Starting /dee2/code/volunteer_pipeline.sh SRR3208047 current disk space = 3049118179328 free memory = 1579267700 SRR3208047 SRAfilesize 63dd820b0226903865662fa8c5f98e99 SRR3208047.sra SRR3208047.sra file validated SRR3208047 is single end SRR3208047 is conventional basespace SRR3208047 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3208047_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5995 33.0 33.0 33.0 33.0 33.0 2 32.18625 33.0 33.0 33.0 33.0 33.0 3 32.279 33.0 33.0 33.0 33.0 33.0 4 32.31775 33.0 33.0 33.0 33.0 33.0 5 32.41975 33.0 33.0 33.0 33.0 33.0 6 36.185 37.0 37.0 37.0 37.0 37.0 7 36.20225 37.0 37.0 37.0 37.0 37.0 8 36.2915 37.0 37.0 37.0 37.0 37.0 9 36.36125 37.0 37.0 37.0 37.0 37.0 10-11 36.31825 37.0 37.0 37.0 37.0 37.0 12-13 36.28375 37.0 37.0 37.0 37.0 37.0 14-15 36.288 37.0 37.0 37.0 37.0 37.0 16-17 36.32275 37.0 37.0 37.0 37.0 37.0 18-19 36.272375 37.0 37.0 37.0 37.0 37.0 20-21 36.311625 37.0 37.0 37.0 37.0 37.0 22-23 36.250875 37.0 37.0 37.0 37.0 37.0 24-25 36.302625 37.0 37.0 37.0 37.0 37.0 26-27 36.1885 37.0 37.0 37.0 37.0 37.0 28-29 36.248875 37.0 37.0 37.0 37.0 37.0 30-31 36.266125 37.0 37.0 37.0 37.0 37.0 32-33 36.27025 37.0 37.0 37.0 37.0 37.0 34-35 36.22425 37.0 37.0 37.0 37.0 37.0 36-37 36.232124999999996 37.0 37.0 37.0 37.0 37.0 38-39 36.264375 37.0 37.0 37.0 37.0 37.0 40-41 36.216 37.0 37.0 37.0 37.0 37.0 42-43 36.22775 37.0 37.0 37.0 37.0 37.0 44-45 36.258250000000004 37.0 37.0 37.0 37.0 37.0 46-47 36.271375 37.0 37.0 37.0 37.0 37.0 48-49 36.26649999999999 37.0 37.0 37.0 37.0 37.0 50-51 36.221000000000004 37.0 37.0 37.0 37.0 37.0 52-53 36.256874999999994 37.0 37.0 37.0 37.0 37.0 54-55 36.225125 37.0 37.0 37.0 37.0 37.0 56-57 36.208749999999995 37.0 37.0 37.0 37.0 37.0 58-59 36.1515 37.0 37.0 37.0 37.0 37.0 60-61 36.15712499999999 37.0 37.0 37.0 37.0 37.0 62-63 36.1075 37.0 37.0 37.0 37.0 37.0 64-65 36.149125 37.0 37.0 37.0 37.0 37.0 66-67 36.1185 37.0 37.0 37.0 37.0 37.0 68-69 36.1205 37.0 37.0 37.0 37.0 37.0 70-71 36.0945 37.0 37.0 37.0 37.0 37.0 72-73 36.088375 37.0 37.0 37.0 37.0 37.0 74-75 36.041875000000005 37.0 37.0 37.0 37.0 37.0 76-77 36.03125 37.0 37.0 37.0 37.0 37.0 78-79 36.037375 37.0 37.0 37.0 37.0 37.0 80-81 36.038375 37.0 37.0 37.0 37.0 37.0 82-83 36.007125 37.0 37.0 37.0 37.0 37.0 84-85 36.010999999999996 37.0 37.0 37.0 37.0 37.0 86-87 35.982875 37.0 37.0 37.0 37.0 37.0 88-89 35.9825 37.0 37.0 37.0 37.0 37.0 90-91 35.945875 37.0 37.0 37.0 37.0 37.0 92-93 35.96125 37.0 37.0 37.0 37.0 37.0 94-95 36.001625000000004 37.0 37.0 37.0 37.0 37.0 96-97 35.92075 37.0 37.0 37.0 37.0 37.0 98-99 35.893625 37.0 37.0 37.0 37.0 37.0 100-101 35.85225 37.0 37.0 37.0 37.0 37.0 102-103 35.83525 37.0 37.0 37.0 37.0 37.0 104-105 35.884 37.0 37.0 37.0 37.0 37.0 106-107 35.929625 37.0 37.0 37.0 37.0 37.0 108-109 35.82075 37.0 37.0 37.0 37.0 37.0 110-111 35.733125 37.0 37.0 37.0 37.0 37.0 112-113 35.6255 37.0 37.0 37.0 37.0 37.0 114-115 35.698375 37.0 37.0 37.0 37.0 37.0 116-117 35.628874999999994 37.0 37.0 37.0 37.0 37.0 118-119 35.68475 37.0 37.0 37.0 37.0 37.0 120-121 35.613749999999996 37.0 37.0 37.0 37.0 37.0 122-123 35.610125 37.0 37.0 37.0 37.0 37.0 124-125 33.924125000000004 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120-121 0.0 1101 122-123 0.0 1101 124-125 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 1.0 4 1.0 5 0.0 6 1.0 7 0.0 8 2.0 9 0.0 10 0.0 11 0.0 12 4.0 13 2.0 14 2.0 15 3.0 16 1.0 17 1.0 18 1.0 19 0.0 20 3.0 21 1.0 22 8.0 23 2.0 24 5.0 25 2.0 26 17.0 27 10.0 28 13.0 29 16.0 30 34.0 31 40.0 32 62.0 33 76.0 34 109.0 35 222.0 36 3340.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.395551009971875 15.39248274098696 13.500383533623115 47.71158271541805 2 19.375 22.15 38.550000000000004 19.925 3 21.825 24.175 27.925 26.075 4 23.474999999999998 32.05 20.25 24.224999999999998 5 23.599999999999998 34.575 24.25 17.575 6 18.85 36.475 24.525 20.150000000000002 7 16.875 19.35 43.475 20.3 8 19.334667333666832 23.386693346673336 30.015007503751878 27.263631815907953 9 20.025000000000002 23.45 31.3 25.224999999999998 10-11 22.675 33.8375 22.6 20.8875 12-13 19.650000000000002 27.275 29.325000000000003 23.75 14-15 20.5125 27.8125 29.549999999999997 22.125 16-17 22.7 27.925 27.575 21.8 18-19 22.075 28.1125 27.325 22.4875 20-21 21.4375 27.9125 28.425 22.225 22-23 21.375 28.262500000000003 28.462500000000002 21.9 24-25 21.3125 28.787499999999998 27.400000000000002 22.5 26-27 21.167791947987 28.51962990747687 27.906976744186046 22.405601400350086 28-29 21.773386693346673 27.63881940970485 27.226113056528263 23.36168084042021 30-31 20.410205102551277 28.47673836918459 28.08904452226113 23.024012006003 32-33 22.211105552776388 28.076538269134566 27.48874437218609 22.22361180590295 34-35 21.748374187093546 28.01400700350175 28.264132066033014 21.973486743371687 36-37 21.770663998999627 28.860822808553205 27.27272727272727 22.095785919719894 38-39 20.91772943235809 28.66966741685421 27.994498624656167 22.418104526131533 40-41 21.9375 27.5875 27.6875 22.787499999999998 42-43 21.477684710588825 27.928491061382672 27.203400425053132 23.39042380297537 44-45 21.725 28.812500000000004 28.1 21.3625 46-47 22.787499999999998 27.762500000000003 27.762500000000003 21.6875 48-49 21.775 27.425 28.075 22.725 50-51 21.512500000000003 29.075 27.1375 22.275 52-53 22.1375 28.5625 28.0625 21.2375 54-55 22.237499999999997 28.6375 27.150000000000002 21.975 56-57 21.3625 27.8875 27.9375 22.8125 58-59 22.0625 27.900000000000002 27.462500000000002 22.575 60-61 21.85 27.750000000000004 27.762500000000003 22.6375 62-63 22.35 27.800000000000004 27.85 22.0 64-65 21.3125 28.287499999999998 28.025 22.375 66-67 21.3625 27.975 28.962500000000002 21.7 68-69 21.825 28.225 28.037499999999998 21.912499999999998 70-71 21.95 28.725 27.325 22.0 72-73 21.425 28.175 27.700000000000003 22.7 74-75 21.25 28.525 28.625 21.6 76-77 21.8875 27.925 28.475 21.712500000000002 78-79 21.725 27.375 28.625 22.275 80-81 22.0625 28.349999999999998 28.012500000000003 21.575 82-83 21.762500000000003 27.450000000000003 28.037499999999998 22.75 84-85 21.8875 28.7375 27.575 21.8 86-87 21.425 29.4 27.9375 21.2375 88-89 21.3625 28.462500000000002 28.449999999999996 21.725 90-91 21.712500000000002 28.3375 28.4375 21.512500000000003 92-93 21.912499999999998 28.275 28.050000000000004 21.762500000000003 94-95 22.0125 27.8375 28.075 22.075 96-97 21.5375 28.499999999999996 27.825 22.1375 98-99 23.0 28.375 27.537499999999998 21.087500000000002 100-101 22.037499999999998 28.499999999999996 27.5125 21.95 102-103 22.5125 28.225 27.6125 21.65 104-105 21.85 28.749999999999996 27.224999999999998 22.175 106-107 22.4875 28.9 27.125 21.4875 108-109 22.112499999999997 28.787499999999998 27.212500000000002 21.8875 110-111 22.287499999999998 28.375 28.012500000000003 21.325 112-113 22.425 29.025000000000002 27.35 21.2 114-115 22.025 29.475 26.8125 21.6875 116-117 22.412499999999998 29.4375 26.55 21.6 118-119 23.35 28.1 27.200000000000003 21.349999999999998 120-121 22.75 28.1375 27.3 21.8125 122-123 22.2125 29.5875 26.25 21.95 124-125 22.5875 28.775000000000002 26.825 21.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 3.0 25 5.5 26 5.0 27 6.0 28 8.0 29 14.0 30 18.0 31 21.5 32 32.5 33 42.5 34 56.5 35 73.0 36 85.0 37 105.0 38 133.5 39 165.0 40 207.0 41 241.5 42 256.5 43 286.0 44 295.5 45 273.0 46 266.5 47 250.5 48 219.5 49 170.0 50 132.5 51 124.0 52 111.0 53 86.5 54 66.5 55 54.5 56 40.0 57 31.5 58 22.5 59 15.0 60 14.5 61 14.0 62 7.5 63 5.0 64 5.5 65 4.5 66 3.5 67 5.0 68 5.0 69 1.5 70 1.0 71 1.5 72 1.5 73 1.5 74 0.5 75 0.5 76 1.0 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.05 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.025 28-29 0.05 30-31 0.05 32-33 0.05 34-35 0.05 36-37 0.0375 38-39 0.025 40-41 0.0 42-43 0.0125 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79939819458376 99.5 2 0.17552657973921765 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025075225677031094 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC 6 0.15 TruSeq Adapter, Index 5 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.38749999999999996 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.375 0.0 0.0 0.0 0.0 104-105 1.775 0.0 0.0 0.0 0.0 106-107 2.125 0.0 0.0 0.0 0.0 108-109 2.575 0.0 0.0 0.0 0.0 110-111 3.0375 0.0 0.0 0.0 0.0 112-113 3.7125000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 859309 spots for SRR3208047.sra Written 859309 spots for SRR3208047.sra Read 859309 spots for SRR3208047.sra Written 859309 spots for SRR3208047.sra Read 859309 spots for SRR3208047.sra Written 859309 spots for SRR3208047.sra Read 859309 spots for SRR3208047.sra Written 859309 spots for SRR3208047.sra Read 859309 spots for SRR3208047.sra Written 859309 spots for SRR3208047.sra Read 859309 spots for SRR3208047.sra Written 859309 spots for SRR3208047.sra Read 859309 spots for SRR3208047.sra Written 859309 spots for SRR3208047.sra Read 859309 spots for SRR3208047.sra Written 859309 spots for SRR3208047.sra Read 859309 spots for SRR3208047.sra Written 859309 spots for SRR3208047.sra Read 859309 spots for SRR3208047.sra Written 859309 spots for SRR3208047.sra Read 859309 spots for SRR3208047.sra Written 859309 spots for SRR3208047.sra Read 859309 spots for SRR3208047.sra Written 859309 spots for SRR3208047.sra Read 859309 spots for SRR3208047.sra Written 859309 spots for SRR3208047.sra Read 859309 spots for SRR3208047.sra Written 859309 spots for SRR3208047.sra Read 859311 spots for SRR3208047.sra Written 859311 spots for SRR3208047.sra Read 859309 spots for SRR3208047.sra Written 859309 spots for SRR3208047.sra Read 859309 spots for SRR3208047.sra Written 859309 spots for SRR3208047.sra Read 859309 spots for SRR3208047.sra Written 859309 spots for SRR3208047.sra Read 859309 spots for SRR3208047.sra Written 859309 spots for SRR3208047.sra Read 859309 spots for SRR3208047.sra Written 859309 spots for SRR3208047.sra SRR ids: ['SRR3208047.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hz3ncnvp SRR3208047.sra spots: 17186182 blocks: [[1, 859309], [859310, 1718618], [1718619, 2577927], [2577928, 3437236], [3437237, 4296545], [4296546, 5155854], [5155855, 6015163], [6015164, 6874472], [6874473, 7733781], [7733782, 8593090], [8593091, 9452399], [9452400, 10311708], [10311709, 11171017], [11171018, 12030326], [12030327, 12889635], [12889636, 13748944], [13748945, 14608253], [14608254, 15467562], [15467563, 16326871], [16326872, 17186182]] SRR3208047 file size 5502431 SRR3208047 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3208047 SRR3208047_1.fastq Input file: SRR3208047_1.fastq trimmed: SRR3208047-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 04:05:40 2025 >> started Wed Feb 12 04:05:49 2025 >> done (9.022s) 17186182 reads processed; of these: 12198 ( 0.07%) short reads filtered out after trimming by size control 61862 ( 0.36%) empty reads filtered out after trimming by size control 17112122 (99.57%) reads available; of these: 1857924 (10.86%) trimmed reads available after processing 15254198 (89.14%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 547 0.00% 19 539 0.00% 20 620 0.00% 21 625 0.00% 22 663 0.00% 23 714 0.00% 24 895 0.01% 25 881 0.01% 26 916 0.01% 27 906 0.01% 28 875 0.01% 29 950 0.01% 30 1417 0.01% 31 1231 0.01% 32 827 0.00% 33 819 0.00% 34 840 0.00% 35 832 0.00% 36 859 0.01% 37 888 0.01% 38 873 0.01% 39 923 0.01% 40 850 0.00% 41 908 0.01% 42 937 0.01% 43 950 0.01% 44 932 0.01% 45 953 0.01% 46 977 0.01% 47 967 0.01% 48 993 0.01% 49 1091 0.01% 50 999 0.01% 51 1071 0.01% 52 1081 0.01% 53 1069 0.01% 54 1089 0.01% 55 1099 0.01% 56 1186 0.01% 57 1223 0.01% 58 1190 0.01% 59 1280 0.01% 60 1356 0.01% 61 1409 0.01% 62 1403 0.01% 63 1561 0.01% 64 1520 0.01% 65 1525 0.01% 66 1452 0.01% 67 1568 0.01% 68 1551 0.01% 69 1647 0.01% 70 1719 0.01% 71 1907 0.01% 72 1991 0.01% 73 2225 0.01% 74 2350 0.01% 75 2265 0.01% 76 2415 0.01% 77 2445 0.01% 78 2661 0.02% 79 2901 0.02% 80 3185 0.02% 81 3416 0.02% 82 3904 0.02% 83 4500 0.03% 84 4564 0.03% 85 4979 0.03% 86 5428 0.03% 87 5960 0.03% 88 6772 0.04% 89 7479 0.04% 90 8755 0.05% 91 9992 0.06% 92 11586 0.07% 93 12912 0.08% 94 2462 0.01% 95 2657 0.02% 96 2686 0.02% 97 2958 0.02% 98 2974 0.02% 99 3197 0.02% 100 3417 0.02% 101 3430 0.02% 102 3689 0.02% 103 3728 0.02% 104 3954 0.02% 105 4422 0.03% 106 4586 0.03% 107 5046 0.03% 108 5624 0.03% 109 6266 0.04% 110 6711 0.04% 111 7495 0.04% 112 8475 0.05% 113 9465 0.06% 114 11038 0.06% 115 12405 0.07% 116 14694 0.09% 117 17877 0.10% 118 22361 0.13% 119 29960 0.18% 120 39062 0.23% 121 54032 0.32% 122 93918 0.55% 123 262736 1.54% 124 1035811 6.05% 125 15254198 89.14% 17112122 reads passed initial QC criterion=sequence-density sequence-density=3.77 sequence-density-rank=1 fanout-score=51.83 fanout-score-rank=1 prefix-density=5.18 prefix-fanout=37.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=3.77 sequence-density-rank=1 fanout-score=51.83 fanout-score-rank=1 prefix-density=5.18 prefix-fanout=37.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGAAAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGAAAAAAA -o SRR3208047 - Input file: STDIN trimmed: SRR3208047-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Wed Feb 12 04:06:32 2025 >> started Wed Feb 12 04:06:41 2025 >> done (8.813s) 8556061 reads processed; of these: 104 ( 0.00%) short reads filtered out after trimming by size control 470 ( 0.01%) empty reads filtered out after trimming by size control 8555487 (99.99%) reads available; of these: 1039273 (12.15%) trimmed reads available after processing 7516214 (87.85%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 277 0.00% 19 256 0.00% 20 315 0.00% 21 311 0.00% 22 348 0.00% 23 374 0.00% 24 457 0.01% 25 481 0.01% 26 468 0.01% 27 449 0.01% 28 444 0.01% 29 456 0.01% 30 680 0.01% 31 608 0.01% 32 407 0.00% 33 404 0.00% 34 414 0.00% 35 439 0.01% 36 450 0.01% 37 431 0.01% 38 409 0.00% 39 450 0.01% 40 442 0.01% 41 497 0.01% 42 486 0.01% 43 482 0.01% 44 473 0.01% 45 510 0.01% 46 486 0.01% 47 488 0.01% 48 516 0.01% 49 586 0.01% 50 479 0.01% 51 507 0.01% 52 529 0.01% 53 548 0.01% 54 547 0.01% 55 515 0.01% 56 577 0.01% 57 607 0.01% 58 591 0.01% 59 645 0.01% 60 674 0.01% 61 711 0.01% 62 692 0.01% 63 714 0.01% 64 746 0.01% 65 773 0.01% 66 738 0.01% 67 782 0.01% 68 779 0.01% 69 845 0.01% 70 858 0.01% 71 953 0.01% 72 998 0.01% 73 1026 0.01% 74 1025 0.01% 75 1098 0.01% 76 1189 0.01% 77 1211 0.01% 78 1330 0.02% 79 1455 0.02% 80 1623 0.02% 81 1695 0.02% 82 1961 0.02% 83 2253 0.03% 84 2347 0.03% 85 2480 0.03% 86 2681 0.03% 87 3056 0.04% 88 3471 0.04% 89 3806 0.04% 90 4468 0.05% 91 4944 0.06% 92 5664 0.07% 93 6481 0.08% 94 7409 0.09% 95 8076 0.09% 96 8577 0.10% 97 9503 0.11% 98 10509 0.12% 99 11825 0.14% 100 13559 0.16% 101 15353 0.18% 102 17658 0.21% 103 19552 0.23% 104 21526 0.25% 105 23121 0.27% 106 24236 0.28% 107 25974 0.30% 108 27793 0.32% 109 30289 0.35% 110 32915 0.38% 111 36343 0.42% 112 40232 0.47% 113 43858 0.51% 114 47281 0.55% 115 50024 0.58% 116 52258 0.61% 117 54518 0.64% 118 58060 0.68% 119 65264 0.76% 120 81700 0.95% 121 121390 1.42% 122 260027 3.04% 123 118508 1.39% 124 469323 5.49% 125 6663460 77.89% criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=112.02 fanout-score-rank=9 prefix-density=0.36 prefix-fanout=17.7 sequence=GCTGCTGCTGCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=398.96 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=16.6 sequence=CAGCAGCAAGACAAACCGAATTATTCATAAGTACCAATAAAATAAGCATTGCGCAAAAGGGATAGGATAAATCACTCTTAAGCTTGAGGCTTCTCCCATTTGAGGGGCTTGACAACTTCCCAGGTGAAGTCTGGGTCATCCCTTCCAAAATGTCCGTATGCAGCTGTCTTCAAGAACCTATTACCCCCCCTCTTGAGATCCAGGTTGATGGTCATCATTCCAGGCCTAAAGTCAAAGCTCTCCTTCACAATCTTAAGGATCTCCTTGTCAGGAATTTTTCCAGTGCCATAGGTGTCCACAAAGACTGACAAAGGCTCAGGTACACCAATAGCATAGGA Started job on | Feb 12 04:07:09 Started mapping on | Feb 12 04:07:09 Finished on | Feb 12 04:07:30 Mapping speed, Million of reads per hour | 2933.41 Number of input reads | 17111548 Average input read length | 123 UNIQUE READS: Uniquely mapped reads number | 16302918 Uniquely mapped reads % | 95.27% Average mapped length | 122.77 Number of splices: Total | 6284632 Number of splices: Annotated (sjdb) | 6166792 Number of splices: GT/AG | 6188201 Number of splices: GC/AG | 79217 Number of splices: AT/AC | 6101 Number of splices: Non-canonical | 11113 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.13 Insertion rate per base | 0.02% Insertion average length | 1.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 338588 % of reads mapped to multiple loci | 1.98% Number of reads mapped to too many loci | 207218 % of reads mapped to too many loci | 1.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.52% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 470042 470042 470042 N_multimapping 338588 338588 338588 N_noFeature 667782 8436721 8428340 N_ambiguous 162527 28262 28924 UnstrandedReadsAssigned:15472609 PositiveStrandReadsAssigned:7837935 NegativeStrandReadsAssigned:7845654 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 SRR3208047 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3208047-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,111,548 reads, 15,943,177 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,081 rounds 52401 SRR3208047.ke.tsv 34699 SRR3208047.se.tsv 87100 total ==> SRR3208047.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 476 22.1942 Potri.005G024800.1.v4.1 1035 936 84 8.02991 Potri.004G059700.1.v4.1 961 862 12 1.24561 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 299.247 9.41472 Potri.016G087400.1.v4.1 270 171 703 367.847 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 58 3.10013 Potri.012G127500.1.v4.1 977 878 3682 375.229 ==> SRR3208047.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1252 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 320 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 26 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3208047 completed mapping pipeline successfully