Starting /dee2/code/volunteer_pipeline.sh SRR3208043 current disk space = 3048884690944 free memory = 1374141484 SRR3208043 SRAfilesize 31b281a3ad33421dfdde72dca845a4dc SRR3208043.sra SRR3208043.sra file validated SRR3208043 is single end SRR3208043 is conventional basespace SRR3208043 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208043_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.447 33.0 33.0 33.0 33.0 33.0 2 32.18 33.0 33.0 33.0 33.0 33.0 3 32.12275 33.0 33.0 33.0 33.0 33.0 4 32.3245 33.0 33.0 33.0 33.0 33.0 5 32.40075 33.0 33.0 33.0 33.0 33.0 6 35.94 37.0 37.0 37.0 37.0 37.0 7 36.17225 37.0 37.0 37.0 37.0 37.0 8 36.15525 37.0 37.0 37.0 37.0 37.0 9 36.2025 37.0 37.0 37.0 37.0 37.0 10-11 36.20125 37.0 37.0 37.0 37.0 37.0 12-13 36.2605 37.0 37.0 37.0 37.0 37.0 14-15 36.24075 37.0 37.0 37.0 37.0 37.0 16-17 36.30137499999999 37.0 37.0 37.0 37.0 37.0 18-19 36.279875000000004 37.0 37.0 37.0 37.0 37.0 20-21 36.344375 37.0 37.0 37.0 37.0 37.0 22-23 36.26025 37.0 37.0 37.0 37.0 37.0 24-25 36.294624999999996 37.0 37.0 37.0 37.0 37.0 26-27 36.229375 37.0 37.0 37.0 37.0 37.0 28-29 36.195 37.0 37.0 37.0 37.0 37.0 30-31 36.152875 37.0 37.0 37.0 37.0 37.0 32-33 36.19825 37.0 37.0 37.0 37.0 37.0 34-35 36.155625 37.0 37.0 37.0 37.0 37.0 36-37 36.16275 37.0 37.0 37.0 37.0 37.0 38-39 36.2235 37.0 37.0 37.0 37.0 37.0 40-41 36.205375000000004 37.0 37.0 37.0 37.0 37.0 42-43 36.231875 37.0 37.0 37.0 37.0 37.0 44-45 36.15575 37.0 37.0 37.0 37.0 37.0 46-47 36.233625 37.0 37.0 37.0 37.0 37.0 48-49 36.161 37.0 37.0 37.0 37.0 37.0 50-51 36.212375 37.0 37.0 37.0 37.0 37.0 52-53 36.169875000000005 37.0 37.0 37.0 37.0 37.0 54-55 36.11475 37.0 37.0 37.0 37.0 37.0 56-57 36.08475 37.0 37.0 37.0 37.0 37.0 58-59 36.17 37.0 37.0 37.0 37.0 37.0 60-61 36.096625 37.0 37.0 37.0 37.0 37.0 62-63 36.1595 37.0 37.0 37.0 37.0 37.0 64-65 36.086 37.0 37.0 37.0 37.0 37.0 66-67 36.07275 37.0 37.0 37.0 37.0 37.0 68-69 36.015125 37.0 37.0 37.0 37.0 37.0 70-71 35.98350000000001 37.0 37.0 37.0 37.0 37.0 72-73 35.98075 37.0 37.0 37.0 37.0 37.0 74-75 35.967749999999995 37.0 37.0 37.0 37.0 37.0 76-77 35.794375 37.0 37.0 37.0 37.0 37.0 78-79 35.694375 37.0 37.0 37.0 37.0 37.0 80-81 35.704625 37.0 37.0 37.0 37.0 37.0 82-83 35.67275 37.0 37.0 37.0 37.0 37.0 84-85 35.719375 37.0 37.0 37.0 37.0 37.0 86-87 35.655875 37.0 37.0 37.0 37.0 37.0 88-89 35.699625 37.0 37.0 37.0 37.0 37.0 90-91 35.645375 37.0 37.0 37.0 37.0 37.0 92-93 35.615875 37.0 37.0 37.0 37.0 37.0 94-95 35.573125 37.0 37.0 37.0 37.0 37.0 96-97 35.58 37.0 37.0 37.0 37.0 37.0 98-99 35.548874999999995 37.0 37.0 37.0 37.0 37.0 100-101 35.532 37.0 37.0 37.0 37.0 37.0 102-103 35.48325 37.0 37.0 37.0 37.0 37.0 104-105 35.53 37.0 37.0 37.0 37.0 37.0 106-107 35.532875000000004 37.0 37.0 37.0 37.0 37.0 108-109 35.46325 37.0 37.0 37.0 35.0 37.0 110-111 35.364875 37.0 37.0 37.0 35.0 37.0 112-113 35.256 37.0 37.0 37.0 33.0 37.0 114-115 35.33325 37.0 37.0 37.0 33.0 37.0 116-117 35.304500000000004 37.0 37.0 37.0 33.0 37.0 118-119 35.268875 37.0 37.0 37.0 35.0 37.0 120-121 35.273875000000004 37.0 37.0 37.0 35.0 37.0 122-123 35.140375 37.0 37.0 37.0 35.0 37.0 124-125 33.583 37.0 35.0 37.0 17.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 0.0 4 0.0 5 1.0 6 2.0 7 0.0 8 0.0 9 1.0 10 0.0 11 2.0 12 0.0 13 0.0 14 2.0 15 3.0 16 6.0 17 2.0 18 4.0 19 0.0 20 4.0 21 11.0 22 17.0 23 8.0 24 7.0 25 10.0 26 12.0 27 10.0 28 23.0 29 29.0 30 30.0 31 42.0 32 55.0 33 85.0 34 130.0 35 278.0 36 3207.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.276214833759592 15.626598465473146 12.122762148337596 49.97442455242967 2 19.05 20.3 40.5 20.150000000000002 3 20.525 24.15 28.65 26.674999999999997 4 24.6 29.7 20.8 24.9 5 26.075 32.525 23.875 17.525 6 20.225 36.275 23.724999999999998 19.775000000000002 7 17.9 20.225 41.75 20.125 8 17.65 25.575 31.424999999999997 25.35 9 19.975 23.849999999999998 32.7 23.474999999999998 10-11 22.4625 33.4 23.025000000000002 21.1125 12-13 19.85 27.3 29.799999999999997 23.05 14-15 21.55 27.750000000000004 28.462500000000002 22.237499999999997 16-17 21.5375 27.987499999999997 27.8625 22.6125 18-19 21.3 28.537499999999998 28.15 22.0125 20-21 22.325 27.287499999999998 28.525 21.8625 22-23 21.25 28.875 28.15 21.725 24-25 22.075 27.5625 28.225 22.1375 26-27 21.075 27.650000000000002 28.275 23.0 28-29 21.905476369092273 28.08202050512628 27.906976744186046 22.1055263815954 30-31 21.973486743371687 27.276138069034516 27.71385692846423 23.036518259129565 32-33 21.810905452726363 29.014507253626814 26.91345672836418 22.26113056528264 34-35 20.720270101287984 28.23558834562961 27.935475803426286 23.108665749656122 36-37 21.57769721215152 27.82847855981998 28.091011376422053 22.502812851606453 38-39 21.767941985496375 28.882220555138783 27.04426106526632 22.305576394098527 40-41 22.043010752688172 28.51962990747687 27.431857964491122 22.005501375343837 42-43 21.4125 28.212500000000002 28.012500000000003 22.3625 44-45 20.9 28.499999999999996 28.449999999999996 22.15 46-47 21.85 28.4 27.187499999999996 22.5625 48-49 21.9625 28.6125 28.15 21.275 50-51 22.3625 28.225 28.075 21.337500000000002 52-53 21.2 28.249999999999996 27.700000000000003 22.85 54-55 21.7875 27.925 28.1125 22.175 56-57 21.837500000000002 28.1125 27.8625 22.1875 58-59 21.5 27.800000000000004 28.449999999999996 22.25 60-61 22.925 27.2625 27.4125 22.400000000000002 62-63 21.45 28.849999999999998 26.974999999999998 22.725 64-65 21.8875 28.375 28.225 21.512500000000003 66-67 21.475 29.1625 27.6625 21.7 68-69 21.59289822455614 28.994748687171796 27.94448612153038 21.467866966741685 70-71 22.2125 28.512500000000003 27.6 21.675 72-73 21.9375 28.762500000000003 28.375 20.925 74-75 21.8 28.487499999999997 28.3875 21.325 76-77 21.41517689711214 28.86610826353294 27.790973871733964 21.927740967620952 78-79 21.50537634408602 28.169542385596397 27.806951737934483 22.518129532383096 80-81 21.513445903689806 28.355222013758596 28.205128205128204 21.92620387742339 82-83 21.540192524065507 28.54106763345418 27.69096137017127 22.22777847230904 84-85 21.95 28.525 27.224999999999998 22.3 86-87 22.1 28.775000000000002 27.8625 21.2625 88-89 22.412499999999998 28.199999999999996 27.525 21.8625 90-91 22.45 27.962500000000002 27.9125 21.675 92-93 21.85 28.275 27.675 22.2 94-95 21.6125 29.475 27.1 21.8125 96-97 21.9625 27.6 28.0625 22.375 98-99 22.112499999999997 29.1375 27.025 21.725 100-101 22.8875 27.437499999999996 28.15 21.525 102-103 22.95 27.250000000000004 28.262500000000003 21.5375 104-105 22.883581343003627 28.848318119294735 27.410278854570464 20.857821683131174 106-107 23.533825184444165 28.76078529448543 25.959734900587723 21.745654620482682 108-109 23.030757689422355 28.707176794198553 25.893973493373345 22.36809202300575 110-111 22.8375 29.1875 27.1375 20.837500000000002 112-113 22.825 28.512500000000003 26.950000000000003 21.712500000000002 114-115 23.175 29.849999999999998 26.125 20.849999999999998 116-117 23.200000000000003 28.075 27.2625 21.462500000000002 118-119 23.0375 28.787499999999998 26.125 22.05 120-121 23.325000000000003 28.6625 26.200000000000003 21.8125 122-123 23.9375 29.362500000000004 25.75 20.95 124-125 24.4 28.1375 25.474999999999998 21.987499999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 0.5 23 2.5 24 6.0 25 5.5 26 3.5 27 9.5 28 14.5 29 14.0 30 17.5 31 30.5 32 43.5 33 54.0 34 65.5 35 71.0 36 93.0 37 122.5 38 145.0 39 163.5 40 189.0 41 226.5 42 245.5 43 250.0 44 258.0 45 264.5 46 256.0 47 235.5 48 212.5 49 186.0 50 163.5 51 138.5 52 101.0 53 77.5 54 61.0 55 43.0 56 39.0 57 31.5 58 23.5 59 22.0 60 18.0 61 12.5 62 11.5 63 12.5 64 11.0 65 8.5 66 6.0 67 4.5 68 3.5 69 3.5 70 2.5 71 2.0 72 3.0 73 3.5 74 3.0 75 2.0 76 1.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.025 30-31 0.05 32-33 0.05 34-35 0.0375 36-37 0.0125 38-39 0.025 40-41 0.025 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.025 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0125 78-79 0.025 80-81 0.0625 82-83 0.0125 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0375 106-107 0.0375 108-109 0.025 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64601769911503 98.52499999999999 2 0.3034134007585335 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05056890012642225 0.8750000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTAT 25 0.625 TruSeq Adapter, Index 18 (97% over 40bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTA 10 0.25 TruSeq Adapter, Index 18 (97% over 40bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.25 0.0 0.0 0.0 0.0 2 0.25 0.0 0.0 0.0 0.0 3 0.25 0.0 0.0 0.0 0.0 4 0.25 0.0 0.0 0.0 0.0 5 0.25 0.0 0.0 0.0 0.0 6 0.25 0.0 0.0 0.0 0.0 7 0.25 0.0 0.0 0.0 0.0 8 0.25 0.0 0.0 0.0 0.0 9 0.25 0.0 0.0 0.0 0.0 10-11 0.25 0.0 0.0 0.0 0.0 12-13 0.25 0.0 0.0 0.0 0.0 14-15 0.25 0.0 0.0 0.0 0.0 16-17 0.25 0.0 0.0 0.0 0.0 18-19 0.25 0.0 0.0 0.0 0.0 20-21 0.25 0.0 0.0 0.0 0.0 22-23 0.25 0.0 0.0 0.0 0.0 24-25 0.25 0.0 0.0 0.0 0.0 26-27 0.25 0.0 0.0 0.0 0.0 28-29 0.25 0.0 0.0 0.0 0.0 30-31 0.25 0.0 0.0 0.0 0.0 32-33 0.2625 0.0 0.0 0.0 0.0 34-35 0.275 0.0 0.0 0.0 0.0 36-37 0.275 0.0 0.0 0.0 0.0 38-39 0.275 0.0 0.0 0.0 0.0 40-41 0.275 0.0 0.0 0.0 0.0 42-43 0.275 0.0 0.0 0.0 0.0 44-45 0.275 0.0 0.0 0.0 0.0 46-47 0.275 0.0 0.0 0.0 0.0 48-49 0.275 0.0 0.0 0.0 0.0 50-51 0.275 0.0 0.0 0.0 0.0 52-53 0.275 0.0 0.0 0.0 0.0 54-55 0.275 0.0 0.0 0.0 0.0 56-57 0.35 0.0 0.0 0.0 0.0 58-59 0.35 0.0 0.0 0.0 0.0 60-61 0.35 0.0 0.0 0.0 0.0 62-63 0.3625 0.0 0.0 0.0 0.0 64-65 0.375 0.0 0.0 0.0 0.0 66-67 0.42500000000000004 0.0 0.0 0.0 0.0 68-69 0.4625 0.0 0.0 0.0 0.0 70-71 0.475 0.0 0.0 0.0 0.0 72-73 0.475 0.0 0.0 0.0 0.0 74-75 0.475 0.0 0.0 0.0 0.0 76-77 0.475 0.0 0.0 0.0 0.0 78-79 0.5 0.0 0.0 0.0 0.0 80-81 0.5375000000000001 0.0 0.0 0.0 0.0 82-83 0.55 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.5874999999999999 0.0 0.0 0.0 0.0 88-89 0.75 0.0 0.0 0.0 0.0 90-91 0.825 0.0 0.0 0.0 0.0 92-93 0.9874999999999999 0.0 0.0 0.0 0.0 94-95 1.3 0.0 0.0 0.0 0.0 96-97 1.575 0.0 0.0 0.0 0.0 98-99 1.9749999999999999 0.0 0.0 0.0 0.0 100-101 2.45 0.0 0.0 0.0 0.0 102-103 2.7625 0.0 0.0 0.0 0.0 104-105 3.475 0.0 0.0 0.0 0.0 106-107 4.375 0.0 0.0 0.0 0.0 108-109 5.4125 0.0 0.0 0.0 0.0 110-111 6.375 0.0 0.0 0.0 0.0 112-113 7.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1033037 spots for SRR3208043.sra Written 1033037 spots for SRR3208043.sra Read 1033037 spots for SRR3208043.sra Written 1033037 spots for SRR3208043.sra Read 1033037 spots for SRR3208043.sra Written 1033037 spots for SRR3208043.sra Read 1033037 spots for SRR3208043.sra Written 1033037 spots for SRR3208043.sra Read 1033037 spots for SRR3208043.sra Written 1033037 spots for SRR3208043.sra Read 1033037 spots for SRR3208043.sra Written 1033037 spots for SRR3208043.sra Read 1033037 spots for SRR3208043.sra Written 1033037 spots for SRR3208043.sra Read 1033037 spots for SRR3208043.sra Written 1033037 spots for SRR3208043.sra Read 1033037 spots for SRR3208043.sra Written 1033037 spots for SRR3208043.sra Read 1033037 spots for SRR3208043.sra Written 1033037 spots for SRR3208043.sra Read 1033037 spots for SRR3208043.sra Written 1033037 spots for SRR3208043.sra Read 1033037 spots for SRR3208043.sra Written 1033037 spots for SRR3208043.sra Read 1033037 spots for SRR3208043.sra Written 1033037 spots for SRR3208043.sra Read 1033037 spots for SRR3208043.sra Written 1033037 spots for SRR3208043.sra Read 1033037 spots for SRR3208043.sra Written 1033037 spots for SRR3208043.sra Read 1033037 spots for SRR3208043.sra Written 1033037 spots for SRR3208043.sra Read 1033037 spots for SRR3208043.sra Written 1033037 spots for SRR3208043.sra Read 1033040 spots for SRR3208043.sra Written 1033040 spots for SRR3208043.sra Read 1033037 spots for SRR3208043.sra Written 1033037 spots for SRR3208043.sra Read 1033037 spots for SRR3208043.sra Written 1033037 spots for SRR3208043.sra SRR ids: ['SRR3208043.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_amh4ozbf SRR3208043.sra spots: 20660743 blocks: [[1, 1033037], [1033038, 2066074], [2066075, 3099111], [3099112, 4132148], [4132149, 5165185], [5165186, 6198222], [6198223, 7231259], [7231260, 8264296], [8264297, 9297333], [9297334, 10330370], [10330371, 11363407], [11363408, 12396444], [12396445, 13429481], [13429482, 14462518], [14462519, 15495555], [15495556, 16528592], [16528593, 17561629], [17561630, 18594666], [18594667, 19627703], [19627704, 20660743]] SRR3208043 file size 6617118 SRR3208043 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208043 SRR3208043_1.fastq Input file: SRR3208043_1.fastq trimmed: SRR3208043-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 03:25:42 2025 >> started Wed Feb 12 03:25:59 2025 >> done (16.525s) 20660743 reads processed; of these: 16899 ( 0.08%) short reads filtered out after trimming by size control 273735 ( 1.32%) empty reads filtered out after trimming by size control 20370109 (98.59%) reads available; of these: 2422167 (11.89%) trimmed reads available after processing 17947942 (88.11%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 652 0.00% 19 692 0.00% 20 751 0.00% 21 743 0.00% 22 820 0.00% 23 905 0.00% 24 1113 0.01% 25 1256 0.01% 26 1191 0.01% 27 1169 0.01% 28 1242 0.01% 29 1275 0.01% 30 1788 0.01% 31 1692 0.01% 32 1197 0.01% 33 1100 0.01% 34 1110 0.01% 35 1108 0.01% 36 1194 0.01% 37 1107 0.01% 38 1149 0.01% 39 1204 0.01% 40 1199 0.01% 41 1223 0.01% 42 1178 0.01% 43 1192 0.01% 44 1154 0.01% 45 1291 0.01% 46 1316 0.01% 47 1262 0.01% 48 1311 0.01% 49 1394 0.01% 50 1398 0.01% 51 1395 0.01% 52 1415 0.01% 53 1405 0.01% 54 1425 0.01% 55 1530 0.01% 56 1544 0.01% 57 1649 0.01% 58 1695 0.01% 59 1891 0.01% 60 1953 0.01% 61 2001 0.01% 62 2069 0.01% 63 2119 0.01% 64 2693 0.01% 65 5330 0.03% 66 2614 0.01% 67 2381 0.01% 68 2535 0.01% 69 2687 0.01% 70 2777 0.01% 71 3089 0.02% 72 3228 0.02% 73 3493 0.02% 74 4144 0.02% 75 5158 0.03% 76 5790 0.03% 77 5154 0.03% 78 4840 0.02% 79 5236 0.03% 80 5691 0.03% 81 6528 0.03% 82 7489 0.04% 83 8136 0.04% 84 9086 0.04% 85 10012 0.05% 86 10777 0.05% 87 11994 0.06% 88 13354 0.07% 89 15283 0.08% 90 17406 0.09% 91 20536 0.10% 92 23179 0.11% 93 25670 0.13% 94 3379 0.02% 95 3418 0.02% 96 3568 0.02% 97 3890 0.02% 98 3932 0.02% 99 4129 0.02% 100 4452 0.02% 101 4733 0.02% 102 5059 0.02% 103 5246 0.03% 104 5555 0.03% 105 5987 0.03% 106 6369 0.03% 107 6583 0.03% 108 7270 0.04% 109 8029 0.04% 110 8869 0.04% 111 10028 0.05% 112 11158 0.05% 113 12734 0.06% 114 14499 0.07% 115 16748 0.08% 116 19724 0.10% 117 23557 0.12% 118 30374 0.15% 119 39638 0.19% 120 54478 0.27% 121 110071 0.54% 122 121265 0.60% 123 284720 1.40% 124 1275948 6.26% 125 17947942 88.11% 20370109 reads passed initial QC criterion=sequence-density sequence-density=5.89 sequence-density-rank=1 fanout-score=45.05 fanout-score-rank=1 prefix-density=7.82 prefix-fanout=33.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=5.89 sequence-density-rank=1 fanout-score=45.05 fanout-score-rank=1 prefix-density=7.82 prefix-fanout=33.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR3208043 - Input file: STDIN trimmed: SRR3208043-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 03:27:02 2025 >> started Wed Feb 12 03:27:24 2025 >> done (22.126s) 13580073 reads processed; of these: 289 ( 0.00%) short reads filtered out after trimming by size control 8127 ( 0.06%) empty reads filtered out after trimming by size control 13571657 (99.94%) reads available; of these: 2170144 (15.99%) trimmed reads available after processing 11401513 (84.01%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 445 0.00% 19 484 0.00% 20 517 0.00% 21 499 0.00% 22 551 0.00% 23 595 0.00% 24 740 0.01% 25 874 0.01% 26 803 0.01% 27 793 0.01% 28 808 0.01% 29 886 0.01% 30 1191 0.01% 31 1136 0.01% 32 823 0.01% 33 746 0.01% 34 716 0.01% 35 730 0.01% 36 802 0.01% 37 727 0.01% 38 805 0.01% 39 815 0.01% 40 816 0.01% 41 807 0.01% 42 754 0.01% 43 803 0.01% 44 751 0.01% 45 881 0.01% 46 890 0.01% 47 800 0.01% 48 873 0.01% 49 933 0.01% 50 905 0.01% 51 919 0.01% 52 935 0.01% 53 932 0.01% 54 946 0.01% 55 995 0.01% 56 1053 0.01% 57 1105 0.01% 58 1144 0.01% 59 1265 0.01% 60 1268 0.01% 61 1318 0.01% 62 1338 0.01% 63 1328 0.01% 64 1415 0.01% 65 1390 0.01% 66 1381 0.01% 67 1514 0.01% 68 1699 0.01% 69 1737 0.01% 70 1783 0.01% 71 2039 0.02% 72 2025 0.01% 73 2199 0.02% 74 2247 0.02% 75 2300 0.02% 76 2512 0.02% 77 2802 0.02% 78 3232 0.02% 79 3500 0.03% 80 3824 0.03% 81 4357 0.03% 82 4947 0.04% 83 5376 0.04% 84 6084 0.04% 85 6780 0.05% 86 7256 0.05% 87 8090 0.06% 88 9017 0.07% 89 10242 0.08% 90 11605 0.09% 91 13418 0.10% 92 15420 0.11% 93 17142 0.13% 94 19440 0.14% 95 21657 0.16% 96 22970 0.17% 97 25216 0.19% 98 28241 0.21% 99 30997 0.23% 100 34989 0.26% 101 39210 0.29% 102 43924 0.32% 103 48506 0.36% 104 52689 0.39% 105 55495 0.41% 106 58167 0.43% 107 61242 0.45% 108 63833 0.47% 109 68588 0.51% 110 74698 0.55% 111 81340 0.60% 112 88024 0.65% 113 94565 0.70% 114 100761 0.74% 115 105232 0.78% 116 109214 0.80% 117 111853 0.82% 118 118355 0.87% 119 128485 0.95% 120 154319 1.14% 121 236414 1.74% 122 423455 3.12% 123 165707 1.22% 124 744236 5.48% 125 9962257 73.40% criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=5.70 fanout-score-rank=24 prefix-density=0.12 prefix-fanout=3.6 sequence=TTCAACCAAGCGCG criterion=fanout-score sequence-density=0.05 sequence-density-rank=8 fanout-score=235.57 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=24.9 sequence=AAGAAGAAGAAA Started job on | Feb 12 03:27:52 Started mapping on | Feb 12 03:27:52 Finished on | Feb 12 03:28:25 Mapping speed, Million of reads per hour | 2221.28 Number of input reads | 20361693 Average input read length | 122 UNIQUE READS: Uniquely mapped reads number | 18638620 Uniquely mapped reads % | 91.54% Average mapped length | 121.98 Number of splices: Total | 6767350 Number of splices: Annotated (sjdb) | 6617394 Number of splices: GT/AG | 6656515 Number of splices: GC/AG | 90133 Number of splices: AT/AC | 7448 Number of splices: Non-canonical | 13254 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.21 Insertion rate per base | 0.02% Insertion average length | 1.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 425636 % of reads mapped to multiple loci | 2.09% Number of reads mapped to too many loci | 738114 % of reads mapped to too many loci | 3.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.73% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1297437 1297437 1297437 N_multimapping 425636 425636 425636 N_noFeature 922473 9685441 9734434 N_ambiguous 215389 37251 37458 UnstrandedReadsAssigned:17500758 PositiveStrandReadsAssigned:8915928 NegativeStrandReadsAssigned:8866728 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=123 echo kmer=119 SRR3208043 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208043-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,361,693 reads, 18,504,799 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,164 rounds 52401 SRR3208043.ke.tsv 34699 SRR3208043.se.tsv 87100 total ==> SRR3208043.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 735 27.9806 Potri.005G024800.1.v4.1 1035 936 330 25.7563 Potri.004G059700.1.v4.1 961 862 19 1.61024 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 317.501 8.15569 Potri.016G087400.1.v4.1 270 171 689 294.353 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 94.5999 4.12838 Potri.012G127500.1.v4.1 977 878 2872 238.965 ==> SRR3208043.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2441 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 369 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 38 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 63 SRR3208043 completed mapping pipeline successfully