Starting /dee2/code/volunteer_pipeline.sh SRR3208042 current disk space = 3048967086080 free memory = 1537695980 SRR3208042 SRAfilesize d29efa83ab8500538dbc4aeec984a52a SRR3208042.sra SRR3208042.sra file validated SRR3208042 is single end SRR3208042 is conventional basespace SRR3208042 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208042_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.272 33.0 33.0 33.0 33.0 33.0 2 31.98175 33.0 33.0 33.0 33.0 33.0 3 32.0365 33.0 33.0 33.0 33.0 33.0 4 32.2435 33.0 33.0 33.0 33.0 33.0 5 32.30025 33.0 33.0 33.0 33.0 33.0 6 35.9505 37.0 37.0 37.0 37.0 37.0 7 36.0455 37.0 37.0 37.0 37.0 37.0 8 36.0885 37.0 37.0 37.0 37.0 37.0 9 36.18275 37.0 37.0 37.0 37.0 37.0 10-11 36.148875000000004 37.0 37.0 37.0 37.0 37.0 12-13 36.23975 37.0 37.0 37.0 37.0 37.0 14-15 36.241625 37.0 37.0 37.0 37.0 37.0 16-17 36.27375 37.0 37.0 37.0 37.0 37.0 18-19 36.1955 37.0 37.0 37.0 37.0 37.0 20-21 36.207375 37.0 37.0 37.0 37.0 37.0 22-23 36.21362499999999 37.0 37.0 37.0 37.0 37.0 24-25 36.229125 37.0 37.0 37.0 37.0 37.0 26-27 36.2125 37.0 37.0 37.0 37.0 37.0 28-29 36.129625 37.0 37.0 37.0 37.0 37.0 30-31 36.116125 37.0 37.0 37.0 37.0 37.0 32-33 36.11375 37.0 37.0 37.0 37.0 37.0 34-35 36.0835 37.0 37.0 37.0 37.0 37.0 36-37 36.12675 37.0 37.0 37.0 37.0 37.0 38-39 36.121125 37.0 37.0 37.0 37.0 37.0 40-41 36.100624999999994 37.0 37.0 37.0 37.0 37.0 42-43 36.058625 37.0 37.0 37.0 37.0 37.0 44-45 36.100375 37.0 37.0 37.0 37.0 37.0 46-47 36.178 37.0 37.0 37.0 37.0 37.0 48-49 36.150999999999996 37.0 37.0 37.0 37.0 37.0 50-51 36.0985 37.0 37.0 37.0 37.0 37.0 52-53 36.040875 37.0 37.0 37.0 37.0 37.0 54-55 36.0535 37.0 37.0 37.0 37.0 37.0 56-57 36.1225 37.0 37.0 37.0 37.0 37.0 58-59 36.071125 37.0 37.0 37.0 37.0 37.0 60-61 35.961 37.0 37.0 37.0 37.0 37.0 62-63 36.035125 37.0 37.0 37.0 37.0 37.0 64-65 35.997625 37.0 37.0 37.0 37.0 37.0 66-67 35.9715 37.0 37.0 37.0 37.0 37.0 68-69 35.956875 37.0 37.0 37.0 37.0 37.0 70-71 35.925875000000005 37.0 37.0 37.0 37.0 37.0 72-73 35.947125 37.0 37.0 37.0 37.0 37.0 74-75 35.9075 37.0 37.0 37.0 37.0 37.0 76-77 35.832125000000005 37.0 37.0 37.0 37.0 37.0 78-79 35.845375000000004 37.0 37.0 37.0 37.0 37.0 80-81 35.839749999999995 37.0 37.0 37.0 37.0 37.0 82-83 35.805 37.0 37.0 37.0 37.0 37.0 84-85 35.790375 37.0 37.0 37.0 37.0 37.0 86-87 35.791125 37.0 37.0 37.0 37.0 37.0 88-89 35.7775 37.0 37.0 37.0 37.0 37.0 90-91 35.71575 37.0 37.0 37.0 37.0 37.0 92-93 35.754999999999995 37.0 37.0 37.0 37.0 37.0 94-95 35.751 37.0 37.0 37.0 37.0 37.0 96-97 35.67975 37.0 37.0 37.0 37.0 37.0 98-99 35.576750000000004 37.0 37.0 37.0 37.0 37.0 100-101 35.548375 37.0 37.0 37.0 37.0 37.0 102-103 35.588125000000005 37.0 37.0 37.0 37.0 37.0 104-105 35.558 37.0 37.0 37.0 33.0 37.0 106-107 35.609375 37.0 37.0 37.0 37.0 37.0 108-109 35.558 37.0 37.0 37.0 37.0 37.0 110-111 35.455625 37.0 37.0 37.0 33.0 37.0 112-113 35.298500000000004 37.0 37.0 37.0 33.0 37.0 114-115 35.366749999999996 37.0 37.0 37.0 33.0 37.0 116-117 35.30775 37.0 37.0 37.0 33.0 37.0 118-119 35.315 37.0 37.0 37.0 33.0 37.0 120-121 35.241 37.0 37.0 37.0 33.0 37.0 122-123 35.238625 37.0 37.0 37.0 33.0 37.0 124-125 33.501374999999996 37.0 35.0 37.0 17.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 1.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 1.0 10 2.0 11 2.0 12 0.0 13 4.0 14 1.0 15 1.0 16 5.0 17 4.0 18 1.0 19 3.0 20 3.0 21 0.0 22 9.0 23 6.0 24 5.0 25 8.0 26 11.0 27 10.0 28 21.0 29 23.0 30 41.0 31 52.0 32 77.0 33 91.0 34 173.0 35 274.0 36 3149.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.781668383110194 13.954685890834192 12.899073120494336 51.36457260556128 2 18.099999999999998 22.275 39.300000000000004 20.325 3 22.275 24.15 27.575 26.0 4 24.90622655663916 30.307576894223555 21.10527631907977 23.680920230057513 5 24.099999999999998 34.25 23.225 18.425 6 19.85 36.5 24.25 19.400000000000002 7 17.299999999999997 19.525000000000002 42.75 20.424999999999997 8 19.15 24.15 28.725 27.975 9 19.675 24.275 31.15 24.9 10-11 22.7125 32.300000000000004 23.425 21.5625 12-13 20.2125 26.424999999999997 29.849999999999998 23.5125 14-15 20.6625 27.8375 28.95 22.55 16-17 21.4875 27.975 27.950000000000003 22.5875 18-19 21.912499999999998 28.299999999999997 27.150000000000002 22.6375 20-21 22.025 27.900000000000002 28.1625 21.912499999999998 22-23 21.75 29.375 27.537499999999998 21.337500000000002 24-25 21.9 27.925 28.012500000000003 22.162499999999998 26-27 21.702712839104887 28.066008251031377 27.365920740092513 22.86535816977122 28-29 22.2430607651913 27.894473618404604 27.819454863715933 22.043010752688172 30-31 22.295860947855445 27.72289608603226 28.248093034888083 21.73314993122421 32-33 21.296296296296298 28.928928928928926 28.14064064064064 21.634134134134133 34-35 22.426516572858034 28.580362726704188 26.79174484052533 22.201375859912446 36-37 21.717929482370593 28.769692423105774 27.26931732933233 22.2430607651913 38-39 22.402800350043755 28.60357544693087 27.078384798099762 21.915239404925615 40-41 21.602700337542196 27.50343792974122 28.028503562945367 22.86535816977122 42-43 21.41517689711214 28.091011376422053 27.61595199399925 22.877859732466558 44-45 21.712500000000002 28.3125 28.1375 21.837500000000002 46-47 21.55 28.1875 28.1125 22.15 48-49 22.925 27.6875 27.6625 21.725 50-51 22.125 27.875 28.025 21.975 52-53 22.25 28.4 27.500000000000004 21.85 54-55 21.712500000000002 27.800000000000004 27.987499999999997 22.5 56-57 22.325 27.9125 28.037499999999998 21.725 58-59 21.925 28.6125 28.299999999999997 21.1625 60-61 21.2375 27.8125 28.249999999999996 22.7 62-63 21.575 26.4625 29.1125 22.85 64-65 21.875 28.4 27.8875 21.837500000000002 66-67 22.475 28.4125 27.0625 22.05 68-69 21.3625 28.4125 27.762500000000003 22.4625 70-71 22.1 28.3375 27.900000000000002 21.6625 72-73 21.425 29.025000000000002 28.4375 21.1125 74-75 22.3125 28.475 27.8875 21.325 76-77 22.575 27.6625 28.237499999999997 21.525 78-79 22.375 28.449999999999996 27.1625 22.0125 80-81 21.6625 29.012500000000003 27.037499999999998 22.287499999999998 82-83 21.9625 27.8625 27.675 22.5 84-85 21.0125 28.762500000000003 27.712500000000002 22.5125 86-87 22.1875 29.012500000000003 27.2625 21.5375 88-89 22.8625 27.700000000000003 27.8125 21.625 90-91 22.1875 28.8875 27.237499999999997 21.6875 92-93 22.425 28.8875 27.3125 21.375 94-95 21.8625 29.1375 27.275 21.725 96-97 22.7 28.0625 27.6875 21.55 98-99 22.2125 29.349999999999998 26.5875 21.85 100-101 22.112499999999997 29.375 27.0 21.512500000000003 102-103 22.537499999999998 28.775000000000002 27.375 21.3125 104-105 23.7875 28.725 26.224999999999998 21.2625 106-107 22.412499999999998 27.700000000000003 28.3875 21.5 108-109 22.675 28.4 27.3875 21.5375 110-111 22.275 28.9125 27.212500000000002 21.6 112-113 23.674999999999997 30.0375 25.687500000000004 20.599999999999998 114-115 22.825 29.1875 25.9875 22.0 116-117 23.825 28.712500000000002 26.237500000000004 21.224999999999998 118-119 22.1 30.7 24.975 22.225 120-121 22.3625 29.7 25.825 22.112499999999997 122-123 23.35 28.3625 26.1 22.1875 124-125 23.825 29.099999999999998 24.9875 22.0875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.5 23 3.0 24 4.0 25 2.5 26 4.0 27 7.0 28 9.5 29 17.0 30 24.5 31 28.5 32 34.5 33 53.5 34 60.0 35 69.5 36 101.5 37 119.5 38 133.5 39 158.0 40 192.0 41 221.0 42 239.0 43 241.5 44 248.0 45 264.5 46 264.5 47 252.5 48 228.0 49 197.0 50 160.0 51 127.0 52 102.5 53 81.5 54 67.5 55 54.0 56 39.5 57 32.5 58 29.0 59 23.0 60 19.0 61 15.5 62 12.5 63 9.0 64 5.0 65 4.5 66 4.5 67 2.0 68 3.0 69 4.0 70 3.5 71 3.0 72 2.0 73 2.0 74 1.5 75 2.0 76 2.0 77 2.0 78 2.0 79 1.0 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9000000000000004 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.025 30-31 0.0375 32-33 0.1 34-35 0.0625 36-37 0.025 38-39 0.0125 40-41 0.0125 42-43 0.0125 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72368751569958 99.25 2 0.22607385079125847 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.050238633509168545 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTAT 6 0.15 TruSeq Adapter, Index 16 (97% over 40bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTA 6 0.15 TruSeq Adapter, Index 16 (97% over 40bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.2 0.0 0.0 0.0 0.0 2 0.2 0.0 0.0 0.0 0.0 3 0.2 0.0 0.0 0.0 0.0 4 0.2 0.0 0.0 0.0 0.0 5 0.2 0.0 0.0 0.0 0.0 6 0.2 0.0 0.0 0.0 0.0 7 0.2 0.0 0.0 0.0 0.0 8 0.2 0.0 0.0 0.0 0.0 9 0.2 0.0 0.0 0.0 0.0 10-11 0.2 0.0 0.0 0.0 0.0 12-13 0.2 0.0 0.0 0.0 0.0 14-15 0.21250000000000002 0.0 0.0 0.0 0.0 16-17 0.225 0.0 0.0 0.0 0.0 18-19 0.225 0.0 0.0 0.0 0.0 20-21 0.225 0.0 0.0 0.0 0.0 22-23 0.225 0.0 0.0 0.0 0.0 24-25 0.225 0.0 0.0 0.0 0.0 26-27 0.225 0.0 0.0 0.0 0.0 28-29 0.225 0.0 0.0 0.0 0.0 30-31 0.225 0.0 0.0 0.0 0.0 32-33 0.225 0.0 0.0 0.0 0.0 34-35 0.225 0.0 0.0 0.0 0.0 36-37 0.225 0.0 0.0 0.0 0.0 38-39 0.225 0.0 0.0 0.0 0.0 40-41 0.225 0.0 0.0 0.0 0.0 42-43 0.225 0.0 0.0 0.0 0.0 44-45 0.225 0.0 0.0 0.0 0.0 46-47 0.225 0.0 0.0 0.0 0.0 48-49 0.225 0.0 0.0 0.0 0.0 50-51 0.225 0.0 0.0 0.0 0.0 52-53 0.225 0.0 0.0 0.0 0.0 54-55 0.225 0.0 0.0 0.0 0.0 56-57 0.225 0.0 0.0 0.0 0.0 58-59 0.225 0.0 0.0 0.0 0.0 60-61 0.225 0.0 0.0 0.0 0.0 62-63 0.225 0.0 0.0 0.0 0.0 64-65 0.225 0.0 0.0 0.0 0.0 66-67 0.25 0.0 0.0 0.0 0.0 68-69 0.25 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.3 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.325 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.3250000000000002 0.0 0.0 0.0 0.0 102-103 1.8125 0.0 0.0 0.0 0.0 104-105 2.2125000000000004 0.0 0.0 0.0 0.0 106-107 2.9375 0.0 0.0 0.0 0.0 108-109 3.6 0.0 0.0 0.0 0.0 110-111 4.425000000000001 0.0 0.0 0.0 0.0 112-113 5.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1128606 spots for SRR3208042.sra Written 1128606 spots for SRR3208042.sra Read 1128606 spots for SRR3208042.sra Written 1128606 spots for SRR3208042.sra Read 1128606 spots for SRR3208042.sra Written 1128606 spots for SRR3208042.sra Read 1128606 spots for SRR3208042.sra Written 1128606 spots for SRR3208042.sra Read 1128606 spots for SRR3208042.sra Written 1128606 spots for SRR3208042.sra Read 1128606 spots for SRR3208042.sra Written 1128606 spots for SRR3208042.sra Read 1128606 spots for SRR3208042.sra Written 1128606 spots for SRR3208042.sra Read 1128606 spots for SRR3208042.sra Written 1128606 spots for SRR3208042.sra Read 1128606 spots for SRR3208042.sra Written 1128606 spots for SRR3208042.sra Read 1128606 spots for SRR3208042.sra Written 1128606 spots for SRR3208042.sra Read 1128606 spots for SRR3208042.sra Written 1128606 spots for SRR3208042.sra Read 1128606 spots for SRR3208042.sra Written 1128606 spots for SRR3208042.sra Read 1128606 spots for SRR3208042.sra Written 1128606 spots for SRR3208042.sra Read 1128606 spots for SRR3208042.sra Written 1128606 spots for SRR3208042.sra Read 1128606 spots for SRR3208042.sra Read 1128606 spots for SRR3208042.sra Written 1128606 spots for SRR3208042.sra Written 1128606 spots for SRR3208042.sra Read 1128606 spots for SRR3208042.sra Written 1128606 spots for SRR3208042.sra Read 1128606 spots for SRR3208042.sra Written 1128606 spots for SRR3208042.sra Read 1128606 spots for SRR3208042.sra Written 1128606 spots for SRR3208042.sra Read 1128624 spots for SRR3208042.sra Written 1128624 spots for SRR3208042.sra SRR ids: ['SRR3208042.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0b7dvo6g SRR3208042.sra spots: 22572138 blocks: [[1, 1128606], [1128607, 2257212], [2257213, 3385818], [3385819, 4514424], [4514425, 5643030], [5643031, 6771636], [6771637, 7900242], [7900243, 9028848], [9028849, 10157454], [10157455, 11286060], [11286061, 12414666], [12414667, 13543272], [13543273, 14671878], [14671879, 15800484], [15800485, 16929090], [16929091, 18057696], [18057697, 19186302], [19186303, 20314908], [20314909, 21443514], [21443515, 22572138]] SRR3208042 file size 7230300 SRR3208042 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208042 SRR3208042_1.fastq Input file: SRR3208042_1.fastq trimmed: SRR3208042-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 03:14:12 2025 >> started Wed Feb 12 03:14:30 2025 >> done (18.196s) 22572138 reads processed; of these: 15953 ( 0.07%) short reads filtered out after trimming by size control 107537 ( 0.48%) empty reads filtered out after trimming by size control 22448648 (99.45%) reads available; of these: 2646802 (11.79%) trimmed reads available after processing 19801846 (88.21%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 689 0.00% 19 768 0.00% 20 1177 0.01% 21 844 0.00% 22 896 0.00% 23 1036 0.00% 24 1253 0.01% 25 1413 0.01% 26 1369 0.01% 27 1293 0.01% 28 1358 0.01% 29 1535 0.01% 30 2175 0.01% 31 2480 0.01% 32 1356 0.01% 33 1181 0.01% 34 1110 0.00% 35 1149 0.01% 36 1182 0.01% 37 1260 0.01% 38 1242 0.01% 39 1245 0.01% 40 1252 0.01% 41 1300 0.01% 42 1284 0.01% 43 1307 0.01% 44 1379 0.01% 45 1322 0.01% 46 1459 0.01% 47 1409 0.01% 48 1350 0.01% 49 1456 0.01% 50 1533 0.01% 51 1532 0.01% 52 1571 0.01% 53 1544 0.01% 54 1671 0.01% 55 1598 0.01% 56 1689 0.01% 57 1816 0.01% 58 1684 0.01% 59 1825 0.01% 60 2027 0.01% 61 2023 0.01% 62 2051 0.01% 63 2015 0.01% 64 2191 0.01% 65 2321 0.01% 66 2194 0.01% 67 2278 0.01% 68 2411 0.01% 69 2541 0.01% 70 2647 0.01% 71 2849 0.01% 72 3072 0.01% 73 3258 0.01% 74 3483 0.02% 75 4075 0.02% 76 4033 0.02% 77 4223 0.02% 78 4193 0.02% 79 4657 0.02% 80 5175 0.02% 81 5716 0.03% 82 6376 0.03% 83 7081 0.03% 84 7789 0.03% 85 8399 0.04% 86 9202 0.04% 87 9918 0.04% 88 10953 0.05% 89 12843 0.06% 90 14502 0.06% 91 16926 0.08% 92 19349 0.09% 93 21781 0.10% 94 3619 0.02% 95 3911 0.02% 96 4095 0.02% 97 4402 0.02% 98 4434 0.02% 99 4864 0.02% 100 5023 0.02% 101 5161 0.02% 102 5643 0.03% 103 5929 0.03% 104 6062 0.03% 105 6417 0.03% 106 7040 0.03% 107 7453 0.03% 108 8235 0.04% 109 9060 0.04% 110 9939 0.04% 111 11092 0.05% 112 12514 0.06% 113 14200 0.06% 114 16164 0.07% 115 19252 0.09% 116 22285 0.10% 117 26725 0.12% 118 34221 0.15% 119 45367 0.20% 120 61219 0.27% 121 124270 0.55% 122 138310 0.62% 123 322793 1.44% 124 1424559 6.35% 125 19801846 88.21% 22448648 reads passed initial QC criterion=sequence-density sequence-density=4.65 sequence-density-rank=1 fanout-score=48.44 fanout-score-rank=1 prefix-density=6.38 prefix-fanout=35.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA criterion=fanout-score sequence-density=4.65 sequence-density-rank=1 fanout-score=48.44 fanout-score-rank=1 prefix-density=6.38 prefix-fanout=35.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA -o SRR3208042 - Input file: STDIN trimmed: SRR3208042-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 03:15:19 2025 >> started Wed Feb 12 03:15:39 2025 >> done (19.509s) 13469189 reads processed; of these: 142 ( 0.00%) short reads filtered out after trimming by size control 1374 ( 0.01%) empty reads filtered out after trimming by size control 13467673 (99.99%) reads available; of these: 1869177 (13.88%) trimmed reads available after processing 11598496 (86.12%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 416 0.00% 19 494 0.00% 20 1185 0.01% 21 530 0.00% 22 548 0.00% 23 631 0.00% 24 767 0.01% 25 886 0.01% 26 845 0.01% 27 791 0.01% 28 835 0.01% 29 899 0.01% 30 1317 0.01% 31 1502 0.01% 32 813 0.01% 33 683 0.01% 34 631 0.00% 35 712 0.01% 36 732 0.01% 37 768 0.01% 38 766 0.01% 39 729 0.01% 40 751 0.01% 41 805 0.01% 42 801 0.01% 43 804 0.01% 44 836 0.01% 45 793 0.01% 46 915 0.01% 47 857 0.01% 48 830 0.01% 49 844 0.01% 50 946 0.01% 51 952 0.01% 52 962 0.01% 53 903 0.01% 54 978 0.01% 55 950 0.01% 56 1026 0.01% 57 1096 0.01% 58 975 0.01% 59 1098 0.01% 60 1242 0.01% 61 1244 0.01% 62 1194 0.01% 63 1215 0.01% 64 1264 0.01% 65 1362 0.01% 66 1275 0.01% 67 1395 0.01% 68 1494 0.01% 69 1505 0.01% 70 1619 0.01% 71 1672 0.01% 72 1854 0.01% 73 1953 0.01% 74 1920 0.01% 75 2052 0.02% 76 2066 0.02% 77 2400 0.02% 78 2478 0.02% 79 2834 0.02% 80 3072 0.02% 81 3467 0.03% 82 3809 0.03% 83 4293 0.03% 84 4699 0.03% 85 5059 0.04% 86 5552 0.04% 87 5953 0.04% 88 6654 0.05% 89 7747 0.06% 90 8830 0.07% 91 9942 0.07% 92 11388 0.08% 93 13155 0.10% 94 14480 0.11% 95 16361 0.12% 96 17358 0.13% 97 19253 0.14% 98 21177 0.16% 99 23800 0.18% 100 26952 0.20% 101 30160 0.22% 102 34359 0.26% 103 38319 0.28% 104 42092 0.31% 105 44666 0.33% 106 47049 0.35% 107 49423 0.37% 108 51866 0.39% 109 56138 0.42% 110 61481 0.46% 111 67772 0.50% 112 74520 0.55% 113 81281 0.60% 114 87497 0.65% 115 92731 0.69% 116 96445 0.72% 117 100249 0.74% 118 107101 0.80% 119 117640 0.87% 120 144867 1.08% 121 228036 1.69% 122 419269 3.11% 123 172557 1.28% 124 764130 5.67% 125 10155384 75.41% criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=4.52 fanout-score-rank=19 prefix-density=0.13 prefix-fanout=3.1 sequence=TTCAACCAAGCGCG criterion=fanout-score sequence-density=0.05 sequence-density-rank=9 fanout-score=218.60 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=24.6 sequence=AAGAAGAAGAAA Started job on | Feb 12 03:16:10 Started mapping on | Feb 12 03:16:11 Finished on | Feb 12 03:16:48 Mapping speed, Million of reads per hour | 2184.05 Number of input reads | 22447132 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 20430708 Uniquely mapped reads % | 91.02% Average mapped length | 122.41 Number of splices: Total | 7448167 Number of splices: Annotated (sjdb) | 7295217 Number of splices: GT/AG | 7328945 Number of splices: GC/AG | 96899 Number of splices: AT/AC | 8216 Number of splices: Non-canonical | 14107 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.02% Deletion average length | 2.18 Insertion rate per base | 0.02% Insertion average length | 1.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 478541 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 906380 % of reads mapped to too many loci | 4.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.79% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1537883 1537883 1537883 N_multimapping 478541 478541 478541 N_noFeature 946027 10595968 10627458 N_ambiguous 231675 39315 39587 UnstrandedReadsAssigned:19253006 PositiveStrandReadsAssigned:9795425 NegativeStrandReadsAssigned:9763663 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208042 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208042-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,447,132 reads, 20,453,029 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,193 rounds 52401 SRR3208042.ke.tsv 34699 SRR3208042.se.tsv 87100 total ==> SRR3208042.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 716 24.5407 Potri.005G024800.1.v4.1 1035 936 315 22.1352 Potri.004G059700.1.v4.1 961 862 27 2.06018 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 327.176 7.56659 Potri.016G087400.1.v4.1 270 171 784 301.557 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 107 4.20414 Potri.012G127500.1.v4.1 977 878 3841 287.739 ==> SRR3208042.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2394 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 367 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 27 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 37 SRR3208042 completed mapping pipeline successfully