Starting /dee2/code/volunteer_pipeline.sh SRR3208046 current disk space = 3048919207936 free memory = 1579246632 SRR3208046 SRAfilesize ad3fe2c5f0eb4f1479dc8835486d3521 SRR3208046.sra SRR3208046.sra file validated SRR3208046 is single end SRR3208046 is conventional basespace SRR3208046 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208046_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.51 33.0 33.0 33.0 33.0 33.0 2 32.11775 33.0 33.0 33.0 33.0 33.0 3 32.22475 33.0 33.0 33.0 33.0 33.0 4 32.2505 33.0 33.0 33.0 33.0 33.0 5 32.307 33.0 33.0 33.0 33.0 33.0 6 36.01275 37.0 37.0 37.0 37.0 37.0 7 36.09825 37.0 37.0 37.0 37.0 37.0 8 36.072 37.0 37.0 37.0 37.0 37.0 9 36.12925 37.0 37.0 37.0 37.0 37.0 10-11 36.219125 37.0 37.0 37.0 37.0 37.0 12-13 36.179125 37.0 37.0 37.0 37.0 37.0 14-15 36.18875 37.0 37.0 37.0 37.0 37.0 16-17 36.217875 37.0 37.0 37.0 37.0 37.0 18-19 36.213625 37.0 37.0 37.0 37.0 37.0 20-21 36.18775 37.0 37.0 37.0 37.0 37.0 22-23 36.147375 37.0 37.0 37.0 37.0 37.0 24-25 36.18775 37.0 37.0 37.0 37.0 37.0 26-27 36.091625 37.0 37.0 37.0 37.0 37.0 28-29 36.121125000000006 37.0 37.0 37.0 37.0 37.0 30-31 36.078 37.0 37.0 37.0 37.0 37.0 32-33 36.08425 37.0 37.0 37.0 37.0 37.0 34-35 36.072 37.0 37.0 37.0 37.0 37.0 36-37 36.059375 37.0 37.0 37.0 37.0 37.0 38-39 36.114000000000004 37.0 37.0 37.0 37.0 37.0 40-41 36.0955 37.0 37.0 37.0 37.0 37.0 42-43 36.1 37.0 37.0 37.0 37.0 37.0 44-45 36.179625 37.0 37.0 37.0 37.0 37.0 46-47 36.163125 37.0 37.0 37.0 37.0 37.0 48-49 36.080124999999995 37.0 37.0 37.0 37.0 37.0 50-51 36.098375000000004 37.0 37.0 37.0 37.0 37.0 52-53 36.020625 37.0 37.0 37.0 37.0 37.0 54-55 36.030125 37.0 37.0 37.0 37.0 37.0 56-57 36.026125 37.0 37.0 37.0 37.0 37.0 58-59 36.047625 37.0 37.0 37.0 37.0 37.0 60-61 36.073625 37.0 37.0 37.0 37.0 37.0 62-63 36.033874999999995 37.0 37.0 37.0 37.0 37.0 64-65 35.99875 37.0 37.0 37.0 37.0 37.0 66-67 35.971000000000004 37.0 37.0 37.0 37.0 37.0 68-69 36.04 37.0 37.0 37.0 37.0 37.0 70-71 35.985375 37.0 37.0 37.0 37.0 37.0 72-73 35.987375 37.0 37.0 37.0 37.0 37.0 74-75 35.93325 37.0 37.0 37.0 37.0 37.0 76-77 35.9025 37.0 37.0 37.0 37.0 37.0 78-79 35.897125 37.0 37.0 37.0 37.0 37.0 80-81 35.84825 37.0 37.0 37.0 37.0 37.0 82-83 35.812625 37.0 37.0 37.0 37.0 37.0 84-85 35.819500000000005 37.0 37.0 37.0 37.0 37.0 86-87 35.7535 37.0 37.0 37.0 37.0 37.0 88-89 35.786375 37.0 37.0 37.0 37.0 37.0 90-91 35.692 37.0 37.0 37.0 37.0 37.0 92-93 35.761624999999995 37.0 37.0 37.0 37.0 37.0 94-95 35.738875 37.0 37.0 37.0 37.0 37.0 96-97 35.699 37.0 37.0 37.0 37.0 37.0 98-99 35.760625 37.0 37.0 37.0 37.0 37.0 100-101 35.624375 37.0 37.0 37.0 37.0 37.0 102-103 35.653625000000005 37.0 37.0 37.0 37.0 37.0 104-105 35.656625000000005 37.0 37.0 37.0 37.0 37.0 106-107 35.698 37.0 37.0 37.0 37.0 37.0 108-109 35.602625 37.0 37.0 37.0 37.0 37.0 110-111 35.58575 37.0 37.0 37.0 37.0 37.0 112-113 35.542249999999996 37.0 37.0 37.0 37.0 37.0 114-115 35.539874999999995 37.0 37.0 37.0 37.0 37.0 116-117 35.475125000000006 37.0 37.0 37.0 37.0 37.0 118-119 35.466125000000005 37.0 37.0 37.0 37.0 37.0 120-121 35.343125 37.0 37.0 37.0 37.0 37.0 122-123 35.377750000000006 37.0 37.0 37.0 37.0 37.0 124-125 33.56425 37.0 35.0 37.0 17.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 31.0 3 1.0 4 2.0 5 2.0 6 2.0 7 1.0 8 1.0 9 1.0 10 0.0 11 3.0 12 1.0 13 2.0 14 1.0 15 1.0 16 0.0 17 2.0 18 2.0 19 3.0 20 2.0 21 6.0 22 8.0 23 3.0 24 5.0 25 11.0 26 13.0 27 8.0 28 9.0 29 16.0 30 40.0 31 41.0 32 57.0 33 82.0 34 112.0 35 227.0 36 3304.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.56580628673652 15.077945310503448 12.29235880398671 50.063889598773315 2 18.15 21.675 40.875 19.3 3 21.7 25.324999999999996 28.325 24.65 4 25.4 29.825000000000003 21.099999999999998 23.674999999999997 5 25.4 33.324999999999996 22.575 18.7 6 18.525 36.6 24.575 20.3 7 16.675 19.5 43.275000000000006 20.549999999999997 8 18.25 23.674999999999997 31.424999999999997 26.650000000000002 9 19.6 23.425 32.9 24.075 10-11 21.0375 34.2 23.549999999999997 21.212500000000002 12-13 20.2625 27.175 29.2 23.3625 14-15 21.15 28.462500000000002 27.950000000000003 22.4375 16-17 22.325 28.712500000000002 26.5375 22.425 18-19 22.1 28.3875 27.3125 22.2 20-21 22.475 27.625 27.462500000000002 22.4375 22-23 21.7375 28.3625 27.962500000000002 21.9375 24-25 21.2625 28.1375 27.525 23.075000000000003 26-27 21.4 29.562500000000004 27.187499999999996 21.85 28-29 21.1375 29.1875 27.712500000000002 21.9625 30-31 20.980245061265315 27.35683920980245 28.93223305826457 22.73068267066767 32-33 22.218054513628406 27.94448612153038 27.46936734183546 22.36809202300575 34-35 22.152769096137018 28.453556694586823 27.265908238529818 22.127765970746342 36-37 21.077634704338042 28.216027003375423 27.753469183647955 22.95286910863858 38-39 21.6 28.287499999999998 27.787499999999998 22.325 40-41 22.025 27.500000000000004 27.712500000000002 22.7625 42-43 20.7125 28.1375 27.8625 23.2875 44-45 22.0625 28.499999999999996 27.474999999999998 21.9625 46-47 21.725 29.262500000000003 27.125 21.8875 48-49 21.712500000000002 28.9125 27.437499999999996 21.9375 50-51 21.512500000000003 28.0625 27.237499999999997 23.1875 52-53 21.8 28.212500000000002 27.950000000000003 22.037499999999998 54-55 21.7875 28.1625 28.075 21.975 56-57 21.925 27.8625 28.249999999999996 21.9625 58-59 22.037499999999998 27.85 28.512500000000003 21.6 60-61 22.1375 27.3 28.199999999999996 22.3625 62-63 21.4875 28.075 28.449999999999996 21.987499999999997 64-65 21.099999999999998 28.975 28.225 21.7 66-67 21.4 27.625 28.475 22.5 68-69 21.0625 28.7375 28.375 21.825 70-71 21.3625 29.3375 28.025 21.275 72-73 22.25 27.8875 27.237499999999997 22.625 74-75 22.85 28.6375 26.775 21.7375 76-77 22.5625 28.575 27.237499999999997 21.625 78-79 21.475 28.7375 27.5125 22.275 80-81 21.7375 28.849999999999998 28.4 21.0125 82-83 22.0625 28.749999999999996 27.3375 21.85 84-85 20.962500000000002 27.9125 27.975 23.150000000000002 86-87 21.875 27.712500000000002 28.512500000000003 21.9 88-89 22.4625 28.549999999999997 27.712500000000002 21.275 90-91 22.425 28.875 26.887499999999996 21.8125 92-93 22.3375 28.000000000000004 29.2375 20.424999999999997 94-95 22.15 28.199999999999996 27.5625 22.0875 96-97 21.3 28.1375 28.449999999999996 22.112499999999997 98-99 22.9875 27.925 27.437499999999996 21.65 100-101 21.825 29.025000000000002 27.650000000000002 21.5 102-103 21.912499999999998 28.4375 27.35 22.3 104-105 22.125 28.425 28.349999999999998 21.099999999999998 106-107 22.75 28.599999999999998 27.150000000000002 21.5 108-109 21.575 28.9 27.575 21.95 110-111 22.85 27.750000000000004 27.9125 21.4875 112-113 23.4375 28.775000000000002 26.424999999999997 21.3625 114-115 22.7125 28.6125 26.937499999999996 21.7375 116-117 22.8 28.9875 26.700000000000003 21.512500000000003 118-119 22.525000000000002 29.549999999999997 26.637499999999996 21.2875 120-121 23.6625 28.1125 26.35 21.875 122-123 23.3125 28.012500000000003 27.0625 21.6125 124-125 22.7625 30.4875 26.487500000000004 20.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 2.5 26 6.0 27 8.0 28 7.5 29 11.0 30 18.0 31 23.5 32 38.5 33 56.0 34 59.0 35 71.0 36 86.5 37 111.5 38 143.0 39 162.0 40 184.0 41 209.0 42 256.0 43 294.0 44 285.0 45 267.5 46 265.0 47 252.5 48 218.0 49 184.5 50 158.0 51 134.0 52 111.5 53 87.5 54 71.0 55 49.5 56 31.0 57 29.5 58 24.5 59 14.5 60 10.5 61 9.5 62 6.0 63 6.5 64 6.5 65 7.0 66 6.0 67 2.5 68 2.0 69 1.0 70 1.0 71 1.5 72 0.5 73 1.5 74 2.0 75 1.0 76 1.0 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.025 32-33 0.025 34-35 0.0125 36-37 0.0125 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7739829231542 99.325 2 0.20090406830738325 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025113008538422906 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC 11 0.27499999999999997 TruSeq Adapter, Index 4 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.23750000000000002 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.6499999999999999 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.5625 0.0 0.0 0.0 0.0 104-105 2.0 0.0 0.0 0.0 0.0 106-107 2.5625 0.0 0.0 0.0 0.0 108-109 3.2 0.0 0.0 0.0 0.0 110-111 3.9749999999999996 0.0 0.0 0.0 0.0 112-113 4.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGAAGA 40 0.005061612 29.740625 118-119 ATCGGAA 40 0.005061612 29.740625 116-117 AGATCGG 45 0.008998546 26.43611 114-115 >>END_MODULE Read 975029 spots for SRR3208046.sra Written 975029 spots for SRR3208046.sra Read 975029 spots for SRR3208046.sra Written 975029 spots for SRR3208046.sra Read 975029 spots for SRR3208046.sra Written 975029 spots for SRR3208046.sra Read 975029 spots for SRR3208046.sra Written 975029 spots for SRR3208046.sra Read 975029 spots for SRR3208046.sra Written 975029 spots for SRR3208046.sra Read 975029 spots for SRR3208046.sra Written 975029 spots for SRR3208046.sra Read 975029 spots for SRR3208046.sra Written 975029 spots for SRR3208046.sra Read 975029 spots for SRR3208046.sra Written 975029 spots for SRR3208046.sra Read 975029 spots for SRR3208046.sra Written 975029 spots for SRR3208046.sra Read 975029 spots for SRR3208046.sra Written 975029 spots for SRR3208046.sra Read 975029 spots for SRR3208046.sra Written 975029 spots for SRR3208046.sra Read 975029 spots for SRR3208046.sra Written 975029 spots for SRR3208046.sra Read 975029 spots for SRR3208046.sra Written 975029 spots for SRR3208046.sra Read 975029 spots for SRR3208046.sra Written 975029 spots for SRR3208046.sra Read 975029 spots for SRR3208046.sra Written 975029 spots for SRR3208046.sra Read 975029 spots for SRR3208046.sra Written 975029 spots for SRR3208046.sra Read 975029 spots for SRR3208046.sra Written 975029 spots for SRR3208046.sra Read 975029 spots for SRR3208046.sra Written 975029 spots for SRR3208046.sra Read 975046 spots for SRR3208046.sra Written 975046 spots for SRR3208046.sra Read 975029 spots for SRR3208046.sra Written 975029 spots for SRR3208046.sra SRR ids: ['SRR3208046.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lk2gsix3 SRR3208046.sra spots: 19500597 blocks: [[1, 975029], [975030, 1950058], [1950059, 2925087], [2925088, 3900116], [3900117, 4875145], [4875146, 5850174], [5850175, 6825203], [6825204, 7800232], [7800233, 8775261], [8775262, 9750290], [9750291, 10725319], [10725320, 11700348], [11700349, 12675377], [12675378, 13650406], [13650407, 14625435], [14625436, 15600464], [15600465, 16575493], [16575494, 17550522], [17550523, 18525551], [18525552, 19500597]] SRR3208046 file size 6244891 SRR3208046 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208046 SRR3208046_1.fastq Input file: SRR3208046_1.fastq trimmed: SRR3208046-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 03:24:03 2025 >> started Wed Feb 12 03:24:13 2025 >> done (10.119s) 19500597 reads processed; of these: 20136 ( 0.10%) short reads filtered out after trimming by size control 131847 ( 0.68%) empty reads filtered out after trimming by size control 19348614 (99.22%) reads available; of these: 2141686 (11.07%) trimmed reads available after processing 17206928 (88.93%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 833 0.00% 19 941 0.00% 20 3462 0.02% 21 953 0.00% 22 853 0.00% 23 1116 0.01% 24 1256 0.01% 25 1310 0.01% 26 1277 0.01% 27 1142 0.01% 28 1161 0.01% 29 1365 0.01% 30 1873 0.01% 31 1908 0.01% 32 1079 0.01% 33 1032 0.01% 34 1029 0.01% 35 1040 0.01% 36 1119 0.01% 37 1073 0.01% 38 1051 0.01% 39 1065 0.01% 40 1129 0.01% 41 1124 0.01% 42 1166 0.01% 43 1232 0.01% 44 1163 0.01% 45 1226 0.01% 46 1253 0.01% 47 1231 0.01% 48 1243 0.01% 49 1206 0.01% 50 1315 0.01% 51 1312 0.01% 52 1380 0.01% 53 1358 0.01% 54 1344 0.01% 55 1490 0.01% 56 1507 0.01% 57 1640 0.01% 58 1653 0.01% 59 1737 0.01% 60 1746 0.01% 61 1832 0.01% 62 1876 0.01% 63 3350 0.02% 64 2083 0.01% 65 1980 0.01% 66 1898 0.01% 67 2121 0.01% 68 2108 0.01% 69 2298 0.01% 70 2386 0.01% 71 2749 0.01% 72 2891 0.01% 73 3334 0.02% 74 3442 0.02% 75 3134 0.02% 76 3116 0.02% 77 3332 0.02% 78 3587 0.02% 79 4044 0.02% 80 4316 0.02% 81 4891 0.03% 82 5392 0.03% 83 5939 0.03% 84 6432 0.03% 85 6866 0.04% 86 7406 0.04% 87 8113 0.04% 88 9247 0.05% 89 10654 0.06% 90 11781 0.06% 91 13439 0.07% 92 15455 0.08% 93 17483 0.09% 94 3061 0.02% 95 3086 0.02% 96 3261 0.02% 97 3425 0.02% 98 3642 0.02% 99 3645 0.02% 100 4073 0.02% 101 3945 0.02% 102 4293 0.02% 103 4407 0.02% 104 4806 0.02% 105 5094 0.03% 106 5494 0.03% 107 5954 0.03% 108 6581 0.03% 109 7204 0.04% 110 7896 0.04% 111 8612 0.04% 112 9589 0.05% 113 11301 0.06% 114 12336 0.06% 115 14507 0.07% 116 17063 0.09% 117 20573 0.11% 118 25423 0.13% 119 33668 0.17% 120 44171 0.23% 121 61486 0.32% 122 106210 0.55% 123 296556 1.53% 124 1164956 6.02% 125 17206928 88.93% 19348614 reads passed initial QC criterion=sequence-density sequence-density=4.42 sequence-density-rank=1 fanout-score=47.29 fanout-score-rank=1 prefix-density=6.03 prefix-fanout=34.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=4.42 sequence-density-rank=1 fanout-score=47.29 fanout-score-rank=1 prefix-density=6.03 prefix-fanout=34.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA -o SRR3208046 - Input file: STDIN trimmed: SRR3208046-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 03:25:10 2025 >> started Wed Feb 12 03:25:22 2025 >> done (12.168s) 11609169 reads processed; of these: 245 ( 0.00%) short reads filtered out after trimming by size control 2708 ( 0.02%) empty reads filtered out after trimming by size control 11606216 (99.97%) reads available; of these: 1565857 (13.49%) trimmed reads available after processing 10040359 (86.51%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 516 0.00% 19 615 0.01% 20 2757 0.02% 21 588 0.01% 22 507 0.00% 23 654 0.01% 24 748 0.01% 25 804 0.01% 26 873 0.01% 27 668 0.01% 28 725 0.01% 29 831 0.01% 30 1117 0.01% 31 1130 0.01% 32 656 0.01% 33 650 0.01% 34 627 0.01% 35 616 0.01% 36 643 0.01% 37 638 0.01% 38 655 0.01% 39 610 0.01% 40 726 0.01% 41 668 0.01% 42 697 0.01% 43 752 0.01% 44 694 0.01% 45 777 0.01% 46 757 0.01% 47 728 0.01% 48 769 0.01% 49 721 0.01% 50 821 0.01% 51 777 0.01% 52 885 0.01% 53 858 0.01% 54 823 0.01% 55 912 0.01% 56 896 0.01% 57 995 0.01% 58 1039 0.01% 59 1047 0.01% 60 1078 0.01% 61 1080 0.01% 62 1116 0.01% 63 1095 0.01% 64 1190 0.01% 65 1151 0.01% 66 1126 0.01% 67 1225 0.01% 68 1253 0.01% 69 1362 0.01% 70 1400 0.01% 71 1578 0.01% 72 1557 0.01% 73 1638 0.01% 74 1689 0.01% 75 1685 0.01% 76 1844 0.02% 77 2029 0.02% 78 2213 0.02% 79 2455 0.02% 80 2567 0.02% 81 2875 0.02% 82 3193 0.03% 83 3535 0.03% 84 3764 0.03% 85 4173 0.04% 86 4410 0.04% 87 4883 0.04% 88 5467 0.05% 89 6265 0.05% 90 7173 0.06% 91 7996 0.07% 92 9199 0.08% 93 10412 0.09% 94 11789 0.10% 95 13058 0.11% 96 13937 0.12% 97 15364 0.13% 98 17176 0.15% 99 18999 0.16% 100 21595 0.19% 101 24359 0.21% 102 27580 0.24% 103 31003 0.27% 104 33961 0.29% 105 36088 0.31% 106 37994 0.33% 107 40275 0.35% 108 42813 0.37% 109 46159 0.40% 110 50766 0.44% 111 55756 0.48% 112 61614 0.53% 113 67654 0.58% 114 71735 0.62% 115 75679 0.65% 116 78608 0.68% 117 81706 0.70% 118 86551 0.75% 119 95694 0.82% 120 118532 1.02% 121 171839 1.48% 122 360533 3.11% 123 158449 1.37% 124 623628 5.37% 125 8875676 76.47% criterion=sequence-density sequence-density=0.05 sequence-density-rank=1 fanout-score=89.03 fanout-score-rank=10 prefix-density=0.27 prefix-fanout=17.6 sequence=TTCTTTCTTTCT criterion=fanout-score sequence-density=0.05 sequence-density-rank=16 fanout-score=326.62 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=29.9 sequence=TTCTTCTTCTTT Started job on | Feb 12 03:25:51 Started mapping on | Feb 12 03:25:51 Finished on | Feb 12 03:26:14 Mapping speed, Million of reads per hour | 3028.02 Number of input reads | 19345661 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 18482071 Uniquely mapped reads % | 95.54% Average mapped length | 122.51 Number of splices: Total | 7025639 Number of splices: Annotated (sjdb) | 6889089 Number of splices: GT/AG | 6917104 Number of splices: GC/AG | 89191 Number of splices: AT/AC | 6876 Number of splices: Non-canonical | 12468 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.12 Insertion rate per base | 0.02% Insertion average length | 1.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 390903 % of reads mapped to multiple loci | 2.02% Number of reads mapped to too many loci | 203249 % of reads mapped to too many loci | 1.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.38% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 472687 472687 472687 N_multimapping 390903 390903 390903 N_noFeature 756687 9556490 9555111 N_ambiguous 191529 32121 32658 UnstrandedReadsAssigned:17533855 PositiveStrandReadsAssigned:8893460 NegativeStrandReadsAssigned:8894302 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208046 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208046-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,345,661 reads, 18,039,571 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,075 rounds 52401 SRR3208046.ke.tsv 34699 SRR3208046.se.tsv 87100 total ==> SRR3208046.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 481 19.5077 Potri.005G024800.1.v4.1 1035 936 92 7.64976 Potri.004G059700.1.v4.1 961 862 22 1.98633 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 326.193 8.92648 Potri.016G087400.1.v4.1 270 171 826 375.941 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 78 3.62639 Potri.012G127500.1.v4.1 977 878 4205 372.741 ==> SRR3208046.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1626 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 388 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 32 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR3208046 completed mapping pipeline successfully