Starting /dee2/code/volunteer_pipeline.sh SRR3208045 current disk space = 3049053052928 free memory = 1579429736 SRR3208045 SRAfilesize 9bd855f6afc0a79f6913d8f46e70e0c4 SRR3208045.sra SRR3208045.sra file validated SRR3208045 is single end SRR3208045 is conventional basespace SRR3208045 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208045_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.72625 33.0 33.0 33.0 33.0 33.0 2 32.2085 33.0 33.0 33.0 33.0 33.0 3 32.2835 33.0 33.0 33.0 33.0 33.0 4 32.3225 33.0 33.0 33.0 33.0 33.0 5 32.28775 33.0 33.0 33.0 33.0 33.0 6 35.9785 37.0 37.0 37.0 37.0 37.0 7 36.18475 37.0 37.0 37.0 37.0 37.0 8 36.26775 37.0 37.0 37.0 37.0 37.0 9 36.26125 37.0 37.0 37.0 37.0 37.0 10-11 36.1885 37.0 37.0 37.0 37.0 37.0 12-13 36.191500000000005 37.0 37.0 37.0 37.0 37.0 14-15 36.252375 37.0 37.0 37.0 37.0 37.0 16-17 36.207 37.0 37.0 37.0 37.0 37.0 18-19 36.17525 37.0 37.0 37.0 37.0 37.0 20-21 36.222125000000005 37.0 37.0 37.0 37.0 37.0 22-23 36.233999999999995 37.0 37.0 37.0 37.0 37.0 24-25 36.20675 37.0 37.0 37.0 37.0 37.0 26-27 36.163124999999994 37.0 37.0 37.0 37.0 37.0 28-29 36.156625000000005 37.0 37.0 37.0 37.0 37.0 30-31 36.140125 37.0 37.0 37.0 37.0 37.0 32-33 36.182249999999996 37.0 37.0 37.0 37.0 37.0 34-35 36.089375000000004 37.0 37.0 37.0 37.0 37.0 36-37 36.054249999999996 37.0 37.0 37.0 37.0 37.0 38-39 36.11725 37.0 37.0 37.0 37.0 37.0 40-41 36.07025 37.0 37.0 37.0 37.0 37.0 42-43 36.10975 37.0 37.0 37.0 37.0 37.0 44-45 36.12875 37.0 37.0 37.0 37.0 37.0 46-47 36.111000000000004 37.0 37.0 37.0 37.0 37.0 48-49 36.106624999999994 37.0 37.0 37.0 37.0 37.0 50-51 36.104749999999996 37.0 37.0 37.0 37.0 37.0 52-53 36.0595 37.0 37.0 37.0 37.0 37.0 54-55 36.094375 37.0 37.0 37.0 37.0 37.0 56-57 36.075125 37.0 37.0 37.0 37.0 37.0 58-59 36.08525 37.0 37.0 37.0 37.0 37.0 60-61 36.071749999999994 37.0 37.0 37.0 37.0 37.0 62-63 36.028625000000005 37.0 37.0 37.0 37.0 37.0 64-65 36.0035 37.0 37.0 37.0 37.0 37.0 66-67 36.013125 37.0 37.0 37.0 37.0 37.0 68-69 36.07625 37.0 37.0 37.0 37.0 37.0 70-71 35.971875 37.0 37.0 37.0 37.0 37.0 72-73 35.972125 37.0 37.0 37.0 37.0 37.0 74-75 35.92525 37.0 37.0 37.0 37.0 37.0 76-77 36.0045 37.0 37.0 37.0 37.0 37.0 78-79 36.001999999999995 37.0 37.0 37.0 37.0 37.0 80-81 36.024249999999995 37.0 37.0 37.0 37.0 37.0 82-83 35.973 37.0 37.0 37.0 37.0 37.0 84-85 35.870999999999995 37.0 37.0 37.0 37.0 37.0 86-87 35.945125 37.0 37.0 37.0 37.0 37.0 88-89 35.85325 37.0 37.0 37.0 37.0 37.0 90-91 35.905625 37.0 37.0 37.0 37.0 37.0 92-93 35.911 37.0 37.0 37.0 37.0 37.0 94-95 35.86125 37.0 37.0 37.0 37.0 37.0 96-97 35.854 37.0 37.0 37.0 37.0 37.0 98-99 35.859375 37.0 37.0 37.0 37.0 37.0 100-101 35.759 37.0 37.0 37.0 37.0 37.0 102-103 35.726749999999996 37.0 37.0 37.0 37.0 37.0 104-105 35.696 37.0 37.0 37.0 37.0 37.0 106-107 35.809124999999995 37.0 37.0 37.0 37.0 37.0 108-109 35.77975 37.0 37.0 37.0 37.0 37.0 110-111 35.6935 37.0 37.0 37.0 37.0 37.0 112-113 35.65625 37.0 37.0 37.0 37.0 37.0 114-115 35.716125000000005 37.0 37.0 37.0 37.0 37.0 116-117 35.660375 37.0 37.0 37.0 37.0 37.0 118-119 35.552625 37.0 37.0 37.0 37.0 37.0 120-121 35.53325 37.0 37.0 37.0 37.0 37.0 122-123 35.512125 37.0 37.0 37.0 37.0 37.0 124-125 33.91775 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 35.0 3 1.0 4 2.0 5 2.0 6 1.0 7 0.0 8 0.0 9 2.0 10 0.0 11 2.0 12 1.0 13 2.0 14 1.0 15 1.0 16 3.0 17 0.0 18 2.0 19 1.0 20 0.0 21 1.0 22 4.0 23 3.0 24 6.0 25 10.0 26 6.0 27 15.0 28 16.0 29 22.0 30 30.0 31 28.0 32 50.0 33 65.0 34 106.0 35 211.0 36 3371.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.278738555442523 15.132248219735503 12.360122075279756 50.22889114954222 2 17.875 22.525000000000002 40.150000000000006 19.45 3 21.675 25.724999999999998 27.1 25.5 4 24.125 30.9 21.075 23.9 5 23.775 35.05 23.150000000000002 18.025 6 18.975 36.199999999999996 25.474999999999998 19.35 7 17.1 19.950000000000003 41.699999999999996 21.25 8 17.875 23.075000000000003 31.45 27.6 9 20.875 22.625 32.975 23.525 10-11 22.0 31.75 24.4125 21.837500000000002 12-13 20.325 27.1375 29.425 23.1125 14-15 21.325 27.450000000000003 29.212500000000002 22.0125 16-17 21.575 27.85 28.4125 22.162499999999998 18-19 22.0875 28.787499999999998 26.5375 22.5875 20-21 21.55 28.575 27.224999999999998 22.650000000000002 22-23 21.25 28.999999999999996 27.287499999999998 22.4625 24-25 22.125 28.249999999999996 27.8375 21.7875 26-27 21.027628453556694 28.378547318414803 28.316039504938118 22.277784723090384 28-29 21.94024253031629 28.291036379547442 28.166020752594072 21.602700337542196 30-31 21.14807403701851 27.776388194097045 28.92696348174087 22.14857428714357 32-33 21.673336668334166 28.76438219109555 27.801400700350175 21.76088044022011 34-35 21.64832416208104 28.12656328164082 27.963981990995496 22.26113056528264 36-37 22.05551387846962 27.981995498874717 28.08202050512628 21.880470117529384 38-39 21.762500000000003 28.787499999999998 27.3625 22.0875 40-41 21.5625 28.812500000000004 28.15 21.475 42-43 22.15 27.8625 28.8875 21.099999999999998 44-45 22.1375 28.525 28.3875 20.95 46-47 21.65 28.4 27.9375 22.0125 48-49 21.762500000000003 27.6375 28.599999999999998 22.0 50-51 22.3375 28.525 28.037499999999998 21.099999999999998 52-53 21.7 28.050000000000004 28.1375 22.112499999999997 54-55 20.925 28.5625 29.037499999999998 21.475 56-57 21.875 27.625 28.975 21.525 58-59 23.0875 27.800000000000004 27.2625 21.85 60-61 22.4625 28.249999999999996 27.8875 21.4 62-63 21.8625 28.675 27.700000000000003 21.762500000000003 64-65 21.5 28.575 28.000000000000004 21.925 66-67 21.6875 28.512500000000003 27.962500000000002 21.837500000000002 68-69 22.3875 28.475 27.55 21.587500000000002 70-71 22.6375 28.8875 26.450000000000003 22.025 72-73 23.375 28.1875 27.224999999999998 21.212500000000002 74-75 21.587500000000002 28.475 28.1 21.837500000000002 76-77 22.075 28.812500000000004 27.487499999999997 21.625 78-79 22.575 27.0125 28.712500000000002 21.7 80-81 21.837500000000002 28.4 27.975 21.7875 82-83 22.4625 28.349999999999998 28.1125 21.075 84-85 22.0625 27.925 28.3625 21.65 86-87 21.7875 28.012500000000003 28.812500000000004 21.3875 88-89 22.675 28.599999999999998 26.8125 21.912499999999998 90-91 22.15 27.8375 28.199999999999996 21.8125 92-93 22.55 28.1125 27.1375 22.2 94-95 22.05 27.800000000000004 28.299999999999997 21.85 96-97 22.6875 28.1875 27.650000000000002 21.475 98-99 21.4375 28.4375 28.625 21.5 100-101 22.5875 28.3625 26.950000000000003 22.1 102-103 21.912499999999998 28.7 27.487499999999997 21.9 104-105 22.5125 28.549999999999997 27.212500000000002 21.725 106-107 21.375 28.6125 28.3875 21.625 108-109 22.2 28.825 26.875 22.1 110-111 23.0 27.712500000000002 28.599999999999998 20.6875 112-113 22.6875 28.625 26.650000000000002 22.037499999999998 114-115 23.4875 28.499999999999996 26.525 21.4875 116-117 22.900000000000002 29.562500000000004 26.5375 21.0 118-119 23.0375 27.5125 27.725 21.725 120-121 22.275 29.25 27.35 21.125 122-123 22.95 29.1375 26.7125 21.2 124-125 23.525 28.749999999999996 26.75 20.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 0.5 24 1.0 25 2.0 26 3.5 27 5.5 28 14.0 29 19.5 30 22.5 31 27.5 32 32.0 33 38.0 34 56.0 35 75.0 36 96.0 37 120.0 38 139.0 39 164.5 40 197.0 41 222.0 42 246.0 43 284.0 44 285.5 45 264.5 46 262.5 47 248.0 48 222.0 49 195.5 50 168.5 51 126.0 52 91.0 53 79.5 54 65.0 55 45.0 56 29.5 57 28.0 58 27.5 59 22.5 60 14.0 61 10.0 62 7.5 63 5.0 64 4.0 65 5.0 66 4.5 67 3.0 68 5.0 69 4.0 70 1.5 71 1.0 72 0.5 73 1.0 74 2.0 75 1.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7000000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.0125 30-31 0.05 32-33 0.05 34-35 0.05 36-37 0.025 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.07500000000000001 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.35 0.0 0.0 0.0 0.0 104-105 1.775 0.0 0.0 0.0 0.0 106-107 2.2 0.0 0.0 0.0 0.0 108-109 2.775 0.0 0.0 0.0 0.0 110-111 3.4625 0.0 0.0 0.0 0.0 112-113 4.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 597799 spots for SRR3208045.sra Written 597799 spots for SRR3208045.sra Read 597799 spots for SRR3208045.sra Written 597799 spots for SRR3208045.sra Read 597799 spots for SRR3208045.sra Written 597799 spots for SRR3208045.sra Read 597799 spots for SRR3208045.sra Written 597799 spots for SRR3208045.sra Read 597799 spots for SRR3208045.sra Written 597799 spots for SRR3208045.sra Read 597799 spots for SRR3208045.sra Written 597799 spots for SRR3208045.sra Read 597799 spots for SRR3208045.sra Written 597799 spots for SRR3208045.sra Read 597799 spots for SRR3208045.sra Written 597799 spots for SRR3208045.sra Read 597799 spots for SRR3208045.sra Written 597799 spots for SRR3208045.sra Read 597799 spots for SRR3208045.sra Written 597799 spots for SRR3208045.sra Read 597799 spots for SRR3208045.sra Written 597799 spots for SRR3208045.sra Read 597799 spots for SRR3208045.sra Written 597799 spots for SRR3208045.sra Read 597799 spots for SRR3208045.sra Written 597799 spots for SRR3208045.sra Read 597799 spots for SRR3208045.sra Written 597799 spots for SRR3208045.sra Read 597812 spots for SRR3208045.sra Written 597812 spots for SRR3208045.sra Read 597799 spots for SRR3208045.sra Written 597799 spots for SRR3208045.sra Read 597799 spots for SRR3208045.sra Written 597799 spots for SRR3208045.sra Read 597799 spots for SRR3208045.sra Written 597799 spots for SRR3208045.sra Read 597799 spots for SRR3208045.sra Written 597799 spots for SRR3208045.sra Read 597799 spots for SRR3208045.sra Written 597799 spots for SRR3208045.sra SRR ids: ['SRR3208045.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lca1y5eu SRR3208045.sra spots: 11955993 blocks: [[1, 597799], [597800, 1195598], [1195599, 1793397], [1793398, 2391196], [2391197, 2988995], [2988996, 3586794], [3586795, 4184593], [4184594, 4782392], [4782393, 5380191], [5380192, 5977990], [5977991, 6575789], [6575790, 7173588], [7173589, 7771387], [7771388, 8369186], [8369187, 8966985], [8966986, 9564784], [9564785, 10162583], [10162584, 10760382], [10760383, 11358181], [11358182, 11955993]] SRR3208045 file size 3824599 SRR3208045 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208045 SRR3208045_1.fastq Input file: SRR3208045_1.fastq trimmed: SRR3208045-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 04:01:13 2025 >> started Wed Feb 12 04:01:20 2025 >> done (6.728s) 11955993 reads processed; of these: 11627 ( 0.10%) short reads filtered out after trimming by size control 58163 ( 0.49%) empty reads filtered out after trimming by size control 11886203 (99.42%) reads available; of these: 1332428 (11.21%) trimmed reads available after processing 10553775 (88.79%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 430 0.00% 19 393 0.00% 20 489 0.00% 21 475 0.00% 22 527 0.00% 23 575 0.00% 24 651 0.01% 25 743 0.01% 26 743 0.01% 27 621 0.01% 28 652 0.01% 29 685 0.01% 30 1013 0.01% 31 920 0.01% 32 702 0.01% 33 629 0.01% 34 623 0.01% 35 634 0.01% 36 670 0.01% 37 625 0.01% 38 602 0.01% 39 678 0.01% 40 653 0.01% 41 739 0.01% 42 696 0.01% 43 738 0.01% 44 711 0.01% 45 716 0.01% 46 777 0.01% 47 774 0.01% 48 715 0.01% 49 801 0.01% 50 807 0.01% 51 847 0.01% 52 846 0.01% 53 877 0.01% 54 854 0.01% 55 908 0.01% 56 930 0.01% 57 964 0.01% 58 1017 0.01% 59 1018 0.01% 60 958 0.01% 61 1100 0.01% 62 1123 0.01% 63 1122 0.01% 64 1127 0.01% 65 1078 0.01% 66 1180 0.01% 67 1202 0.01% 68 1228 0.01% 69 1270 0.01% 70 1400 0.01% 71 1463 0.01% 72 1553 0.01% 73 1640 0.01% 74 1692 0.01% 75 1673 0.01% 76 1834 0.02% 77 1937 0.02% 78 2124 0.02% 79 2348 0.02% 80 2447 0.02% 81 2843 0.02% 82 3161 0.03% 83 3466 0.03% 84 3687 0.03% 85 3889 0.03% 86 4406 0.04% 87 4730 0.04% 88 5247 0.04% 89 5902 0.05% 90 6988 0.06% 91 7807 0.07% 92 8934 0.08% 93 10261 0.09% 94 1867 0.02% 95 1979 0.02% 96 2058 0.02% 97 2248 0.02% 98 2261 0.02% 99 2432 0.02% 100 2515 0.02% 101 2601 0.02% 102 2852 0.02% 103 2838 0.02% 104 2980 0.03% 105 3188 0.03% 106 3508 0.03% 107 3879 0.03% 108 4221 0.04% 109 4597 0.04% 110 5094 0.04% 111 5653 0.05% 112 6370 0.05% 113 7247 0.06% 114 8186 0.07% 115 9447 0.08% 116 10918 0.09% 117 13354 0.11% 118 16432 0.14% 119 21900 0.18% 120 28261 0.24% 121 39101 0.33% 122 67922 0.57% 123 186140 1.57% 124 727091 6.12% 125 10553775 88.79% 11886203 reads passed initial QC criterion=sequence-density sequence-density=4.29 sequence-density-rank=1 fanout-score=48.65 fanout-score-rank=1 prefix-density=5.87 prefix-fanout=35.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC criterion=fanout-score sequence-density=4.29 sequence-density-rank=1 fanout-score=48.65 fanout-score-rank=1 prefix-density=5.87 prefix-fanout=35.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC -o SRR3208045 - Input file: STDIN trimmed: SRR3208045-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 04:01:51 2025 >> started Wed Feb 12 04:01:58 2025 >> done (7.779s) 7131722 reads processed; of these: 55 ( 0.00%) short reads filtered out after trimming by size control 151 ( 0.00%) empty reads filtered out after trimming by size control 7131516 (100.00%) reads available; of these: 950427 (13.33%) trimmed reads available after processing 6181089 (86.67%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 258 0.00% 19 231 0.00% 20 292 0.00% 21 295 0.00% 22 334 0.00% 23 356 0.00% 24 385 0.01% 25 452 0.01% 26 451 0.01% 27 393 0.01% 28 361 0.01% 29 390 0.01% 30 632 0.01% 31 550 0.01% 32 420 0.01% 33 376 0.01% 34 372 0.01% 35 381 0.01% 36 404 0.01% 37 375 0.01% 38 353 0.00% 39 404 0.01% 40 383 0.01% 41 427 0.01% 42 430 0.01% 43 449 0.01% 44 427 0.01% 45 451 0.01% 46 452 0.01% 47 485 0.01% 48 447 0.01% 49 473 0.01% 50 476 0.01% 51 517 0.01% 52 490 0.01% 53 532 0.01% 54 504 0.01% 55 533 0.01% 56 559 0.01% 57 574 0.01% 58 628 0.01% 59 600 0.01% 60 552 0.01% 61 685 0.01% 62 681 0.01% 63 657 0.01% 64 658 0.01% 65 656 0.01% 66 725 0.01% 67 716 0.01% 68 751 0.01% 69 763 0.01% 70 846 0.01% 71 906 0.01% 72 898 0.01% 73 918 0.01% 74 996 0.01% 75 975 0.01% 76 1076 0.02% 77 1181 0.02% 78 1324 0.02% 79 1409 0.02% 80 1469 0.02% 81 1716 0.02% 82 1937 0.03% 83 2089 0.03% 84 2238 0.03% 85 2358 0.03% 86 2634 0.04% 87 2886 0.04% 88 3160 0.04% 89 3642 0.05% 90 4203 0.06% 91 4563 0.06% 92 5365 0.08% 93 6156 0.09% 94 6879 0.10% 95 7584 0.11% 96 8081 0.11% 97 8893 0.12% 98 9896 0.14% 99 10991 0.15% 100 12750 0.18% 101 14354 0.20% 102 16817 0.24% 103 18272 0.26% 104 20037 0.28% 105 21690 0.30% 106 22939 0.32% 107 24208 0.34% 108 26000 0.36% 109 28177 0.40% 110 30776 0.43% 111 34296 0.48% 112 37774 0.53% 113 41025 0.58% 114 44039 0.62% 115 46799 0.66% 116 48517 0.68% 117 50898 0.71% 118 53792 0.75% 119 60060 0.84% 120 74199 1.04% 121 106322 1.49% 122 222311 3.12% 123 99735 1.40% 124 391731 5.49% 125 5451583 76.44% criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=51.10 fanout-score-rank=11 prefix-density=0.23 prefix-fanout=14.1 sequence=CACCACCACCATGGGCTCCCCAGCCACCATAGGTGTCAATAATGATCTTGCGTCCAGTGAGACCTGCATCACCATGAGGACCACCAATAAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=17 fanout-score=311.38 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=29.5 sequence=TTCTTCTTCTTT Started job on | Feb 12 04:02:27 Started mapping on | Feb 12 04:02:27 Finished on | Feb 12 04:02:45 Mapping speed, Million of reads per hour | 2377.20 Number of input reads | 11885997 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 11249730 Uniquely mapped reads % | 94.65% Average mapped length | 122.54 Number of splices: Total | 4148036 Number of splices: Annotated (sjdb) | 4063404 Number of splices: GT/AG | 4083916 Number of splices: GC/AG | 52221 Number of splices: AT/AC | 4172 Number of splices: Non-canonical | 7727 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.02% Deletion average length | 2.15 Insertion rate per base | 0.02% Insertion average length | 1.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 232210 % of reads mapped to multiple loci | 1.95% Number of reads mapped to too many loci | 135969 % of reads mapped to too many loci | 1.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.24% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 404057 404057 404057 N_multimapping 232210 232210 232210 N_noFeature 502361 5833458 5833358 N_ambiguous 127176 20901 21242 UnstrandedReadsAssigned:10620193 PositiveStrandReadsAssigned:5395371 NegativeStrandReadsAssigned:5395130 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208045 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208045-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,885,997 reads, 10,941,187 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,086 rounds 52401 SRR3208045.ke.tsv 34699 SRR3208045.se.tsv 87100 total ==> SRR3208045.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 364 24.4858 Potri.005G024800.1.v4.1 1035 936 83 11.447 Potri.004G059700.1.v4.1 961 862 10 1.49755 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 177.314 8.04824 Potri.016G087400.1.v4.1 270 171 451 340.462 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 37 2.85321 Potri.012G127500.1.v4.1 977 878 1833 269.498 ==> SRR3208045.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1316 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 203 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR3208045 completed mapping pipeline successfully