Starting /dee2/code/volunteer_pipeline.sh SRR3208041 current disk space = 3048977735680 free memory = 1579603180 SRR3208041 SRAfilesize 498d7645a56db2275c1d9e045dbfa5a1 SRR3208041.sra SRR3208041.sra file validated SRR3208041 is single end SRR3208041 is conventional basespace SRR3208041 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208041_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.56975 33.0 33.0 33.0 33.0 33.0 2 32.137 33.0 33.0 33.0 33.0 33.0 3 32.0845 33.0 33.0 33.0 33.0 33.0 4 32.30175 33.0 33.0 33.0 33.0 33.0 5 32.26825 33.0 33.0 33.0 33.0 33.0 6 35.91275 37.0 37.0 37.0 37.0 37.0 7 36.058 37.0 37.0 37.0 37.0 37.0 8 35.9215 37.0 37.0 37.0 37.0 37.0 9 36.07675 37.0 37.0 37.0 37.0 37.0 10-11 36.061499999999995 37.0 37.0 37.0 37.0 37.0 12-13 36.115125 37.0 37.0 37.0 37.0 37.0 14-15 36.041375 37.0 37.0 37.0 37.0 37.0 16-17 36.1905 37.0 37.0 37.0 37.0 37.0 18-19 36.107625 37.0 37.0 37.0 37.0 37.0 20-21 36.1475 37.0 37.0 37.0 37.0 37.0 22-23 36.067750000000004 37.0 37.0 37.0 37.0 37.0 24-25 36.12925 37.0 37.0 37.0 37.0 37.0 26-27 36.10325 37.0 37.0 37.0 37.0 37.0 28-29 36.037125 37.0 37.0 37.0 37.0 37.0 30-31 36.083749999999995 37.0 37.0 37.0 37.0 37.0 32-33 36.082750000000004 37.0 37.0 37.0 37.0 37.0 34-35 36.022999999999996 37.0 37.0 37.0 37.0 37.0 36-37 36.08475 37.0 37.0 37.0 37.0 37.0 38-39 36.00375 37.0 37.0 37.0 37.0 37.0 40-41 36.002375 37.0 37.0 37.0 37.0 37.0 42-43 36.00875 37.0 37.0 37.0 37.0 37.0 44-45 35.9965 37.0 37.0 37.0 37.0 37.0 46-47 35.9705 37.0 37.0 37.0 37.0 37.0 48-49 36.02225 37.0 37.0 37.0 37.0 37.0 50-51 35.98125 37.0 37.0 37.0 37.0 37.0 52-53 36.013625 37.0 37.0 37.0 37.0 37.0 54-55 35.953 37.0 37.0 37.0 37.0 37.0 56-57 35.9465 37.0 37.0 37.0 37.0 37.0 58-59 35.99575 37.0 37.0 37.0 37.0 37.0 60-61 36.003625 37.0 37.0 37.0 37.0 37.0 62-63 36.028875 37.0 37.0 37.0 37.0 37.0 64-65 35.973 37.0 37.0 37.0 37.0 37.0 66-67 35.9385 37.0 37.0 37.0 37.0 37.0 68-69 35.890375000000006 37.0 37.0 37.0 37.0 37.0 70-71 35.7795 37.0 37.0 37.0 37.0 37.0 72-73 35.81 37.0 37.0 37.0 37.0 37.0 74-75 35.780375 37.0 37.0 37.0 37.0 37.0 76-77 35.49975 37.0 37.0 37.0 37.0 37.0 78-79 35.404250000000005 37.0 37.0 37.0 37.0 37.0 80-81 35.426125 37.0 37.0 37.0 37.0 37.0 82-83 35.41175 37.0 37.0 37.0 37.0 37.0 84-85 35.411874999999995 37.0 37.0 37.0 37.0 37.0 86-87 35.341 37.0 37.0 37.0 37.0 37.0 88-89 35.284375 37.0 37.0 37.0 37.0 37.0 90-91 35.250625 37.0 37.0 37.0 37.0 37.0 92-93 35.293625 37.0 37.0 37.0 37.0 37.0 94-95 35.333375000000004 37.0 37.0 37.0 37.0 37.0 96-97 35.26325 37.0 37.0 37.0 35.0 37.0 98-99 35.248875 37.0 37.0 37.0 37.0 37.0 100-101 35.142125 37.0 37.0 37.0 33.0 37.0 102-103 35.221875 37.0 37.0 37.0 37.0 37.0 104-105 35.15975 37.0 37.0 37.0 33.0 37.0 106-107 35.11425 37.0 37.0 37.0 33.0 37.0 108-109 35.121375 37.0 37.0 37.0 35.0 37.0 110-111 35.068 37.0 37.0 37.0 33.0 37.0 112-113 35.020624999999995 37.0 37.0 37.0 33.0 37.0 114-115 34.999125 37.0 37.0 37.0 33.0 37.0 116-117 34.918625000000006 37.0 37.0 37.0 33.0 37.0 118-119 34.888125 37.0 37.0 37.0 33.0 37.0 120-121 34.89075 37.0 37.0 37.0 33.0 37.0 122-123 34.736125 37.0 37.0 37.0 33.0 37.0 124-125 33.22325 37.0 35.0 37.0 17.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 28.0 3 3.0 4 2.0 5 1.0 6 0.0 7 0.0 8 1.0 9 4.0 10 1.0 11 1.0 12 3.0 13 3.0 14 2.0 15 1.0 16 3.0 17 2.0 18 5.0 19 6.0 20 4.0 21 6.0 22 32.0 23 14.0 24 5.0 25 12.0 26 9.0 27 12.0 28 21.0 29 25.0 30 39.0 31 33.0 32 79.0 33 81.0 34 140.0 35 227.0 36 3195.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.4123947972456 14.486100484570263 13.2109155827595 48.89058913542464 2 18.2 23.3 37.925 20.575 3 20.1 25.275 29.9 24.725 4 23.849999999999998 30.45 20.125 25.575 5 26.025 33.050000000000004 23.599999999999998 17.325 6 20.125 35.8 23.375 20.7 7 17.974999999999998 20.1 41.3 20.625 8 18.35 25.6 31.075000000000003 24.975 9 20.625 23.65 32.1 23.625 10-11 22.537499999999998 32.9125 23.1875 21.3625 12-13 20.549999999999997 27.4125 29.299999999999997 22.7375 14-15 20.575 28.762500000000003 27.975 22.6875 16-17 21.7 27.55 27.0875 23.6625 18-19 21.7875 27.762500000000003 27.85 22.6 20-21 22.25 27.8625 27.425 22.4625 22-23 21.337500000000002 29.925 26.8 21.9375 24-25 20.974999999999998 28.675 27.5875 22.7625 26-27 21.4875 27.537499999999998 27.275 23.7 28-29 22.61815453863466 28.432108027006752 27.956989247311824 20.99274818704676 30-31 21.388367729831145 27.392120075046904 28.017510944340213 23.20200125078174 32-33 21.12112112112112 27.915415415415417 27.652652652652655 23.31081081081081 34-35 21.41338336460288 29.068167604752972 27.166979362101312 22.35146966854284 36-37 21.77772221527691 27.29091136392049 28.34104263032879 22.59032379047381 38-39 20.84271067766942 28.857214303575894 27.694423605901473 22.605651412853213 40-41 22.53063265816454 28.244561140285075 27.181795448862218 22.043010752688172 42-43 21.627703462932867 28.89111138892362 27.953494186773348 21.527690961370173 44-45 22.3125 27.025 28.050000000000004 22.6125 46-47 22.1 27.1625 27.800000000000004 22.9375 48-49 22.412499999999998 28.775000000000002 27.675 21.1375 50-51 21.875 27.0875 28.012500000000003 23.025000000000002 52-53 21.025 28.050000000000004 27.575 23.35 54-55 22.0 27.800000000000004 27.700000000000003 22.5 56-57 21.587500000000002 27.537499999999998 28.599999999999998 22.275 58-59 21.337500000000002 27.05 28.512500000000003 23.1 60-61 22.5875 27.85 28.0625 21.5 62-63 22.175 27.6875 27.975 22.162499999999998 64-65 22.1875 28.212500000000002 28.7 20.9 66-67 21.475 30.412499999999998 27.375 20.7375 68-69 21.040130016252032 29.953744218027257 26.64083010376297 22.365295661957745 70-71 21.0375 30.3875 27.275 21.3 72-73 21.5 28.849999999999998 27.150000000000002 22.5 74-75 21.637500000000003 29.8875 27.3875 21.087500000000002 76-77 22.162499999999998 29.9875 25.887500000000003 21.9625 78-79 21.477684710588825 28.34104263032879 28.003500437554695 22.177772221527693 80-81 21.745654620482682 28.535700887832938 27.42278354382894 22.295860947855445 82-83 22.375 28.449999999999996 27.200000000000003 21.975 84-85 21.087500000000002 27.725 28.199999999999996 22.9875 86-87 22.325 27.3125 28.425 21.9375 88-89 22.3875 28.299999999999997 28.262500000000003 21.05 90-91 21.4375 27.474999999999998 27.700000000000003 23.3875 92-93 21.125 28.6625 27.650000000000002 22.5625 94-95 22.225 27.3875 28.5625 21.825 96-97 22.35 27.675 27.2625 22.7125 98-99 22.3375 28.025 28.4375 21.2 100-101 21.8625 28.999999999999996 27.425 21.712500000000002 102-103 23.05 27.900000000000002 27.6875 21.3625 104-105 21.952744093011624 28.403550443805475 28.316039504938118 21.327665958244783 106-107 22.765345668208525 28.816102012751593 27.19089886235779 21.227653456682084 108-109 21.340167520940117 29.541192649081133 27.3284160520065 21.790223777972244 110-111 22.3125 28.299999999999997 27.375 22.0125 112-113 23.35 28.249999999999996 25.900000000000002 22.5 114-115 22.112499999999997 29.7 26.937499999999996 21.25 116-117 24.025 28.6375 26.8375 20.5 118-119 23.2875 28.449999999999996 26.200000000000003 22.0625 120-121 23.75 28.0625 26.237500000000004 21.95 122-123 22.9625 28.5875 26.5 21.95 124-125 23.575 28.5875 25.587500000000002 22.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 1.5 23 0.5 24 0.0 25 3.5 26 6.0 27 6.0 28 10.5 29 19.0 30 18.5 31 21.0 32 35.0 33 42.0 34 49.0 35 65.0 36 91.0 37 114.5 38 130.5 39 154.0 40 185.5 41 225.5 42 257.5 43 270.5 44 269.5 45 280.0 46 287.0 47 250.5 48 221.0 49 193.5 50 157.5 51 135.0 52 106.5 53 87.0 54 65.5 55 50.5 56 38.5 57 21.5 58 20.5 59 18.0 60 15.0 61 14.0 62 12.5 63 11.0 64 8.0 65 5.0 66 5.0 67 4.0 68 2.5 69 2.5 70 1.5 71 0.5 72 0.5 73 1.5 74 2.0 75 1.5 76 1.5 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.975 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.025 30-31 0.0625 32-33 0.1 34-35 0.0625 36-37 0.0125 38-39 0.025 40-41 0.025 42-43 0.0125 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0125 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0125 80-81 0.0375 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0125 106-107 0.0125 108-109 0.0125 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59183673469387 97.6 2 0.35714285714285715 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025510204081632654 0.27499999999999997 >50 0.025510204081632654 1.425 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTAT 57 1.425 TruSeq Adapter, Index 15 (97% over 40bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTA 11 0.27499999999999997 TruSeq Adapter, Index 15 (97% over 40bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.275 0.0 0.0 0.0 0.0 2 0.3 0.0 0.0 0.0 0.0 3 0.3 0.0 0.0 0.0 0.0 4 0.3 0.0 0.0 0.0 0.0 5 0.3 0.0 0.0 0.0 0.0 6 0.3 0.0 0.0 0.0 0.0 7 0.3 0.0 0.0 0.0 0.0 8 0.3 0.0 0.0 0.0 0.0 9 0.3 0.0 0.0 0.0 0.0 10-11 0.3 0.0 0.0 0.0 0.0 12-13 0.3 0.0 0.0 0.0 0.0 14-15 0.3 0.0 0.0 0.0 0.0 16-17 0.325 0.0 0.0 0.0 0.0 18-19 0.325 0.0 0.0 0.0 0.0 20-21 0.35 0.0 0.0 0.0 0.0 22-23 0.35 0.0 0.0 0.0 0.0 24-25 0.35 0.0 0.0 0.0 0.0 26-27 0.35 0.0 0.0 0.0 0.0 28-29 0.35 0.0 0.0 0.0 0.0 30-31 0.35 0.0 0.0 0.0 0.0 32-33 0.35 0.0 0.0 0.0 0.0 34-35 0.35 0.0 0.0 0.0 0.0 36-37 0.35 0.0 0.0 0.0 0.0 38-39 0.35 0.0 0.0 0.0 0.0 40-41 0.35 0.0 0.0 0.0 0.0 42-43 0.35 0.0 0.0 0.0 0.0 44-45 0.35 0.0 0.0 0.0 0.0 46-47 0.35 0.0 0.0 0.0 0.0 48-49 0.35 0.0 0.0 0.0 0.0 50-51 0.35 0.0 0.0 0.0 0.0 52-53 0.35 0.0 0.0 0.0 0.0 54-55 0.35 0.0 0.0 0.0 0.0 56-57 0.35 0.0 0.0 0.0 0.0 58-59 0.35 0.0 0.0 0.0 0.0 60-61 0.35 0.0 0.0 0.0 0.0 62-63 0.375 0.0 0.0 0.0 0.0 64-65 0.4 0.0 0.0 0.0 0.0 66-67 0.45 0.0 0.0 0.0 0.0 68-69 0.475 0.0 0.0 0.0 0.0 70-71 0.4875 0.0 0.0 0.0 0.0 72-73 0.525 0.0 0.0 0.0 0.0 74-75 0.5375000000000001 0.0 0.0 0.0 0.0 76-77 0.5874999999999999 0.0 0.0 0.0 0.0 78-79 0.7375 0.0 0.0 0.0 0.0 80-81 0.7875000000000001 0.0 0.0 0.0 0.0 82-83 0.8 0.0 0.0 0.0 0.0 84-85 0.825 0.0 0.0 0.0 0.0 86-87 0.9125000000000001 0.0 0.0 0.0 0.0 88-89 0.9624999999999999 0.0 0.0 0.0 0.0 90-91 1.0125 0.0 0.0 0.0 0.0 92-93 1.2 0.0 0.0 0.0 0.0 94-95 1.4375 0.0 0.0 0.0 0.0 96-97 1.75 0.0 0.0 0.0 0.0 98-99 2.0625 0.0 0.0 0.0 0.0 100-101 2.3625 0.0 0.0 0.0 0.0 102-103 2.7875 0.0 0.0 0.0 0.0 104-105 3.3 0.0 0.0 0.0 0.0 106-107 4.125 0.0 0.0 0.0 0.0 108-109 4.8125 0.0 0.0 0.0 0.0 110-111 5.637499999999999 0.0 0.0 0.0 0.0 112-113 6.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 976539 spots for SRR3208041.sra Written 976539 spots for SRR3208041.sra Read 976539 spots for SRR3208041.sra Written 976539 spots for SRR3208041.sra Read 976539 spots for SRR3208041.sra Written 976539 spots for SRR3208041.sra Read 976539 spots for SRR3208041.sra Written 976539 spots for SRR3208041.sra Read 976539 spots for SRR3208041.sra Written 976539 spots for SRR3208041.sra Read 976539 spots for SRR3208041.sra Written 976539 spots for SRR3208041.sra Read 976539 spots for SRR3208041.sra Written 976539 spots for SRR3208041.sra Read 976539 spots for SRR3208041.sra Written 976539 spots for SRR3208041.sra Read 976539 spots for SRR3208041.sra Written 976539 spots for SRR3208041.sra Read 976539 spots for SRR3208041.sra Written 976539 spots for SRR3208041.sra Read 976539 spots for SRR3208041.sra Written 976539 spots for SRR3208041.sra Read 976539 spots for SRR3208041.sra Written 976539 spots for SRR3208041.sra Read 976539 spots for SRR3208041.sra Written 976539 spots for SRR3208041.sra Read 976539 spots for SRR3208041.sra Written 976539 spots for SRR3208041.sra Read 976539 spots for SRR3208041.sra Written 976539 spots for SRR3208041.sra Read 976539 spots for SRR3208041.sra Written 976539 spots for SRR3208041.sra Read 976539 spots for SRR3208041.sra Written 976539 spots for SRR3208041.sra Read 976539 spots for SRR3208041.sra Written 976539 spots for SRR3208041.sra Read 976539 spots for SRR3208041.sra Written 976539 spots for SRR3208041.sra Read 976542 spots for SRR3208041.sra Written 976542 spots for SRR3208041.sra SRR ids: ['SRR3208041.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3ht4jvbw SRR3208041.sra spots: 19530783 blocks: [[1, 976539], [976540, 1953078], [1953079, 2929617], [2929618, 3906156], [3906157, 4882695], [4882696, 5859234], [5859235, 6835773], [6835774, 7812312], [7812313, 8788851], [8788852, 9765390], [9765391, 10741929], [10741930, 11718468], [11718469, 12695007], [12695008, 13671546], [13671547, 14648085], [14648086, 15624624], [15624625, 16601163], [16601164, 17577702], [17577703, 18554241], [18554242, 19530783]] SRR3208041 file size 6254623 SRR3208041 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208041 SRR3208041_1.fastq Input file: SRR3208041_1.fastq trimmed: SRR3208041-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 03:46:34 2025 >> started Wed Feb 12 03:46:49 2025 >> done (14.820s) 19530783 reads processed; of these: 22656 ( 0.12%) short reads filtered out after trimming by size control 411636 ( 2.11%) empty reads filtered out after trimming by size control 19096491 (97.78%) reads available; of these: 2219525 (11.62%) trimmed reads available after processing 16876966 (88.38%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 887 0.00% 19 827 0.00% 20 1006 0.01% 21 883 0.00% 22 1051 0.01% 23 1060 0.01% 24 1219 0.01% 25 1365 0.01% 26 1240 0.01% 27 1224 0.01% 28 1287 0.01% 29 1347 0.01% 30 1805 0.01% 31 1711 0.01% 32 1859 0.01% 33 1940 0.01% 34 1186 0.01% 35 1206 0.01% 36 1195 0.01% 37 1289 0.01% 38 1203 0.01% 39 1311 0.01% 40 2272 0.01% 41 1333 0.01% 42 1356 0.01% 43 1340 0.01% 44 1388 0.01% 45 1314 0.01% 46 1348 0.01% 47 1412 0.01% 48 1346 0.01% 49 1458 0.01% 50 1476 0.01% 51 1493 0.01% 52 1612 0.01% 53 1577 0.01% 54 1507 0.01% 55 1508 0.01% 56 1632 0.01% 57 1701 0.01% 58 1947 0.01% 59 1971 0.01% 60 2031 0.01% 61 2153 0.01% 62 2282 0.01% 63 2366 0.01% 64 3133 0.02% 65 16834 0.09% 66 4314 0.02% 67 2654 0.01% 68 2791 0.01% 69 2943 0.02% 70 3011 0.02% 71 3267 0.02% 72 3460 0.02% 73 3700 0.02% 74 4604 0.02% 75 6350 0.03% 76 8991 0.05% 77 5856 0.03% 78 4900 0.03% 79 5126 0.03% 80 5739 0.03% 81 6420 0.03% 82 7322 0.04% 83 7850 0.04% 84 8642 0.05% 85 9293 0.05% 86 10029 0.05% 87 11126 0.06% 88 12318 0.06% 89 13826 0.07% 90 15865 0.08% 91 18925 0.10% 92 20852 0.11% 93 22718 0.12% 94 3192 0.02% 95 3224 0.02% 96 3467 0.02% 97 3702 0.02% 98 3896 0.02% 99 4161 0.02% 100 4224 0.02% 101 4595 0.02% 102 4767 0.02% 103 4862 0.03% 104 5271 0.03% 105 5433 0.03% 106 6025 0.03% 107 6291 0.03% 108 7176 0.04% 109 7759 0.04% 110 8521 0.04% 111 9148 0.05% 112 10268 0.05% 113 11682 0.06% 114 13641 0.07% 115 15425 0.08% 116 18057 0.09% 117 22008 0.12% 118 27666 0.14% 119 35829 0.19% 120 48404 0.25% 121 100569 0.53% 122 107416 0.56% 123 252496 1.32% 124 1139567 5.97% 125 16876966 88.38% 19096491 reads passed initial QC criterion=sequence-density sequence-density=5.43 sequence-density-rank=1 fanout-score=48.27 fanout-score-rank=1 prefix-density=7.25 prefix-fanout=36.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=5.43 sequence-density-rank=1 fanout-score=48.27 fanout-score-rank=1 prefix-density=7.25 prefix-fanout=36.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR3208041 - Input file: STDIN trimmed: SRR3208041-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 03:48:10 2025 >> started Wed Feb 12 03:48:23 2025 >> done (13.088s) 12730994 reads processed; of these: 969 ( 0.01%) short reads filtered out after trimming by size control 22495 ( 0.18%) empty reads filtered out after trimming by size control 12707530 (99.82%) reads available; of these: 1933605 (15.22%) trimmed reads available after processing 10773925 (84.78%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 610 0.00% 19 579 0.00% 20 712 0.01% 21 601 0.00% 22 703 0.01% 23 700 0.01% 24 807 0.01% 25 946 0.01% 26 828 0.01% 27 799 0.01% 28 899 0.01% 29 888 0.01% 30 1194 0.01% 31 1147 0.01% 32 1279 0.01% 33 1584 0.01% 34 799 0.01% 35 797 0.01% 36 833 0.01% 37 842 0.01% 38 800 0.01% 39 896 0.01% 40 1904 0.01% 41 915 0.01% 42 942 0.01% 43 893 0.01% 44 938 0.01% 45 919 0.01% 46 905 0.01% 47 953 0.01% 48 896 0.01% 49 965 0.01% 50 984 0.01% 51 982 0.01% 52 1089 0.01% 53 1019 0.01% 54 1005 0.01% 55 992 0.01% 56 1110 0.01% 57 1169 0.01% 58 1332 0.01% 59 1330 0.01% 60 1340 0.01% 61 1424 0.01% 62 1464 0.01% 63 1461 0.01% 64 1444 0.01% 65 1496 0.01% 66 1791 0.01% 67 1592 0.01% 68 1802 0.01% 69 1892 0.01% 70 1936 0.02% 71 2134 0.02% 72 2154 0.02% 73 2241 0.02% 74 2316 0.02% 75 2437 0.02% 76 2601 0.02% 77 2808 0.02% 78 3099 0.02% 79 3368 0.03% 80 3773 0.03% 81 4256 0.03% 82 4790 0.04% 83 5223 0.04% 84 5740 0.05% 85 6139 0.05% 86 6684 0.05% 87 7561 0.06% 88 8353 0.07% 89 9312 0.07% 90 10569 0.08% 91 11901 0.09% 92 13740 0.11% 93 15332 0.12% 94 17098 0.13% 95 18506 0.15% 96 20056 0.16% 97 21967 0.17% 98 24272 0.19% 99 26848 0.21% 100 30074 0.24% 101 33711 0.27% 102 37669 0.30% 103 41636 0.33% 104 45254 0.36% 105 48099 0.38% 106 50349 0.40% 107 53326 0.42% 108 56401 0.44% 109 60302 0.47% 110 65541 0.52% 111 70912 0.56% 112 77222 0.61% 113 83338 0.66% 114 88383 0.70% 115 92277 0.73% 116 95890 0.75% 117 99421 0.78% 118 105695 0.83% 119 114720 0.90% 120 140161 1.10% 121 216295 1.70% 122 397753 3.13% 123 147860 1.16% 124 667985 5.26% 125 9463851 74.47% criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=33 prefix-density=0.09 prefix-fanout=2.6 sequence=ACCTTGATGAGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=292.06 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=15.4 sequence=CAGCAGCAAGACAAACCGAATTATTCATAAGTACCAATAAAATAAGCATTGCGCAAAAGGGATAGGATAAATCACTCTTAAGCTTGAGGCTTCTCCCATTTGAGGGGCTTGACAACTTCCCAGGTGAAGTCTGGGTCATCCCTTCCAAAATGTCCGTATGCAGCTGTCTTCAAGAACCTATTACCCCCCCTCTTGAGATCCAGGTTGATGGTCATCATTCCAGGCCTAAAGTCAAAGCTCTCCTTCACAATCTTAAGGATCTCCTTGTCAGGAATTTTTCCAGTGCCATAGGTGTCCACAAAGACTGACAAAGGCTCAGGTACACCAATAGCATAGGAAACTTGCACAATGCACCTACGAGCAAGACCATTTGCTACGATGCTCTTGGCAGCTT Started job on | Feb 12 03:48:51 Started mapping on | Feb 12 03:48:51 Finished on | Feb 12 03:49:19 Mapping speed, Million of reads per hour | 2452.25 Number of input reads | 19073027 Average input read length | 122 UNIQUE READS: Uniquely mapped reads number | 17933664 Uniquely mapped reads % | 94.03% Average mapped length | 122.09 Number of splices: Total | 6760271 Number of splices: Annotated (sjdb) | 6627777 Number of splices: GT/AG | 6657277 Number of splices: GC/AG | 84046 Number of splices: AT/AC | 6795 Number of splices: Non-canonical | 12153 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.12 Insertion rate per base | 0.02% Insertion average length | 1.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 369001 % of reads mapped to multiple loci | 1.93% Number of reads mapped to too many loci | 317835 % of reads mapped to too many loci | 1.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.36% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 770362 770362 770362 N_multimapping 369001 369001 369001 N_noFeature 758212 9277594 9295354 N_ambiguous 183639 32378 32679 UnstrandedReadsAssigned:16991813 PositiveStrandReadsAssigned:8623692 NegativeStrandReadsAssigned:8605631 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=123 echo kmer=119 SRR3208041 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208041-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,073,027 reads, 17,582,112 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,140 rounds 52401 SRR3208041.ke.tsv 34699 SRR3208041.se.tsv 87100 total ==> SRR3208041.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 498 20.6455 Potri.005G024800.1.v4.1 1035 936 117 9.94448 Potri.004G059700.1.v4.1 961 862 18 1.66126 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 308.255 8.62288 Potri.016G087400.1.v4.1 270 171 745 346.603 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 73 3.46928 Potri.012G127500.1.v4.1 977 878 2099 190.191 ==> SRR3208041.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1256 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 329 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 42 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 20 SRR3208041 completed mapping pipeline successfully