Starting /dee2/code/volunteer_pipeline.sh SRR3208044 current disk space = 3048878247936 free memory = 1388623552 SRR3208044 SRAfilesize c6e971f41651064b1803a8ec164ee3b2 SRR3208044.sra SRR3208044.sra file validated SRR3208044 is single end SRR3208044 is conventional basespace SRR3208044 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208044_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3755 33.0 33.0 33.0 33.0 33.0 2 32.10075 33.0 33.0 33.0 33.0 33.0 3 32.1565 33.0 33.0 33.0 33.0 33.0 4 32.3435 33.0 33.0 33.0 33.0 33.0 5 32.34375 33.0 33.0 33.0 33.0 33.0 6 36.006 37.0 37.0 37.0 37.0 37.0 7 36.13525 37.0 37.0 37.0 37.0 37.0 8 36.26625 37.0 37.0 37.0 37.0 37.0 9 36.284 37.0 37.0 37.0 37.0 37.0 10-11 36.2715 37.0 37.0 37.0 37.0 37.0 12-13 36.331500000000005 37.0 37.0 37.0 37.0 37.0 14-15 36.294624999999996 37.0 37.0 37.0 37.0 37.0 16-17 36.292375 37.0 37.0 37.0 37.0 37.0 18-19 36.27825 37.0 37.0 37.0 37.0 37.0 20-21 36.30875 37.0 37.0 37.0 37.0 37.0 22-23 36.285 37.0 37.0 37.0 37.0 37.0 24-25 36.29375 37.0 37.0 37.0 37.0 37.0 26-27 36.281125 37.0 37.0 37.0 37.0 37.0 28-29 36.270125 37.0 37.0 37.0 37.0 37.0 30-31 36.303 37.0 37.0 37.0 37.0 37.0 32-33 36.198625 37.0 37.0 37.0 37.0 37.0 34-35 36.157125 37.0 37.0 37.0 37.0 37.0 36-37 36.227000000000004 37.0 37.0 37.0 37.0 37.0 38-39 36.26649999999999 37.0 37.0 37.0 37.0 37.0 40-41 36.19975 37.0 37.0 37.0 37.0 37.0 42-43 36.23225 37.0 37.0 37.0 37.0 37.0 44-45 36.228 37.0 37.0 37.0 37.0 37.0 46-47 36.217 37.0 37.0 37.0 37.0 37.0 48-49 36.24275 37.0 37.0 37.0 37.0 37.0 50-51 36.204750000000004 37.0 37.0 37.0 37.0 37.0 52-53 36.1505 37.0 37.0 37.0 37.0 37.0 54-55 36.256 37.0 37.0 37.0 37.0 37.0 56-57 36.2825 37.0 37.0 37.0 37.0 37.0 58-59 36.227875 37.0 37.0 37.0 37.0 37.0 60-61 36.176 37.0 37.0 37.0 37.0 37.0 62-63 36.212999999999994 37.0 37.0 37.0 37.0 37.0 64-65 36.236625000000004 37.0 37.0 37.0 37.0 37.0 66-67 36.188125 37.0 37.0 37.0 37.0 37.0 68-69 36.175124999999994 37.0 37.0 37.0 37.0 37.0 70-71 36.0875 37.0 37.0 37.0 37.0 37.0 72-73 36.078374999999994 37.0 37.0 37.0 37.0 37.0 74-75 36.10325 37.0 37.0 37.0 37.0 37.0 76-77 36.088375 37.0 37.0 37.0 37.0 37.0 78-79 36.071875 37.0 37.0 37.0 37.0 37.0 80-81 36.06975 37.0 37.0 37.0 37.0 37.0 82-83 36.091875 37.0 37.0 37.0 37.0 37.0 84-85 36.094625 37.0 37.0 37.0 37.0 37.0 86-87 36.018 37.0 37.0 37.0 37.0 37.0 88-89 36.049 37.0 37.0 37.0 37.0 37.0 90-91 36.021125 37.0 37.0 37.0 37.0 37.0 92-93 36.011625 37.0 37.0 37.0 37.0 37.0 94-95 36.06275 37.0 37.0 37.0 37.0 37.0 96-97 35.96725000000001 37.0 37.0 37.0 37.0 37.0 98-99 35.88075 37.0 37.0 37.0 37.0 37.0 100-101 35.915875 37.0 37.0 37.0 37.0 37.0 102-103 35.820625 37.0 37.0 37.0 37.0 37.0 104-105 35.777874999999995 37.0 37.0 37.0 37.0 37.0 106-107 35.857 37.0 37.0 37.0 37.0 37.0 108-109 35.778125 37.0 37.0 37.0 37.0 37.0 110-111 35.7365 37.0 37.0 37.0 37.0 37.0 112-113 35.65575 37.0 37.0 37.0 37.0 37.0 114-115 35.732749999999996 37.0 37.0 37.0 37.0 37.0 116-117 35.617374999999996 37.0 37.0 37.0 37.0 37.0 118-119 35.660375 37.0 37.0 37.0 37.0 37.0 120-121 35.565625 37.0 37.0 37.0 37.0 37.0 122-123 35.5835 37.0 37.0 37.0 37.0 37.0 124-125 33.992999999999995 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 0.0 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 1.0 13 2.0 14 1.0 15 1.0 16 2.0 17 2.0 18 0.0 19 3.0 20 1.0 21 3.0 22 3.0 23 7.0 24 6.0 25 7.0 26 9.0 27 15.0 28 15.0 29 23.0 30 35.0 31 41.0 32 63.0 33 87.0 34 136.0 35 263.0 36 3254.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.395587480759364 15.90559261159569 11.59569009748589 51.103129810159054 2 17.849999999999998 21.375 40.300000000000004 20.474999999999998 3 22.15 24.5 28.1 25.25 4 23.799999999999997 30.599999999999998 20.849999999999998 24.75 5 25.174999999999997 34.050000000000004 23.1 17.675 6 19.475 36.3 24.625 19.6 7 17.875 18.8 42.225 21.099999999999998 8 17.925 23.849999999999998 30.7 27.525 9 20.200000000000003 23.75 31.724999999999998 24.325 10-11 23.025000000000002 32.35 23.4125 21.212500000000002 12-13 19.6125 27.987499999999997 29.525000000000002 22.875 14-15 20.4625 27.287499999999998 29.075 23.175 16-17 21.975 28.0875 27.125 22.8125 18-19 21.75 28.799999999999997 27.5875 21.8625 20-21 21.7875 28.375 27.700000000000003 22.1375 22-23 22.037499999999998 27.725 27.962500000000002 22.275 24-25 21.575 28.3375 28.0625 22.025 26-27 20.974999999999998 28.349999999999998 27.650000000000002 23.025000000000002 28-29 22.093023255813954 27.969492373093274 27.881970492623154 22.05551387846962 30-31 21.520570213830187 28.210578967112664 27.997999249718646 22.2708515693385 32-33 21.528646484863646 28.48386289717288 28.008506379784837 21.978984238178633 34-35 21.223111555777887 29.314657328664335 26.513256628314156 22.948974487243625 36-37 21.590198774846854 28.316039504938118 27.378422302787847 22.715339417427177 38-39 22.090261282660332 29.5286910863858 27.415926990873857 20.96512064008001 40-41 20.877609701212652 29.26615826978372 26.778347293411674 23.07788473559195 42-43 21.45268158519815 27.87848481060132 28.041005125640705 22.62782847855982 44-45 22.4625 28.287499999999998 27.5625 21.6875 46-47 22.0125 28.1 28.000000000000004 21.8875 48-49 21.4375 28.275 27.725 22.5625 50-51 22.237499999999997 27.987499999999997 28.275 21.5 52-53 22.400000000000002 28.462500000000002 27.0 22.1375 54-55 22.075 28.537499999999998 27.437499999999996 21.95 56-57 21.212500000000002 28.675 28.512500000000003 21.6 58-59 21.7 28.7 27.962500000000002 21.637500000000003 60-61 21.725 27.8625 28.299999999999997 22.112499999999997 62-63 21.8125 27.750000000000004 28.4125 22.025 64-65 21.587500000000002 28.537499999999998 27.775 22.1 66-67 21.7875 28.799999999999997 27.5625 21.85 68-69 22.06801700425106 27.79444861215304 28.969742435608904 21.167791947987 70-71 22.1375 28.1875 27.712500000000002 21.9625 72-73 21.75 28.1125 28.8625 21.275 74-75 22.2 27.462500000000002 29.15 21.1875 76-77 22.565320665083135 27.19089886235779 28.678584823102888 21.565195649456182 78-79 21.905476369092273 28.394598649662417 27.831957989497376 21.867966991747938 80-81 21.710855427713856 27.501250625312657 28.85192596298149 21.935967983991997 82-83 21.502687835979497 28.691086385798226 27.803475434429302 22.00275034379297 84-85 22.0125 28.487499999999997 27.537499999999998 21.9625 86-87 22.3125 28.287499999999998 28.275 21.125 88-89 22.15 27.962500000000002 28.375 21.512500000000003 90-91 21.7 27.9125 28.375 22.0125 92-93 21.987499999999997 28.000000000000004 28.6125 21.4 94-95 21.825 28.725 27.987499999999997 21.462500000000002 96-97 22.025 27.875 28.3875 21.712500000000002 98-99 22.425 28.1875 27.9125 21.475 100-101 22.5875 28.125 27.200000000000003 22.0875 102-103 22.275 28.525 27.2625 21.9375 104-105 21.708140552707263 28.598224334125298 28.67325246967613 21.02038264349131 106-107 21.93322495935976 28.6857571589346 27.68538201825685 21.695635863448793 108-109 22.74318579644911 28.08202050512628 26.994248562140534 22.18054513628407 110-111 22.5625 28.849999999999998 27.737499999999997 20.849999999999998 112-113 22.675 28.487499999999997 27.287499999999998 21.55 114-115 23.0 27.8875 27.900000000000002 21.212500000000002 116-117 23.549999999999997 28.787499999999998 26.85 20.8125 118-119 23.0125 28.787499999999998 27.05 21.15 120-121 23.974999999999998 28.575 26.2125 21.2375 122-123 23.0 29.012500000000003 26.237500000000004 21.75 124-125 23.025000000000002 29.049999999999997 25.900000000000002 22.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 2.5 24 2.5 25 4.5 26 8.0 27 8.5 28 8.5 29 13.5 30 21.5 31 23.5 32 33.5 33 49.5 34 65.5 35 82.5 36 101.5 37 119.5 38 141.0 39 171.5 40 202.5 41 223.0 42 243.5 43 265.5 44 261.5 45 249.0 46 240.5 47 237.0 48 220.5 49 188.0 50 159.5 51 127.5 52 97.0 53 83.5 54 75.0 55 57.0 56 49.0 57 36.0 58 23.0 59 23.0 60 16.5 61 11.5 62 10.0 63 7.5 64 5.0 65 4.5 66 4.0 67 3.5 68 2.5 69 2.5 70 2.5 71 2.0 72 1.5 73 1.0 74 0.5 75 0.5 76 2.0 77 1.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.025 30-31 0.0375 32-33 0.075 34-35 0.05 36-37 0.0125 38-39 0.0125 40-41 0.0125 42-43 0.0125 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.025 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0125 78-79 0.025 80-81 0.05 82-83 0.0125 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0375 106-107 0.0375 108-109 0.025 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74918485076498 99.425 2 0.200652119388011 0.4 3 0.025081514923501375 0.075 4 0.025081514923501375 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.0875 0.0 0.0 0.0 0.0 12-13 0.125 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.125 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.7250000000000001 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.4625 0.0 0.0 0.0 0.0 104-105 1.8125 0.0 0.0 0.0 0.0 106-107 2.3375 0.0 0.0 0.0 0.0 108-109 3.1125 0.0 0.0 0.0 0.0 110-111 3.9125 0.0 0.0 0.0 0.0 112-113 4.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1066287 spots for SRR3208044.sra Written 1066287 spots for SRR3208044.sra Read 1066287 spots for SRR3208044.sra Written 1066287 spots for SRR3208044.sra Read 1066287 spots for SRR3208044.sra Written 1066287 spots for SRR3208044.sra Read 1066287 spots for SRR3208044.sra Written 1066287 spots for SRR3208044.sra Read 1066287 spots for SRR3208044.sra Written 1066287 spots for SRR3208044.sra Read 1066287 spots for SRR3208044.sra Written 1066287 spots for SRR3208044.sra Read 1066287 spots for SRR3208044.sra Written 1066287 spots for SRR3208044.sra Read 1066287 spots for SRR3208044.sra Written 1066287 spots for SRR3208044.sra Read 1066287 spots for SRR3208044.sra Written 1066287 spots for SRR3208044.sra Read 1066287 spots for SRR3208044.sra Written 1066287 spots for SRR3208044.sra Read 1066287 spots for SRR3208044.sra Written 1066287 spots for SRR3208044.sra Read 1066287 spots for SRR3208044.sra Written 1066287 spots for SRR3208044.sra Read 1066287 spots for SRR3208044.sra Written 1066287 spots for SRR3208044.sra Read 1066287 spots for SRR3208044.sra Written 1066287 spots for SRR3208044.sra Read 1066287 spots for SRR3208044.sra Written 1066287 spots for SRR3208044.sra Read 1066287 spots for SRR3208044.sra Written 1066287 spots for SRR3208044.sra Read 1066287 spots for SRR3208044.sra Written 1066287 spots for SRR3208044.sra Read 1066288 spots for SRR3208044.sra Written 1066288 spots for SRR3208044.sra Read 1066287 spots for SRR3208044.sra Written 1066287 spots for SRR3208044.sra Read 1066287 spots for SRR3208044.sra Written 1066287 spots for SRR3208044.sra SRR ids: ['SRR3208044.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1dj96a5w SRR3208044.sra spots: 21325741 blocks: [[1, 1066287], [1066288, 2132574], [2132575, 3198861], [3198862, 4265148], [4265149, 5331435], [5331436, 6397722], [6397723, 7464009], [7464010, 8530296], [8530297, 9596583], [9596584, 10662870], [10662871, 11729157], [11729158, 12795444], [12795445, 13861731], [13861732, 14928018], [14928019, 15994305], [15994306, 17060592], [17060593, 18126879], [18126880, 19193166], [19193167, 20259453], [20259454, 21325741]] SRR3208044 file size 6830443 SRR3208044 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208044 SRR3208044_1.fastq Input file: SRR3208044_1.fastq trimmed: SRR3208044-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 03:38:52 2025 >> started Wed Feb 12 03:39:04 2025 >> done (11.292s) 21325741 reads processed; of these: 16834 ( 0.08%) short reads filtered out after trimming by size control 105012 ( 0.49%) empty reads filtered out after trimming by size control 21203895 (99.43%) reads available; of these: 2359954 (11.13%) trimmed reads available after processing 18843941 (88.87%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 702 0.00% 19 937 0.00% 20 2740 0.01% 21 779 0.00% 22 813 0.00% 23 967 0.00% 24 1091 0.01% 25 1208 0.01% 26 1178 0.01% 27 1069 0.01% 28 1163 0.01% 29 1287 0.01% 30 1586 0.01% 31 1419 0.01% 32 1218 0.01% 33 1047 0.00% 34 1076 0.01% 35 1134 0.01% 36 1144 0.01% 37 1187 0.01% 38 1145 0.01% 39 1146 0.01% 40 1157 0.01% 41 1310 0.01% 42 1257 0.01% 43 1199 0.01% 44 1267 0.01% 45 1314 0.01% 46 1348 0.01% 47 1316 0.01% 48 1337 0.01% 49 1402 0.01% 50 1337 0.01% 51 1413 0.01% 52 1471 0.01% 53 1522 0.01% 54 1483 0.01% 55 1541 0.01% 56 1544 0.01% 57 1583 0.01% 58 1649 0.01% 59 1733 0.01% 60 1751 0.01% 61 1788 0.01% 62 1865 0.01% 63 1849 0.01% 64 2005 0.01% 65 2540 0.01% 66 2133 0.01% 67 2090 0.01% 68 2163 0.01% 69 2353 0.01% 70 2411 0.01% 71 2526 0.01% 72 2628 0.01% 73 2749 0.01% 74 2944 0.01% 75 3205 0.02% 76 3406 0.02% 77 3434 0.02% 78 3622 0.02% 79 4063 0.02% 80 4345 0.02% 81 4623 0.02% 82 5184 0.02% 83 5783 0.03% 84 6297 0.03% 85 6743 0.03% 86 7361 0.03% 87 8121 0.04% 88 8813 0.04% 89 10216 0.05% 90 11652 0.05% 91 13209 0.06% 92 15487 0.07% 93 17003 0.08% 94 3411 0.02% 95 3484 0.02% 96 3815 0.02% 97 3938 0.02% 98 3922 0.02% 99 4075 0.02% 100 4228 0.02% 101 4541 0.02% 102 4996 0.02% 103 5002 0.02% 104 5360 0.03% 105 5773 0.03% 106 6026 0.03% 107 6530 0.03% 108 7119 0.03% 109 8001 0.04% 110 8504 0.04% 111 9527 0.04% 112 10844 0.05% 113 12231 0.06% 114 14215 0.07% 115 16255 0.08% 116 19263 0.09% 117 23307 0.11% 118 30084 0.14% 119 38944 0.18% 120 53467 0.25% 121 112453 0.53% 122 120027 0.57% 123 285463 1.35% 124 1294568 6.11% 125 18843941 88.87% 21203895 reads passed initial QC criterion=sequence-density sequence-density=4.05 sequence-density-rank=1 fanout-score=48.00 fanout-score-rank=1 prefix-density=5.57 prefix-fanout=34.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=4.05 sequence-density-rank=1 fanout-score=48.00 fanout-score-rank=1 prefix-density=5.57 prefix-fanout=34.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR3208044 - Input file: STDIN trimmed: SRR3208044-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 03:40:03 2025 >> started Wed Feb 12 03:40:17 2025 >> done (13.982s) 12722337 reads processed; of these: 208 ( 0.00%) short reads filtered out after trimming by size control 1140 ( 0.01%) empty reads filtered out after trimming by size control 12720989 (99.99%) reads available; of these: 1638430 (12.88%) trimmed reads available after processing 11082559 (87.12%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 430 0.00% 19 557 0.00% 20 2699 0.02% 21 469 0.00% 22 476 0.00% 23 580 0.00% 24 637 0.01% 25 714 0.01% 26 683 0.01% 27 654 0.01% 28 724 0.01% 29 794 0.01% 30 977 0.01% 31 865 0.01% 32 718 0.01% 33 638 0.01% 34 628 0.00% 35 685 0.01% 36 689 0.01% 37 711 0.01% 38 693 0.01% 39 689 0.01% 40 691 0.01% 41 812 0.01% 42 808 0.01% 43 736 0.01% 44 756 0.01% 45 791 0.01% 46 781 0.01% 47 796 0.01% 48 769 0.01% 49 820 0.01% 50 816 0.01% 51 827 0.01% 52 862 0.01% 53 879 0.01% 54 900 0.01% 55 946 0.01% 56 929 0.01% 57 954 0.01% 58 1006 0.01% 59 1082 0.01% 60 1073 0.01% 61 1062 0.01% 62 1129 0.01% 63 1121 0.01% 64 1163 0.01% 65 1231 0.01% 66 1184 0.01% 67 1295 0.01% 68 1338 0.01% 69 1428 0.01% 70 1453 0.01% 71 1551 0.01% 72 1594 0.01% 73 1633 0.01% 74 1744 0.01% 75 1840 0.01% 76 1796 0.01% 77 1925 0.02% 78 2140 0.02% 79 2426 0.02% 80 2583 0.02% 81 2754 0.02% 82 3052 0.02% 83 3404 0.03% 84 3726 0.03% 85 4090 0.03% 86 4340 0.03% 87 4867 0.04% 88 5284 0.04% 89 6252 0.05% 90 7115 0.06% 91 7801 0.06% 92 9146 0.07% 93 10208 0.08% 94 11621 0.09% 95 12781 0.10% 96 13915 0.11% 97 15077 0.12% 98 16822 0.13% 99 18796 0.15% 100 21551 0.17% 101 24252 0.19% 102 27837 0.22% 103 31156 0.24% 104 33891 0.27% 105 36693 0.29% 106 38661 0.30% 107 41216 0.32% 108 43771 0.34% 109 47782 0.38% 110 52372 0.41% 111 57742 0.45% 112 64537 0.51% 113 70121 0.55% 114 76058 0.60% 115 79668 0.63% 116 84533 0.66% 117 88253 0.69% 118 94373 0.74% 119 104241 0.82% 120 130123 1.02% 121 210690 1.66% 122 391084 3.07% 123 153504 1.21% 124 697383 5.48% 125 9792066 76.98% criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=3.07 fanout-score-rank=32 prefix-density=0.11 prefix-fanout=3.1 sequence=CAAGGTGGGTACAACCAACAAGAGCACAGGGGCGGCGCACAAGGTGAGCGCAAGGAAGGGTTTGTTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=7 fanout-score=245.68 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=26.8 sequence=AAGAAGAAGAAA Started job on | Feb 12 03:40:43 Started mapping on | Feb 12 03:40:43 Finished on | Feb 12 03:41:15 Mapping speed, Million of reads per hour | 2385.29 Number of input reads | 21202547 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 19766654 Uniquely mapped reads % | 93.23% Average mapped length | 122.62 Number of splices: Total | 7211647 Number of splices: Annotated (sjdb) | 7027052 Number of splices: GT/AG | 7089200 Number of splices: GC/AG | 99952 Number of splices: AT/AC | 7422 Number of splices: Non-canonical | 15073 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.30 Insertion rate per base | 0.02% Insertion average length | 1.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 445320 % of reads mapped to multiple loci | 2.10% Number of reads mapped to too many loci | 554626 % of reads mapped to too many loci | 2.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.04% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 990573 990573 990573 N_multimapping 445320 445320 445320 N_noFeature 1082509 10362991 10355436 N_ambiguous 212586 41418 41095 UnstrandedReadsAssigned:18471559 PositiveStrandReadsAssigned:9362245 NegativeStrandReadsAssigned:9370123 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208044 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208044-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,202,547 reads, 19,276,286 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,238 rounds 52401 SRR3208044.ke.tsv 34699 SRR3208044.se.tsv 87100 total ==> SRR3208044.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1052 38.436 Potri.005G024800.1.v4.1 1035 936 2103 157.529 Potri.004G059700.1.v4.1 961 862 7 0.569362 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 446.201 11.0001 Potri.016G087400.1.v4.1 270 171 471 193.118 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 164 6.86888 Potri.012G127500.1.v4.1 977 878 6202 495.262 ==> SRR3208044.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1006 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 318 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 24 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 20 SRR3208044 completed mapping pipeline successfully