 0.00% 21 492 0.00% 22 557 0.00% 23 619 0.00% 24 665 0.00% 25 853 0.01% 26 796 0.01% 27 720 0.01% 28 717 0.01% 29 842 0.01% 30 1054 0.01% 31 1116 0.01% 32 712 0.01% 33 724 0.01% 34 649 0.00% 35 717 0.01% 36 690 0.01% 37 691 0.01% 38 675 0.01% 39 702 0.01% 40 762 0.01% 41 753 0.01% 42 772 0.01% 43 784 0.01% 44 774 0.01% 45 789 0.01% 46 813 0.01% 47 793 0.01% 48 767 0.01% 49 836 0.01% 50 873 0.01% 51 911 0.01% 52 892 0.01% 53 920 0.01% 54 909 0.01% 55 983 0.01% 56 940 0.01% 57 1045 0.01% 58 1056 0.01% 59 1073 0.01% 60 1147 0.01% 61 1136 0.01% 62 1147 0.01% 63 1090 0.01% 64 1263 0.01% 65 1236 0.01% 66 1273 0.01% 67 1248 0.01% 68 1408 0.01% 69 1374 0.01% 70 1538 0.01% 71 1647 0.01% 72 1702 0.01% 73 1823 0.01% 74 1891 0.01% 75 1970 0.01% 76 2089 0.02% 77 2148 0.02% 78 2400 0.02% 79 2714 0.02% 80 2781 0.02% 81 3301 0.02% 82 3630 0.03% 83 4028 0.03% 84 4344 0.03% 85 4593 0.03% 86 5193 0.04% 87 5717 0.04% 88 6348 0.05% 89 7303 0.05% 90 8222 0.06% 91 9207 0.07% 92 10751 0.08% 93 12220 0.09% 94 13477 0.10% 95 14802 0.11% 96 15901 0.12% 97 17518 0.13% 98 19417 0.14% 99 21748 0.16% 100 24729 0.18% 101 28266 0.21% 102 32160 0.24% 103 35852 0.27% 104 39110 0.29% 105 41716 0.31% 106 43446 0.32% 107 46364 0.34% 108 49525 0.37% 109 53443 0.40% 110 58470 0.43% 111 64431 0.48% 112 71711 0.53% 113 78255 0.58% 114 83904 0.62% 115 88893 0.66% 116 92607 0.69% 117 95736 0.71% 118 103094 0.77% 119 113623 0.84% 120 142160 1.06% 121 225659 1.67% 122 420907 3.12% 123 167325 1.24% 124 752822 5.59% 125 10264093 76.18% criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=6.50 fanout-score-rank=19 prefix-density=0.11 prefix-fanout=3.8 sequence=TTCAACCAAGCGCG criterion=fanout-score sequence-density=0.05 sequence-density-rank=20 fanout-score=266.88 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=27.4 sequence=CTTCTTCTTCTT Started job on | Feb 12 03:19:17 Started mapping on | Feb 12 03:19:17 Finished on | Feb 12 03:19:53 Mapping speed, Million of reads per hour | 2245.72 Number of input reads | 22457206 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 20839749 Uniquely mapped reads % | 92.80% Average mapped length | 122.55 Number of splices: Total | 8024588 Number of splices: Annotated (sjdb) | 7867063 Number of splices: GT/AG | 7900131 Number of splices: GC/AG | 102272 Number of splices: AT/AC | 7923 Number of splices: Non-canonical | 14262 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.15 Insertion rate per base | 0.02% Insertion average length | 1.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 443188 % of reads mapped to multiple loci | 1.97% Number of reads mapped to too many loci | 651679 % of reads mapped to too many loci | 2.90% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.31% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1174269 1174269 1174269 N_multimapping 443188 443188 443188 N_noFeature 913868 10797951 10819570 N_ambiguous 212312 37947 38716 UnstrandedReadsAssigned:19713569 PositiveStrandReadsAssigned:10003851 NegativeStrandReadsAssigned:9981463 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208040 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208040-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,457,206 reads, 20,663,946 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,168 rounds 52401 SRR3208040.ke.tsv 34699 SRR3208040.se.tsv 87100 total ==> SRR3208040.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 530 19.326 Potri.005G024800.1.v4.1 1035 936 94 7.02736 Potri.004G059700.1.v4.1 961 862 9 0.730593 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 399.258 9.82346 Potri.016G087400.1.v4.1 270 171 913 373.607 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 86 3.59487 Potri.012G127500.1.v4.1 977 878 2887 230.087 ==> SRR3208040.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1808 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 364 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 54 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 15 SRR3208040 completed mapping pipeline successfully